Chem Shift validation: AVS_anomalous, AVS_full, LACS
BMRB Entry DOI: doi:10.13018/BMR4813
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Spronk, C.; Bonvin, A.; Radha, P.; Melacini, G.; Boelens, R.; Kaptein, R.. "The Solution Structure of Lac Repressor Headpiece 62 Complexed to a Symmetrical
Lac Operator
" Structure 7, 1483-1492 (1999).
Assembly members:
LAC REPRESSOR, polymer, 62 residues, Formula weight is not available
LAC OPERATOR, polymer, 22 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: 562 Superkingdom: Eubacteria Kingdom: not available Genus/species: Escherichia coli
Experimental source: Production method: recombinant technology Host organism: Escherichia coli Vector: PGP1-2, PET-HP62
Entity Sequences (FASTA):
LAC REPRESSOR: MKPVTLYDVAEYAGVSYQTV
SRVVNQASHVSAKTREKVEA
AMAELNYIPNRVAQQLAGKQ
SL
LAC OPERATOR: GAATTGTGAGCGCTCACAAT
TC
| Data type | Count |
| 1H chemical shifts | 595 |
| 13C chemical shifts | 169 |
| 15N chemical shifts | 66 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | LAC REPRESSOR HP62 A | 1 |
| 2 | LAC REPRESSOR HP62 B | 1 |
| 3 | LAC OPERATOR C | 2 |
| 4 | LAC OPERATOR D | 2 |
Entity 1, LAC REPRESSOR HP62 A 62 residues - Formula weight is not available
| 1 | MET | LYS | PRO | VAL | THR | LEU | TYR | ASP | VAL | ALA | ||||
| 2 | GLU | TYR | ALA | GLY | VAL | SER | TYR | GLN | THR | VAL | ||||
| 3 | SER | ARG | VAL | VAL | ASN | GLN | ALA | SER | HIS | VAL | ||||
| 4 | SER | ALA | LYS | THR | ARG | GLU | LYS | VAL | GLU | ALA | ||||
| 5 | ALA | MET | ALA | GLU | LEU | ASN | TYR | ILE | PRO | ASN | ||||
| 6 | ARG | VAL | ALA | GLN | GLN | LEU | ALA | GLY | LYS | GLN | ||||
| 7 | SER | LEU |
Entity 2, LAC OPERATOR C 22 residues - Formula weight is not available
| 1 | DG | DA | DA | DT | DT | DG | DT | DG | DA | DG | ||||
| 2 | DC | DG | DC | DT | DC | DA | DC | DA | DA | DT | ||||
| 3 | DT | DC |
typical_sample: LAC REPRESSOR, [U-100% 13C; U-100% 15N], 1.5 mM; LAC OPERATOR 1.5 mM
sample_cond_1: pH: 6.1; temperature: 315 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| NOESY | typical_sample | not available | sample_cond_1 |
| TOCSY | typical_sample | not available | sample_cond_1 |
| 1H-15N HSQC | typical_sample | not available | sample_cond_1 |
| 1H-13C HSQC | typical_sample | not available | sample_cond_1 |
| TIME-SHARED 13C-15N DOUBLE-HALF FILTERED NOESY | typical_sample | not available | sample_cond_1 |
| HNCA | typical_sample | not available | sample_cond_1 |
| HN(CO)CA | typical_sample | not available | sample_cond_1 |
| CBCA(CO)NNH | typical_sample | not available | sample_cond_1 |
| H(C)CH-DIPSY | typical_sample | not available | sample_cond_1 |
| (H)CCH-DIPSY | typical_sample | not available | sample_cond_1 |
| HC(C)H-DIPSY | typical_sample | not available | sample_cond_1 |
| 1H-15N NOESY-HSQC | typical_sample | not available | sample_cond_1 |
| 1H-13C NOESY-HSQC | typical_sample | not available | sample_cond_1 |
| 1H-15N TOCSY-HSQC | typical_sample | not available | sample_cond_1 |
| 1H-15N HMQC-NOESY-HSQC | typical_sample | not available | sample_cond_1 |
X-PLOR v3.851 - REFINEMENT, STRUCTURE CALCULATION
| BMRB | 1066 127 1494 1552 2956 32 5345 5791 661 736 848 849 96 |
| PDB | |
| DBJ | BAB20667 BAB33821 BAD00175 BAD20286 BAD20288 |
| EMBL | CAA07594 CAA07597 CAA11118 CAA11119 CAA11120 |
| GB | AAA24052 AAA56744 AAA56768 AAA57088 AAA57091 |
| REF | NP_286086 NP_308425 NP_414879 WP_000248559 WP_000248563 |
| SP | P03023 |
| AlphaFold | P03023 |
Download HSQC peak lists in one of the following formats:
CSV: Backbone
or all simulated peaks
SPARKY: Backbone
or all simulated peaks