Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR36202
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Liu, Xiaodan; Shen, Shengqi; Wu, Pengzhi; Li, Fudong; Liu, Xiaodan; Wang, Chongyuan; Gong, Qingguo; Wu, Jihui; Yao, Xuebiao; Zhang, Huafeng; Shi, Yunyu. "Structural insights into dimethylation of 12S rRNA by TFB1M: indispensable role in translation of mitochondrial genes and mitochondrial function." Nucleic Acids Res. 47, 7648-7665 (2019).
PubMed: 31251801
Assembly members:
RNA (28-MER), polymer, 28 residues, 9035.406 Da.
Natural source: Common Name: human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method:
Entity Sequences (FASTA):
RNA (28-MER): GGUAAGUGUACUGGAAAGUG
CACUUGCC
| Data type | Count |
| 13C chemical shifts | 165 |
| 15N chemical shifts | 25 |
| 1H chemical shifts | 201 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entity 1, entity_1 28 residues - 9035.406 Da.
| 1 | G | G | U | A | A | G | U | G | U | A | ||||
| 2 | C | U | G | G | A | A | A | G | U | G | ||||
| 3 | C | A | C | U | U | G | C | C |
15N_13C_sample: RNA (28-MER), [U-13C; U-15N], mM; H2O 90%; D2O, [U-2H], 10%
sample_2: RNA (28-MER), [U-13C; U-15N], mM; H2O 90%; D2O, [U-2H], 10%
sample_3: RNA (28-MER), [U-13C; U-15N], mM; H2O 90%; D2O, [U-2H], 10%
sample_4: RNA (28-MER), [U-13C; U-15N], mM; H2O 90%; D2O, [U-2H], 10%
sample_5: RNA (28-MER), [U-13C; U-15N], mM; H2O 90%; D2O, [U-2H], 10%
sample_conditions_1: ionic strength: 2 mM; pH: 6.5; pressure: 1 atm; temperature: 283 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 1H-15N HNN-COSY | 15N_13C_sample | isotropic | sample_conditions_1 |
| 1H-15N HSQC | 15N_13C_sample | isotropic | sample_conditions_1 |
| 1H-13C CT-HSQC | 15N_13C_sample | isotropic | sample_conditions_1 |
| 3D 13C NOESY-HSQC | 15N_13C_sample | isotropic | sample_conditions_1 |
| 13C HCCH-TOCSY | 15N_13C_sample | isotropic | sample_conditions_1 |
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement
CYANA, Guntert, Mumenthaler and Wuthrich - structure calculation
Sparky, Goddard - chemical shift assignment
Sparky, Goddard - peak picking