data_36202 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 36202 _Entry.Title ; Solution Structure for helix 45 in 3' end of 12S rRNA ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2018-07-19 _Entry.Accession_date 2020-07-10 _Entry.Last_release_date 2020-07-10 _Entry.Original_release_date 2020-07-10 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.2.0.16 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype SOLUTION _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_experimental_methods.ID _Entry_experimental_methods.Method _Entry_experimental_methods.Subtype _Entry_experimental_methods.Entry_ID 1 'SOLUTION NMR' 'SOLUTION NMR' 36202 stop_ loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 X. Liu X. . . . 36202 2 P. Wu P. . . . 36202 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID RNA . 36202 h45 . 36202 stem-loop . 36202 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 36202 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 165 36202 '15N chemical shifts' 25 36202 '1H chemical shifts' 201 36202 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2025-09-27 . original BMRB . 36202 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 6AAS 'BMRB Entry Tracking System' 36202 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 36202 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 31251801 _Citation.DOI 10.1093/nar/gkz505 _Citation.Full_citation . _Citation.Title ; Structural insights into dimethylation of 12S rRNA by TFB1M: indispensable role in translation of mitochondrial genes and mitochondrial function. ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'Nucleic Acids Res.' _Citation.Journal_name_full 'Nucleic acids research' _Citation.Journal_volume 47 _Citation.Journal_issue 14 _Citation.Journal_ASTM . _Citation.Journal_ISSN 0305-1048 _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 7648 _Citation.Page_last 7665 _Citation.Year 2019 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Xiaodan Liu X. . . . 36202 1 2 Shengqi Shen S. . . . 36202 1 3 Pengzhi Wu P. . . . 36202 1 4 Fudong Li F. . . . 36202 1 5 Xiaodan Liu X. . . . 36202 1 6 Chongyuan Wang C. . . . 36202 1 7 Qingguo Gong Q. . . . 36202 1 8 Jihui Wu J. . . . 36202 1 9 Xuebiao Yao X. . . . 36202 1 10 Huafeng Zhang H. . . . 36202 1 11 Yunyu Shi Y. . . . 36202 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 36202 _Assembly.ID 1 _Assembly.Name '12S rRNA' _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state 'not present' _Assembly.Molecular_mass 9035.406 _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 entity_1 1 $entity_1 A A yes . . . . . . 36202 1 stop_ loop_ _Chem_comp_assembly.Assembly_chem_comp_ID _Chem_comp_assembly.Entity_assembly_ID _Chem_comp_assembly.Entity_ID _Chem_comp_assembly.Comp_index_ID _Chem_comp_assembly.Comp_ID _Chem_comp_assembly.Seq_ID _Chem_comp_assembly.Auth_entity_assembly_ID _Chem_comp_assembly.Auth_asym_ID _Chem_comp_assembly.Auth_seq_ID _Chem_comp_assembly.Auth_comp_ID _Chem_comp_assembly.Auth_variant_ID _Chem_comp_assembly.Sequence_linking _Chem_comp_assembly.Cis_residue _Chem_comp_assembly.NEF_index _Chem_comp_assembly.Entry_ID _Chem_comp_assembly.Assembly_ID . 1 1 1 G 1 . A 1 G . start . . 36202 1 . 1 1 10 A 10 . A 10 A . middle . . 36202 1 . 1 1 11 C 11 . A 11 C . middle . . 36202 1 . 1 1 12 U 12 . A 12 U . middle . . 36202 1 . 1 1 13 G 13 . A 13 G . middle . . 36202 1 . 1 1 14 G 14 . A 14 G . middle . . 36202 1 . 1 1 15 A 15 . A 15 A . middle . . 36202 1 . 1 1 16 A 16 . A 16 A . middle . . 36202 1 . 1 1 17 A 17 . A 17 A . middle . . 36202 1 . 1 1 18 G 18 . A 18 G . middle . . 36202 1 . 1 1 19 U 19 . A 19 U . middle . . 36202 1 . 1 1 2 G 2 . A 2 G . middle . . 36202 1 . 1 1 20 G 20 . A 20 G . middle . . 36202 1 . 1 1 21 C 21 . A 21 C . middle . . 36202 1 . 1 1 22 A 22 . A 22 A . middle . . 36202 1 . 1 1 23 C 23 . A 23 C . middle . . 36202 1 . 1 1 24 U 24 . A 24 U . middle . . 36202 1 . 1 1 25 U 25 . A 25 U . middle . . 36202 1 . 1 1 26 G 26 . A 26 G . middle . . 36202 1 . 1 1 27 C 27 . A 27 C . middle . . 36202 1 . 1 1 28 C 28 . A 28 C . end . . 36202 1 . 1 1 3 U 3 . A 3 U . middle . . 36202 1 . 1 1 4 A 4 . A 4 A . middle . . 36202 1 . 1 1 5 A 5 . A 5 A . middle . . 36202 1 . 1 1 6 G 6 . A 6 G . middle . . 36202 1 . 1 1 7 U 7 . A 7 U . middle . . 36202 1 . 1 1 8 G 8 . A 8 G . middle . . 36202 1 . 1 1 9 U 9 . A 9 U . middle . . 36202 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 36202 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name 'RNA (28-MER)' _Entity.Type polymer _Entity.Polymer_common_type RNA _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGUAAGUGUACUGGAAAGUG CACUUGCC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 28 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method nat _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 9035.406 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 1 G . 36202 1 2 2 G . 36202 1 3 3 U . 36202 1 4 4 A . 36202 1 5 5 A . 36202 1 6 6 G . 36202 1 7 7 U . 36202 1 8 8 G . 36202 1 9 9 U . 36202 1 10 10 A . 36202 1 11 11 C . 36202 1 12 12 U . 36202 1 13 13 G . 36202 1 14 14 G . 36202 1 15 15 A . 36202 1 16 16 A . 36202 1 17 17 A . 36202 1 18 18 G . 36202 1 19 19 U . 36202 1 20 20 G . 36202 1 21 21 C . 36202 1 22 22 A . 36202 1 23 23 C . 36202 1 24 24 U . 36202 1 25 25 U . 36202 1 26 26 G . 36202 1 27 27 C . 36202 1 28 28 C . 36202 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 36202 1 . G 2 2 36202 1 . U 3 3 36202 1 . A 4 4 36202 1 . A 5 5 36202 1 . G 6 6 36202 1 . U 7 7 36202 1 . G 8 8 36202 1 . U 9 9 36202 1 . A 10 10 36202 1 . C 11 11 36202 1 . U 12 12 36202 1 . G 13 13 36202 1 . G 14 14 36202 1 . A 15 15 36202 1 . A 16 16 36202 1 . A 17 17 36202 1 . G 18 18 36202 1 . U 19 19 36202 1 . G 20 20 36202 1 . C 21 21 36202 1 . A 22 22 36202 1 . C 23 23 36202 1 . U 24 24 36202 1 . U 25 25 36202 1 . G 26 26 36202 1 . C 27 27 36202 1 . C 28 28 36202 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 36202 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 9606 organism . 'Homo sapiens' human . . Eukaryota Metazoa Homo sapiens . . . . . . . . . . . . . 36202 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_15N_13C_sample _Sample.Sf_category sample _Sample.Sf_framecode 15N_13C_sample _Sample.Entry_ID 36202 _Sample.ID 1 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '1 mM helix45, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (28-MER)' '[U-13C; U-15N]' 1 $assembly 1 $entity_1 . RNA . . . mM . . . . 36202 1 2 H2O 'natural abundance' . . . . . solvent 90 . . % . . . . 36202 1 3 D2O [U-2H] . . . . . solvent 10 . . % . . . . 36202 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 36202 _Sample.ID 2 _Sample.Name 15N_13C_sample _Sample.Type solution _Sample.Sub_type . _Sample.Details '1 mM [U-13C; U-15N]-Ade helix45, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (28-MER)' '[U-13C; U-15N]' 1 $assembly 1 $entity_1 . RNA . . . mM . . . . 36202 2 2 H2O 'natural abundance' . . . . . solvent 90 . . % . . . . 36202 2 3 D2O [U-2H] . . . . . solvent 10 . . % . . . . 36202 2 stop_ save_ save_sample_3 _Sample.Sf_category sample _Sample.Sf_framecode sample_3 _Sample.Entry_ID 36202 _Sample.ID 3 _Sample.Name 15N_13C_sample _Sample.Type solution _Sample.Sub_type . _Sample.Details '1 mM [U-13C; U-15N]-Cyt helix45, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (28-MER)' '[U-13C; U-15N]' 1 $assembly 1 $entity_1 . RNA . . . mM . . . . 36202 3 2 H2O 'natural abundance' . . . . . solvent 90 . . % . . . . 36202 3 3 D2O [U-2H] . . . . . solvent 10 . . % . . . . 36202 3 stop_ save_ save_sample_4 _Sample.Sf_category sample _Sample.Sf_framecode sample_4 _Sample.Entry_ID 36202 _Sample.ID 4 _Sample.Name 15N_13C_sample _Sample.Type solution _Sample.Sub_type . _Sample.Details '1 mM [U-13C; U-15N]-Gua helix45, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (28-MER)' '[U-13C; U-15N]' 1 $assembly 1 $entity_1 . RNA . . . mM . . . . 36202 4 2 H2O 'natural abundance' . . . . . solvent 90 . . % . . . . 36202 4 3 D2O [U-2H] . . . . . solvent 10 . . % . . . . 36202 4 stop_ save_ save_sample_5 _Sample.Sf_category sample _Sample.Sf_framecode sample_5 _Sample.Entry_ID 36202 _Sample.ID 5 _Sample.Name 15N_13C_sample _Sample.Type solution _Sample.Sub_type . _Sample.Details '1 mM [U-13C; U-15N]-Ura helix45, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (28-MER)' '[U-13C; U-15N]' 1 $assembly 1 $entity_1 . RNA . . . mM . . . . 36202 5 2 H2O 'natural abundance' . . . . . solvent 90 . . % . . . . 36202 5 3 D2O [U-2H] . . . . . solvent 10 . . % . . . . 36202 5 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 36202 _Sample_condition_list.ID 1 _Sample_condition_list.Name . _Sample_condition_list.Details conditions_1 loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 2 . mM 36202 1 pH 6.5 . pH 36202 1 pressure 1 . atm 36202 1 temperature 283 . K 36202 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 36202 _Software.ID 1 _Software.Type . _Software.Name Amber _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman' . . 36202 1 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID refinement . 36202 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 36202 _Software.ID 2 _Software.Type . _Software.Name CYANA _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Guntert, Mumenthaler and Wuthrich' . . 36202 2 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'structure calculation' . 36202 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 36202 _Software.ID 3 _Software.Type . _Software.Name Sparky _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Goddard . . 36202 3 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 36202 3 stop_ save_ save_software_4 _Software.Sf_category software _Software.Sf_framecode software_4 _Software.Entry_ID 36202 _Software.ID 4 _Software.Type . _Software.Name Sparky _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Goddard . . 36202 4 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'peak picking' . 36202 4 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 36202 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model AVANCE _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_NMR_spectrometer_list_1 _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list_1 _NMR_spectrometer_list.Entry_ID 36202 _NMR_spectrometer_list.ID 1 _NMR_spectrometer_list.Name . loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Bruker AVANCE . 600 . . . 36202 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 36202 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '1H-15N HNN-COSY' . . . . . . . . . . . . . 1 $15N_13C_sample isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36202 1 2 '1H-15N HSQC' . . . . . . . . . . . . . 1 $15N_13C_sample isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36202 1 3 '1H-13C CT-HSQC' . . . . . . . . . . . . . 1 $15N_13C_sample isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36202 1 4 '3D 13C NOESY-HSQC' . . . . . . . . . . . . . 1 $15N_13C_sample isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36202 1 5 '13C HCCH-TOCSY' . . . . . . . . . . . . . 1 $15N_13C_sample isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36202 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chemical_shift_reference_1 _Chem_shift_reference.Entry_ID 36202 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name . _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 'phosphoric acid' phosphorus . . . . ppm 80 internal direct 0.251449530 . . . . . 36202 1 H 1 water protons . . . . ppm 4.78 internal direct 1.0 . . . . . 36202 1 N 15 '[15N] nitric acid' nitrogen . . . . ppm 140 internal direct 0.101329118 . . . . . 36202 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 36202 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chemical_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '1H-15N HNN-COSY' 1 $15N_13C_sample isotropic 36202 1 2 '1H-15N HSQC' 1 $15N_13C_sample isotropic 36202 1 3 '1H-13C CT-HSQC' 1 $15N_13C_sample isotropic 36202 1 4 '3D 13C NOESY-HSQC' 1 $15N_13C_sample isotropic 36202 1 5 '13C HCCH-TOCSY' 1 $15N_13C_sample isotropic 36202 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 G H1' H 1 5.805 . . 1 . . . . A 1 G H1' . 36202 1 2 . 1 . 1 1 1 G H2' H 1 4.919 . . 1 . . . . A 1 G H2' . 36202 1 3 . 1 . 1 1 1 G H3' H 1 4.675 . . 1 . . . . A 1 G H3' . 36202 1 4 . 1 . 1 1 1 G H4' H 1 4.535 . . 1 . . . . A 1 G H4' . 36202 1 5 . 1 . 1 1 1 G H5' H 1 4.427 . . . . . . . A 1 G H5' . 36202 1 6 . 1 . 1 1 1 G H8 H 1 8.145 . . 1 . . . . A 1 G H8 . 36202 1 7 . 1 . 1 1 1 G C1' C 13 88.840 . . 1 . . . . A 1 G C1' . 36202 1 8 . 1 . 1 1 1 G C2' C 13 72.074 . . 1 . . . . A 1 G C2' . 36202 1 9 . 1 . 1 1 1 G C3' C 13 71.602 . . 1 . . . . A 1 G C3' . 36202 1 10 . 1 . 1 1 1 G C4' C 13 80.406 . . 1 . . . . A 1 G C4' . 36202 1 11 . 1 . 1 1 1 G C5' C 13 64.084 . . 1 . . . . A 1 G C5' . 36202 1 12 . 1 . 1 1 1 G C8 C 13 136.464 . . 1 . . . . A 1 G C8 . 36202 1 13 . 1 . 1 2 2 G H1 H 1 13.443 . . 1 . . . . A 2 G H1 . 36202 1 14 . 1 . 1 2 2 G H1' H 1 5.910 . . 1 . . . . A 2 G H1' . 36202 1 15 . 1 . 1 2 2 G H2' H 1 4.669 . . 1 . . . . A 2 G H2' . 36202 1 16 . 1 . 1 2 2 G H3' H 1 4.418 . . 1 . . . . A 2 G H3' . 36202 1 17 . 1 . 1 2 2 G H4' H 1 4.519 . . 1 . . . . A 2 G H4' . 36202 1 18 . 1 . 1 2 2 G H5' H 1 4.491 . . . . . . . A 2 G H5' . 36202 1 19 . 1 . 1 2 2 G H8 H 1 7.507 . . 1 . . . . A 2 G H8 . 36202 1 20 . 1 . 1 2 2 G C1' C 13 90.306 . . 1 . . . . A 2 G C1' . 36202 1 21 . 1 . 1 2 2 G C2' C 13 72.615 . . 1 . . . . A 2 G C2' . 36202 1 22 . 1 . 1 2 2 G C3' C 13 69.912 . . 1 . . . . A 2 G C3' . 36202 1 23 . 1 . 1 2 2 G C4' C 13 79.719 . . 1 . . . . A 2 G C4' . 36202 1 24 . 1 . 1 2 2 G C5' C 13 62.814 . . 1 . . . . A 2 G C5' . 36202 1 25 . 1 . 1 2 2 G C8 C 13 133.838 . . 1 . . . . A 2 G C8 . 36202 1 26 . 1 . 1 2 2 G N1 N 15 148.118 . . 1 . . . . A 2 G N1 . 36202 1 27 . 1 . 1 3 3 U H1' H 1 5.435 . . 1 . . . . A 3 U H1' . 36202 1 28 . 1 . 1 3 3 U H2' H 1 4.235 . . 1 . . . . A 3 U H2' . 36202 1 29 . 1 . 1 3 3 U H3 H 1 11.552 . . 1 . . . . A 3 U H3 . 36202 1 30 . 1 . 1 3 3 U H3' H 1 4.582 . . 1 . . . . A 3 U H3' . 36202 1 31 . 1 . 1 3 3 U H4' H 1 4.420 . . 1 . . . . A 3 U H4' . 36202 1 32 . 1 . 1 3 3 U H5 H 1 5.492 . . 1 . . . . A 3 U H5 . 36202 1 33 . 1 . 1 3 3 U H5' H 1 4.505 . . . . . . . A 3 U H5' . 36202 1 34 . 1 . 1 3 3 U H6 H 1 7.658 . . 1 . . . . A 3 U H6 . 36202 1 35 . 1 . 1 3 3 U C1' C 13 93.723 . . 1 . . . . A 3 U C1' . 36202 1 36 . 1 . 1 3 3 U C2' C 13 75.710 . . 1 . . . . A 3 U C2' . 36202 1 37 . 1 . 1 3 3 U C3' C 13 72.356 . . 1 . . . . A 3 U C3' . 36202 1 38 . 1 . 1 3 3 U C4' C 13 82.409 . . 1 . . . . A 3 U C4' . 36202 1 39 . 1 . 1 3 3 U C5' C 13 64.153 . . 1 . . . . A 3 U C5' . 36202 1 40 . 1 . 1 3 3 U C6 C 13 140.462 . . 1 . . . . A 3 U C6 . 36202 1 41 . 1 . 1 3 3 U N3 N 15 158.882 . . 1 . . . . A 3 U N3 . 36202 1 42 . 1 . 1 4 4 A H1' H 1 5.911 . . 1 . . . . A 4 A H1' . 36202 1 43 . 1 . 1 4 4 A H2 H 1 6.569 . . 1 . . . . A 4 A H2 . 36202 1 44 . 1 . 1 4 4 A H2' H 1 4.630 . . 1 . . . . A 4 A H2' . 36202 1 45 . 1 . 1 4 4 A H3' H 1 4.759 . . 1 . . . . A 4 A H3' . 36202 1 46 . 1 . 1 4 4 A H4' H 1 4.459 . . 1 . . . . A 4 A H4' . 36202 1 47 . 1 . 1 4 4 A H5' H 1 4.541 . . . . . . . A 4 A H5' . 36202 1 48 . 1 . 1 4 4 A H8 H 1 8.255 . . 1 . . . . A 4 A H8 . 36202 1 49 . 1 . 1 4 4 A C1' C 13 92.105 . . 1 . . . . A 4 A C1' . 36202 1 50 . 1 . 1 4 4 A C2 C 13 152.600 . . 1 . . . . A 4 A C2 . 36202 1 51 . 1 . 1 4 4 A C2' C 13 75.700 . . 1 . . . . A 4 A C2' . 36202 1 52 . 1 . 1 4 4 A C3' C 13 73.377 . . 1 . . . . A 4 A C3' . 36202 1 53 . 1 . 1 4 4 A C4' C 13 82.340 . . 1 . . . . A 4 A C4' . 36202 1 54 . 1 . 1 4 4 A C5' C 13 65.320 . . 1 . . . . A 4 A C5' . 36202 1 55 . 1 . 1 4 4 A C8 C 13 140.797 . . 1 . . . . A 4 A C8 . 36202 1 56 . 1 . 1 4 4 A N1 N 15 221.147 . . 1 . . . . A 4 A N1 . 36202 1 57 . 1 . 1 5 5 A H1' H 1 5.773 . . 1 . . . . A 5 A H1' . 36202 1 58 . 1 . 1 5 5 A H2 H 1 7.410 . . 1 . . . . A 5 A H2 . 36202 1 59 . 1 . 1 5 5 A H2' H 1 4.574 . . 1 . . . . A 5 A H2' . 36202 1 60 . 1 . 1 5 5 A H3' H 1 4.506 . . 1 . . . . A 5 A H3' . 36202 1 61 . 1 . 1 5 5 A H4' H 1 4.492 . . 1 . . . . A 5 A H4' . 36202 1 62 . 1 . 1 5 5 A H5' H 1 4.414 . . . . . . . A 5 A H5' . 36202 1 63 . 1 . 1 5 5 A H8 H 1 7.701 . . 1 . . . . A 5 A H8 . 36202 1 64 . 1 . 1 5 5 A C1' C 13 92.588 . . 1 . . . . A 5 A C1' . 36202 1 65 . 1 . 1 5 5 A C2 C 13 153.476 . . 1 . . . . A 5 A C2 . 36202 1 66 . 1 . 1 5 5 A C2' C 13 75.481 . . 1 . . . . A 5 A C2' . 36202 1 67 . 1 . 1 5 5 A C3' C 13 73.047 . . 1 . . . . A 5 A C3' . 36202 1 68 . 1 . 1 5 5 A C4' C 13 82.282 . . 1 . . . . A 5 A C4' . 36202 1 69 . 1 . 1 5 5 A C5' C 13 66.055 . . 1 . . . . A 5 A C5' . 36202 1 70 . 1 . 1 5 5 A C8 C 13 139.493 . . 1 . . . . A 5 A C8 . 36202 1 71 . 1 . 1 5 5 A N1 N 15 222.905 . . 1 . . . . A 5 A N1 . 36202 1 72 . 1 . 1 6 6 G H1 H 1 13.452 . . 1 . . . . A 6 G H1 . 36202 1 73 . 1 . 1 6 6 G H1' H 1 5.524 . . 1 . . . . A 6 G H1' . 36202 1 74 . 1 . 1 6 6 G H2' H 1 4.333 . . 1 . . . . A 6 G H2' . 36202 1 75 . 1 . 1 6 6 G H3' H 1 4.362 . . 1 . . . . A 6 G H3' . 36202 1 76 . 1 . 1 6 6 G H4' H 1 4.410 . . 1 . . . . A 6 G H4' . 36202 1 77 . 1 . 1 6 6 G H5' H 1 4.440 . . . . . . . A 6 G H5' . 36202 1 78 . 1 . 1 6 6 G H8 H 1 7.120 . . 1 . . . . A 6 G H8 . 36202 1 79 . 1 . 1 6 6 G C1' C 13 89.891 . . 1 . . . . A 6 G C1' . 36202 1 80 . 1 . 1 6 6 G C2' C 13 72.316 . . 1 . . . . A 6 G C2' . 36202 1 81 . 1 . 1 6 6 G C3' C 13 70.042 . . 1 . . . . A 6 G C3' . 36202 1 82 . 1 . 1 6 6 G C4' C 13 79.346 . . 1 . . . . A 6 G C4' . 36202 1 83 . 1 . 1 6 6 G C5' C 13 62.494 . . 1 . . . . A 6 G C5' . 36202 1 84 . 1 . 1 6 6 G C8 C 13 133.085 . . 1 . . . . A 6 G C8 . 36202 1 85 . 1 . 1 7 7 U H1' H 1 5.507 . . 1 . . . . A 7 U H1' . 36202 1 86 . 1 . 1 7 7 U H2' H 1 4.613 . . 1 . . . . A 7 U H2' . 36202 1 87 . 1 . 1 7 7 U H3 H 1 13.650 . . 1 . . . . A 7 U H3 . 36202 1 88 . 1 . 1 7 7 U H3' H 1 4.513 . . 1 . . . . A 7 U H3' . 36202 1 89 . 1 . 1 7 7 U H4' H 1 4.401 . . 1 . . . . A 7 U H4' . 36202 1 90 . 1 . 1 7 7 U H5 H 1 5.007 . . 1 . . . . A 7 U H5 . 36202 1 91 . 1 . 1 7 7 U H5' H 1 4.428 . . . . . . . A 7 U H5' . 36202 1 92 . 1 . 1 7 7 U H6 H 1 7.654 . . 1 . . . . A 7 U H6 . 36202 1 93 . 1 . 1 7 7 U C1' C 13 93.491 . . 1 . . . . A 7 U C1' . 36202 1 94 . 1 . 1 7 7 U C2' C 13 75.350 . . 1 . . . . A 7 U C2' . 36202 1 95 . 1 . 1 7 7 U C3' C 13 71.859 . . 1 . . . . A 7 U C3' . 36202 1 96 . 1 . 1 7 7 U C4' C 13 82.089 . . 1 . . . . A 7 U C4' . 36202 1 97 . 1 . 1 7 7 U C5' C 13 64.260 . . 1 . . . . A 7 U C5' . 36202 1 98 . 1 . 1 7 7 U C6 C 13 141.204 . . 1 . . . . A 7 U C6 . 36202 1 99 . 1 . 1 7 7 U N3 N 15 162.127 . . 1 . . . . A 7 U N3 . 36202 1 100 . 1 . 1 8 8 G H1 H 1 12.570 . . 1 . . . . A 8 G H1 . 36202 1 101 . 1 . 1 8 8 G H1' H 1 5.773 . . 1 . . . . A 8 G H1' . 36202 1 102 . 1 . 1 8 8 G H2' H 1 4.617 . . 1 . . . . A 8 G H2' . 36202 1 103 . 1 . 1 8 8 G H3' H 1 4.430 . . 1 . . . . A 8 G H3' . 36202 1 104 . 1 . 1 8 8 G H4' H 1 4.482 . . 1 . . . . A 8 G H4' . 36202 1 105 . 1 . 1 8 8 G H5' H 1 4.485 . . . . . . . A 8 G H5' . 36202 1 106 . 1 . 1 8 8 G H8 H 1 7.723 . . 1 . . . . A 8 G H8 . 36202 1 107 . 1 . 1 8 8 G C1' C 13 90.320 . . 1 . . . . A 8 G C1' . 36202 1 108 . 1 . 1 8 8 G C2' C 13 72.382 . . 1 . . . . A 8 G C2' . 36202 1 109 . 1 . 1 8 8 G C3' C 13 70.008 . . 1 . . . . A 8 G C3' . 36202 1 110 . 1 . 1 8 8 G C4' C 13 79.132 . . 1 . . . . A 8 G C4' . 36202 1 111 . 1 . 1 8 8 G C5' C 13 62.619 . . 1 . . . . A 8 G C5' . 36202 1 112 . 1 . 1 8 8 G C8 C 13 134.420 . . 1 . . . . A 8 G C8 . 36202 1 113 . 1 . 1 8 8 G N1 N 15 147.529 . . 1 . . . . A 8 G N1 . 36202 1 114 . 1 . 1 9 9 U H1' H 1 5.355 . . 1 . . . . A 9 U H1' . 36202 1 115 . 1 . 1 9 9 U H2' H 1 4.188 . . 1 . . . . A 9 U H2' . 36202 1 116 . 1 . 1 9 9 U H3 H 1 11.636 . . 1 . . . . A 9 U H3 . 36202 1 117 . 1 . 1 9 9 U H3' H 1 4.688 . . 1 . . . . A 9 U H3' . 36202 1 118 . 1 . 1 9 9 U H5 H 1 5.472 . . 1 . . . . A 9 U H5 . 36202 1 119 . 1 . 1 9 9 U H6 H 1 7.730 . . 1 . . . . A 9 U H6 . 36202 1 120 . 1 . 1 9 9 U C1' C 13 93.569 . . 1 . . . . A 9 U C1' . 36202 1 121 . 1 . 1 9 9 U C2' C 13 75.528 . . 1 . . . . A 9 U C2' . 36202 1 122 . 1 . 1 9 9 U C3' C 13 72.719 . . 1 . . . . A 9 U C3' . 36202 1 123 . 1 . 1 9 9 U C6 C 13 140.613 . . 1 . . . . A 9 U C6 . 36202 1 124 . 1 . 1 9 9 U N3 N 15 158.503 . . 1 . . . . A 9 U N3 . 36202 1 125 . 1 . 1 10 10 A H1' H 1 5.916 . . 1 . . . . A 10 A H1' . 36202 1 126 . 1 . 1 10 10 A H2 H 1 7.213 . . 1 . . . . A 10 A H2 . 36202 1 127 . 1 . 1 10 10 A H2' H 1 4.523 . . 1 . . . . A 10 A H2' . 36202 1 128 . 1 . 1 10 10 A H3' H 1 4.700 . . 1 . . . . A 10 A H3' . 36202 1 129 . 1 . 1 10 10 A H4' H 1 4.444 . . 1 . . . . A 10 A H4' . 36202 1 130 . 1 . 1 10 10 A H5' H 1 4.543 . . . . . . . A 10 A H5' . 36202 1 131 . 1 . 1 10 10 A H8 H 1 8.324 . . 1 . . . . A 10 A H8 . 36202 1 132 . 1 . 1 10 10 A C1' C 13 92.358 . . 1 . . . . A 10 A C1' . 36202 1 133 . 1 . 1 10 10 A C2 C 13 153.626 . . 1 . . . . A 10 A C2 . 36202 1 134 . 1 . 1 10 10 A C2' C 13 75.666 . . 1 . . . . A 10 A C2' . 36202 1 135 . 1 . 1 10 10 A C3' C 13 72.915 . . 1 . . . . A 10 A C3' . 36202 1 136 . 1 . 1 10 10 A C4' C 13 81.939 . . 1 . . . . A 10 A C4' . 36202 1 137 . 1 . 1 10 10 A C5' C 13 65.282 . . 1 . . . . A 10 A C5' . 36202 1 138 . 1 . 1 10 10 A C8 C 13 140.788 . . 1 . . . . A 10 A C8 . 36202 1 139 . 1 . 1 10 10 A N1 N 15 220.015 . . 1 . . . . A 10 A N1 . 36202 1 140 . 1 . 1 11 11 C H1' H 1 5.342 . . 1 . . . . A 11 C H1' . 36202 1 141 . 1 . 1 11 11 C H2' H 1 4.164 . . 1 . . . . A 11 C H2' . 36202 1 142 . 1 . 1 11 11 C H3' H 1 4.303 . . 1 . . . . A 11 C H3' . 36202 1 143 . 1 . 1 11 11 C H4' H 1 4.359 . . 1 . . . . A 11 C H4' . 36202 1 144 . 1 . 1 11 11 C H5 H 1 5.168 . . 1 . . . . A 11 C H5 . 36202 1 145 . 1 . 1 11 11 C H5' H 1 4.452 . . . . . . . A 11 C H5' . 36202 1 146 . 1 . 1 11 11 C H6 H 1 7.446 . . 1 . . . . A 11 C H6 . 36202 1 147 . 1 . 1 11 11 C H41 H 1 8.331 . . . . . . . A 11 C H41 . 36202 1 148 . 1 . 1 11 11 C H42 H 1 6.897 . . . . . . . A 11 C H42 . 36202 1 149 . 1 . 1 11 11 C C1' C 13 93.573 . . 1 . . . . A 11 C C1' . 36202 1 150 . 1 . 1 11 11 C C2' C 13 75.488 . . 1 . . . . A 11 C C2' . 36202 1 151 . 1 . 1 11 11 C C3' C 13 72.422 . . 1 . . . . A 11 C C3' . 36202 1 152 . 1 . 1 11 11 C C4' C 13 81.952 . . 1 . . . . A 11 C C4' . 36202 1 153 . 1 . 1 11 11 C C5' C 13 65.124 . . 1 . . . . A 11 C C5' . 36202 1 154 . 1 . 1 11 11 C C6 C 13 141.113 . . 1 . . . . A 11 C C6 . 36202 1 155 . 1 . 1 11 11 C N3 N 15 196.761 . . 1 . . . . A 11 C N3 . 36202 1 156 . 1 . 1 11 11 C N4 N 15 97.567 . . 1 . . . . A 11 C N4 . 36202 1 157 . 1 . 1 12 12 U H1' H 1 5.511 . . 1 . . . . A 12 U H1' . 36202 1 158 . 1 . 1 12 12 U H2' H 1 4.414 . . 1 . . . . A 12 U H2' . 36202 1 159 . 1 . 1 12 12 U H3 H 1 13.705 . . 1 . . . . A 12 U H3 . 36202 1 160 . 1 . 1 12 12 U H5 H 1 5.196 . . 1 . . . . A 12 U H5 . 36202 1 161 . 1 . 1 12 12 U H6 H 1 7.586 . . 1 . . . . A 12 U H6 . 36202 1 162 . 1 . 1 12 12 U C1' C 13 93.681 . . 1 . . . . A 12 U C1' . 36202 1 163 . 1 . 1 12 12 U C2' C 13 72.200 . . 1 . . . . A 12 U C2' . 36202 1 164 . 1 . 1 12 12 U C6 C 13 141.094 . . 1 . . . . A 12 U C6 . 36202 1 165 . 1 . 1 12 12 U N3 N 15 160.906 . . 1 . . . . A 12 U N3 . 36202 1 166 . 1 . 1 13 13 G H1 H 1 10.289 . . 1 . . . . A 13 G H1 . 36202 1 167 . 1 . 1 13 13 G H1' H 1 5.422 . . 1 . . . . A 13 G H1' . 36202 1 168 . 1 . 1 13 13 G H2' H 1 4.508 . . 1 . . . . A 13 G H2' . 36202 1 169 . 1 . 1 13 13 G H3' H 1 4.548 . . 1 . . . . A 13 G H3' . 36202 1 170 . 1 . 1 13 13 G H4' H 1 4.381 . . 1 . . . . A 13 G H4' . 36202 1 171 . 1 . 1 13 13 G H5' H 1 4.338 . . . . . . . A 13 G H5' . 36202 1 172 . 1 . 1 13 13 G H8 H 1 7.638 . . 1 . . . . A 13 G H8 . 36202 1 173 . 1 . 1 13 13 G C1' C 13 88.724 . . 1 . . . . A 13 G C1' . 36202 1 174 . 1 . 1 13 13 G C2' C 13 73.219 . . 1 . . . . A 13 G C2' . 36202 1 175 . 1 . 1 13 13 G C3' C 13 73.290 . . 1 . . . . A 13 G C3' . 36202 1 176 . 1 . 1 13 13 G C4' C 13 80.083 . . 1 . . . . A 13 G C4' . 36202 1 177 . 1 . 1 13 13 G C5' C 13 62.649 . . 1 . . . . A 13 G C5' . 36202 1 178 . 1 . 1 13 13 G C8 C 13 133.245 . . 1 . . . . A 13 G C8 . 36202 1 179 . 1 . 1 13 13 G N1 N 15 145.697 . . 1 . . . . A 13 G N1 . 36202 1 180 . 1 . 1 14 14 G H1' H 1 5.454 . . 1 . . . . A 14 G H1' . 36202 1 181 . 1 . 1 14 14 G H2' H 1 4.658 . . 1 . . . . A 14 G H2' . 36202 1 182 . 1 . 1 14 14 G H3' H 1 4.411 . . 1 . . . . A 14 G H3' . 36202 1 183 . 1 . 1 14 14 G H4' H 1 4.210 . . 1 . . . . A 14 G H4' . 36202 1 184 . 1 . 1 14 14 G H5' H 1 4.117 . . . . . . . A 14 G H5' . 36202 1 185 . 1 . 1 14 14 G H8 H 1 7.885 . . 1 . . . . A 14 G H8 . 36202 1 186 . 1 . 1 14 14 G C1' C 13 87.195 . . 1 . . . . A 14 G C1' . 36202 1 187 . 1 . 1 14 14 G C2' C 13 72.358 . . 1 . . . . A 14 G C2' . 36202 1 188 . 1 . 1 14 14 G C3' C 13 73.185 . . 1 . . . . A 14 G C3' . 36202 1 189 . 1 . 1 14 14 G C4' C 13 81.426 . . 1 . . . . A 14 G C4' . 36202 1 190 . 1 . 1 14 14 G C5' C 13 63.521 . . 1 . . . . A 14 G C5' . 36202 1 191 . 1 . 1 14 14 G C8 C 13 137.326 . . 1 . . . . A 14 G C8 . 36202 1 192 . 1 . 1 15 15 A H1' H 1 5.569 . . 1 . . . . A 15 A H1' . 36202 1 193 . 1 . 1 15 15 A H2 H 1 7.844 . . 1 . . . . A 15 A H2 . 36202 1 194 . 1 . 1 15 15 A H2' H 1 4.293 . . 1 . . . . A 15 A H2' . 36202 1 195 . 1 . 1 15 15 A H3' H 1 4.525 . . 1 . . . . A 15 A H3' . 36202 1 196 . 1 . 1 15 15 A H4' H 1 4.166 . . 1 . . . . A 15 A H4' . 36202 1 197 . 1 . 1 15 15 A H5' H 1 3.812 . . . . . . . A 15 A H5' . 36202 1 198 . 1 . 1 15 15 A H8 H 1 7.885 . . 1 . . . . A 15 A H8 . 36202 1 199 . 1 . 1 15 15 A C1' C 13 91.179 . . 1 . . . . A 15 A C1' . 36202 1 200 . 1 . 1 15 15 A C2 C 13 154.924 . . 1 . . . . A 15 A C2 . 36202 1 201 . 1 . 1 15 15 A C2' C 13 77.081 . . 1 . . . . A 15 A C2' . 36202 1 202 . 1 . 1 15 15 A C3' C 13 76.160 . . 1 . . . . A 15 A C3' . 36202 1 203 . 1 . 1 15 15 A C4' C 13 84.127 . . 1 . . . . A 15 A C4' . 36202 1 204 . 1 . 1 15 15 A C5' C 13 66.140 . . 1 . . . . A 15 A C5' . 36202 1 205 . 1 . 1 15 15 A C8 C 13 140.911 . . 1 . . . . A 15 A C8 . 36202 1 206 . 1 . 1 16 16 A H1' H 1 6.287 . . 1 . . . . A 16 A H1' . 36202 1 207 . 1 . 1 16 16 A H2 H 1 7.950 . . 1 . . . . A 16 A H2 . 36202 1 208 . 1 . 1 16 16 A H2' H 1 4.775 . . 1 . . . . A 16 A H2' . 36202 1 209 . 1 . 1 16 16 A H3' H 1 5.267 . . 1 . . . . A 16 A H3' . 36202 1 210 . 1 . 1 16 16 A H4' H 1 4.482 . . 1 . . . . A 16 A H4' . 36202 1 211 . 1 . 1 16 16 A H5' H 1 4.409 . . . . . . . A 16 A H5' . 36202 1 212 . 1 . 1 16 16 A H8 H 1 8.141 . . 1 . . . . A 16 A H8 . 36202 1 213 . 1 . 1 16 16 A C1' C 13 92.272 . . 1 . . . . A 16 A C1' . 36202 1 214 . 1 . 1 16 16 A C2 C 13 155.285 . . 1 . . . . A 16 A C2 . 36202 1 215 . 1 . 1 16 16 A C2' C 13 76.910 . . 1 . . . . A 16 A C2' . 36202 1 216 . 1 . 1 16 16 A C3' C 13 74.801 . . 1 . . . . A 16 A C3' . 36202 1 217 . 1 . 1 16 16 A C4' C 13 83.172 . . 1 . . . . A 16 A C4' . 36202 1 218 . 1 . 1 16 16 A C5' C 13 66.927 . . 1 . . . . A 16 A C5' . 36202 1 219 . 1 . 1 16 16 A C8 C 13 140.977 . . 1 . . . . A 16 A C8 . 36202 1 220 . 1 . 1 17 17 A H2 H 1 7.510 . . 1 . . . . A 17 A H2 . 36202 1 221 . 1 . 1 17 17 A H2' H 1 4.496 . . 1 . . . . A 17 A H2' . 36202 1 222 . 1 . 1 17 17 A H3' H 1 4.271 . . 1 . . . . A 17 A H3' . 36202 1 223 . 1 . 1 17 17 A H4' H 1 4.329 . . 1 . . . . A 17 A H4' . 36202 1 224 . 1 . 1 17 17 A H5' H 1 4.359 . . . . . . . A 17 A H5' . 36202 1 225 . 1 . 1 17 17 A H8 H 1 8.138 . . 1 . . . . A 17 A H8 . 36202 1 226 . 1 . 1 17 17 A C1' C 13 92.919 . . 1 . . . . A 17 A C1' . 36202 1 227 . 1 . 1 17 17 A C2 C 13 153.410 . . 1 . . . . A 17 A C2 . 36202 1 228 . 1 . 1 17 17 A C2' C 13 74.942 . . 1 . . . . A 17 A C2' . 36202 1 229 . 1 . 1 17 17 A C3' C 13 74.602 . . 1 . . . . A 17 A C3' . 36202 1 230 . 1 . 1 17 17 A C4' C 13 82.889 . . 1 . . . . A 17 A C4' . 36202 1 231 . 1 . 1 17 17 A C5' C 13 69.122 . . 1 . . . . A 17 A C5' . 36202 1 232 . 1 . 1 17 17 A C8 C 13 142.143 . . 1 . . . . A 17 A C8 . 36202 1 233 . 1 . 1 18 18 G H1 H 1 13.204 . . 1 . . . . A 18 G H1 . 36202 1 234 . 1 . 1 18 18 G H1' H 1 5.632 . . 1 . . . . A 18 G H1' . 36202 1 235 . 1 . 1 18 18 G H2' H 1 4.338 . . 1 . . . . A 18 G H2' . 36202 1 236 . 1 . 1 18 18 G H3' H 1 4.388 . . 1 . . . . A 18 G H3' . 36202 1 237 . 1 . 1 18 18 G H4' H 1 4.388 . . 1 . . . . A 18 G H4' . 36202 1 238 . 1 . 1 18 18 G H5' H 1 4.386 . . . . . . . A 18 G H5' . 36202 1 239 . 1 . 1 18 18 G H8 H 1 7.145 . . 1 . . . . A 18 G H8 . 36202 1 240 . 1 . 1 18 18 G C1' C 13 89.935 . . 1 . . . . A 18 G C1' . 36202 1 241 . 1 . 1 18 18 G C2' C 13 72.372 . . 1 . . . . A 18 G C2' . 36202 1 242 . 1 . 1 18 18 G C3' C 13 70.651 . . 1 . . . . A 18 G C3' . 36202 1 243 . 1 . 1 18 18 G C4' C 13 79.156 . . 1 . . . . A 18 G C4' . 36202 1 244 . 1 . 1 18 18 G C5' C 13 62.375 . . 1 . . . . A 18 G C5' . 36202 1 245 . 1 . 1 18 18 G C8 C 13 133.366 . . 1 . . . . A 18 G C8 . 36202 1 246 . 1 . 1 18 18 G N1 N 15 147.718 . . 1 . . . . A 18 G N1 . 36202 1 247 . 1 . 1 19 19 U H1' H 1 5.564 . . 1 . . . . A 19 U H1' . 36202 1 248 . 1 . 1 19 19 U H2' H 1 4.508 . . 1 . . . . A 19 U H2' . 36202 1 249 . 1 . 1 19 19 U H3 H 1 13.950 . . 1 . . . . A 19 U H3 . 36202 1 250 . 1 . 1 19 19 U H3' H 1 4.405 . . 1 . . . . A 19 U H3' . 36202 1 251 . 1 . 1 19 19 U H5 H 1 5.067 . . 1 . . . . A 19 U H5 . 36202 1 252 . 1 . 1 19 19 U H5' H 1 4.283 . . . . . . . A 19 U H5' . 36202 1 253 . 1 . 1 19 19 U H6 H 1 7.655 . . 1 . . . . A 19 U H6 . 36202 1 254 . 1 . 1 19 19 U C1' C 13 93.038 . . 1 . . . . A 19 U C1' . 36202 1 255 . 1 . 1 19 19 U C2' C 13 73.470 . . 1 . . . . A 19 U C2' . 36202 1 256 . 1 . 1 19 19 U C3' C 13 75.346 . . 1 . . . . A 19 U C3' . 36202 1 257 . 1 . 1 19 19 U C5' C 13 64.497 . . 1 . . . . A 19 U C5' . 36202 1 258 . 1 . 1 19 19 U C6 C 13 141.672 . . 1 . . . . A 19 U C6 . 36202 1 259 . 1 . 1 19 19 U N3 N 15 162.385 . . 1 . . . . A 19 U N3 . 36202 1 260 . 1 . 1 20 20 G H1 H 1 10.732 . . 1 . . . . A 20 G H1 . 36202 1 261 . 1 . 1 20 20 G H1' H 1 5.782 . . 1 . . . . A 20 G H1' . 36202 1 262 . 1 . 1 20 20 G H2' H 1 4.335 . . 1 . . . . A 20 G H2' . 36202 1 263 . 1 . 1 20 20 G H3' H 1 4.566 . . 1 . . . . A 20 G H3' . 36202 1 264 . 1 . 1 20 20 G H4' H 1 4.493 . . 1 . . . . A 20 G H4' . 36202 1 265 . 1 . 1 20 20 G H5' H 1 4.477 . . . . . . . A 20 G H5' . 36202 1 266 . 1 . 1 20 20 G H8 H 1 7.666 . . 1 . . . . A 20 G H8 . 36202 1 267 . 1 . 1 20 20 G C1' C 13 90.356 . . 1 . . . . A 20 G C1' . 36202 1 268 . 1 . 1 20 20 G C2' C 13 70.231 . . 1 . . . . A 20 G C2' . 36202 1 269 . 1 . 1 20 20 G C3' C 13 72.354 . . 1 . . . . A 20 G C3' . 36202 1 270 . 1 . 1 20 20 G C4' C 13 79.376 . . 1 . . . . A 20 G C4' . 36202 1 271 . 1 . 1 20 20 G C5' C 13 63.598 . . 1 . . . . A 20 G C5' . 36202 1 272 . 1 . 1 20 20 G C8 C 13 134.269 . . 1 . . . . A 20 G C8 . 36202 1 273 . 1 . 1 20 20 G N1 N 15 143.940 . . 1 . . . . A 20 G N1 . 36202 1 274 . 1 . 1 21 21 C H1' H 1 5.357 . . 1 . . . . A 21 C H1' . 36202 1 275 . 1 . 1 21 21 C H2' H 1 4.333 . . 1 . . . . A 21 C H2' . 36202 1 276 . 1 . 1 21 21 C H3' H 1 4.540 . . 1 . . . . A 21 C H3' . 36202 1 277 . 1 . 1 21 21 C H4' H 1 4.385 . . 1 . . . . A 21 C H4' . 36202 1 278 . 1 . 1 21 21 C H5 H 1 5.314 . . 1 . . . . A 21 C H5 . 36202 1 279 . 1 . 1 21 21 C H5' H 1 4.220 . . . . . . . A 21 C H5' . 36202 1 280 . 1 . 1 21 21 C H6 H 1 7.626 . . 1 . . . . A 21 C H6 . 36202 1 281 . 1 . 1 21 21 C H41 H 1 8.203 . . . . . . . A 21 C H41 . 36202 1 282 . 1 . 1 21 21 C H42 H 1 6.862 . . . . . . . A 21 C H42 . 36202 1 283 . 1 . 1 21 21 C C2' C 13 75.481 . . 1 . . . . A 21 C C2' . 36202 1 284 . 1 . 1 21 21 C C3' C 13 71.935 . . 1 . . . . A 21 C C3' . 36202 1 285 . 1 . 1 21 21 C C4' C 13 82.061 . . 1 . . . . A 21 C C4' . 36202 1 286 . 1 . 1 21 21 C C5 C 13 97.002 . . 1 . . . . A 21 C C5 . 36202 1 287 . 1 . 1 21 21 C C5' C 13 64.706 . . 1 . . . . A 21 C C5' . 36202 1 288 . 1 . 1 21 21 C C6 C 13 140.993 . . 1 . . . . A 21 C C6 . 36202 1 289 . 1 . 1 21 21 C N3 N 15 196.569 . . 1 . . . . A 21 C N3 . 36202 1 290 . 1 . 1 21 21 C N4 N 15 100.291 . . 1 . . . . A 21 C N4 . 36202 1 291 . 1 . 1 22 22 A H1' H 1 5.884 . . 1 . . . . A 22 A H1' . 36202 1 292 . 1 . 1 22 22 A H2 H 1 7.370 . . 1 . . . . A 22 A H2 . 36202 1 293 . 1 . 1 22 22 A H2' H 1 4.558 . . 1 . . . . A 22 A H2' . 36202 1 294 . 1 . 1 22 22 A H3' H 1 4.648 . . 1 . . . . A 22 A H3' . 36202 1 295 . 1 . 1 22 22 A H4' H 1 4.460 . . 1 . . . . A 22 A H4' . 36202 1 296 . 1 . 1 22 22 A H5' H 1 4.528 . . . . . . . A 22 A H5' . 36202 1 297 . 1 . 1 22 22 A H8 H 1 7.997 . . 1 . . . . A 22 A H8 . 36202 1 298 . 1 . 1 22 22 A C1' C 13 92.932 . . 1 . . . . A 22 A C1' . 36202 1 299 . 1 . 1 22 22 A C2 C 13 153.701 . . 1 . . . . A 22 A C2 . 36202 1 300 . 1 . 1 22 22 A C2' C 13 74.897 . . 1 . . . . A 22 A C2' . 36202 1 301 . 1 . 1 22 22 A C3' C 13 72.709 . . 1 . . . . A 22 A C3' . 36202 1 302 . 1 . 1 22 22 A C4' C 13 81.959 . . 1 . . . . A 22 A C4' . 36202 1 303 . 1 . 1 22 22 A C5' C 13 64.846 . . 1 . . . . A 22 A C5' . 36202 1 304 . 1 . 1 22 22 A C8 C 13 139.586 . . 1 . . . . A 22 A C8 . 36202 1 305 . 1 . 1 22 22 A N1 N 15 221.021 . . 1 . . . . A 22 A N1 . 36202 1 306 . 1 . 1 23 23 C H1' H 1 5.351 . . 1 . . . . A 23 C H1' . 36202 1 307 . 1 . 1 23 23 C H2' H 1 4.189 . . 1 . . . . A 23 C H2' . 36202 1 308 . 1 . 1 23 23 C H3' H 1 4.340 . . 1 . . . . A 23 C H3' . 36202 1 309 . 1 . 1 23 23 C H4' H 1 4.376 . . 1 . . . . A 23 C H4' . 36202 1 310 . 1 . 1 23 23 C H5 H 1 5.205 . . 1 . . . . A 23 C H5 . 36202 1 311 . 1 . 1 23 23 C H5' H 1 4.501 . . . . . . . A 23 C H5' . 36202 1 312 . 1 . 1 23 23 C H6 H 1 7.523 . . 1 . . . . A 23 C H6 . 36202 1 313 . 1 . 1 23 23 C H41 H 1 8.238 . . . . . . . A 23 C H41 . 36202 1 314 . 1 . 1 23 23 C H42 H 1 6.978 . . . . . . . A 23 C H42 . 36202 1 315 . 1 . 1 23 23 C C2' C 13 75.651 . . 1 . . . . A 23 C C2' . 36202 1 316 . 1 . 1 23 23 C C3' C 13 72.409 . . 1 . . . . A 23 C C3' . 36202 1 317 . 1 . 1 23 23 C C4' C 13 82.206 . . 1 . . . . A 23 C C4' . 36202 1 318 . 1 . 1 23 23 C C5' C 13 64.805 . . 1 . . . . A 23 C C5' . 36202 1 319 . 1 . 1 23 23 C C6 C 13 141.048 . . 1 . . . . A 23 C C6 . 36202 1 320 . 1 . 1 23 23 C N4 N 15 98.881 . . 1 . . . . A 23 C N4 . 36202 1 321 . 1 . 1 24 24 U H1' H 1 5.528 . . 1 . . . . A 24 U H1' . 36202 1 322 . 1 . 1 24 24 U H2' H 1 4.427 . . 1 . . . . A 24 U H2' . 36202 1 323 . 1 . 1 24 24 U H3 H 1 13.959 . . 1 . . . . A 24 U H3 . 36202 1 324 . 1 . 1 24 24 U H3' H 1 4.499 . . 1 . . . . A 24 U H3' . 36202 1 325 . 1 . 1 24 24 U H4' H 1 4.341 . . 1 . . . . A 24 U H4' . 36202 1 326 . 1 . 1 24 24 U H5 H 1 5.329 . . 1 . . . . A 24 U H5 . 36202 1 327 . 1 . 1 24 24 U H5' H 1 4.502 . . . . . . . A 24 U H5' . 36202 1 328 . 1 . 1 24 24 U H6 H 1 7.876 . . 1 . . . . A 24 U H6 . 36202 1 329 . 1 . 1 24 24 U C1' C 13 93.777 . . 1 . . . . A 24 U C1' . 36202 1 330 . 1 . 1 24 24 U C2' C 13 74.883 . . 1 . . . . A 24 U C2' . 36202 1 331 . 1 . 1 24 24 U C3' C 13 72.454 . . 1 . . . . A 24 U C3' . 36202 1 332 . 1 . 1 24 24 U C4' C 13 82.550 . . 1 . . . . A 24 U C4' . 36202 1 333 . 1 . 1 24 24 U C5' C 13 64.499 . . 1 . . . . A 24 U C5' . 36202 1 334 . 1 . 1 24 24 U C6 C 13 142.465 . . 1 . . . . A 24 U C6 . 36202 1 335 . 1 . 1 24 24 U N3 N 15 162.394 . . 1 . . . . A 24 U N3 . 36202 1 336 . 1 . 1 25 25 U H1' H 1 5.704 . . 1 . . . . A 25 U H1' . 36202 1 337 . 1 . 1 25 25 U H2' H 1 4.492 . . 1 . . . . A 25 U H2' . 36202 1 338 . 1 . 1 25 25 U H3 H 1 13.383 . . 1 . . . . A 25 U H3 . 36202 1 339 . 1 . 1 25 25 U H3' H 1 4.606 . . 1 . . . . A 25 U H3' . 36202 1 340 . 1 . 1 25 25 U H4' H 1 4.451 . . 1 . . . . A 25 U H4' . 36202 1 341 . 1 . 1 25 25 U H5 H 1 5.611 . . 1 . . . . A 25 U H5 . 36202 1 342 . 1 . 1 25 25 U H5' H 1 4.513 . . . . . . . A 25 U H5' . 36202 1 343 . 1 . 1 25 25 U H6 H 1 7.946 . . 1 . . . . A 25 U H6 . 36202 1 344 . 1 . 1 25 25 U C1' C 13 92.746 . . 1 . . . . A 25 U C1' . 36202 1 345 . 1 . 1 25 25 U C2' C 13 75.742 . . 1 . . . . A 25 U C2' . 36202 1 346 . 1 . 1 25 25 U C3' C 13 73.205 . . 1 . . . . A 25 U C3' . 36202 1 347 . 1 . 1 25 25 U C4' C 13 82.429 . . 1 . . . . A 25 U C4' . 36202 1 348 . 1 . 1 25 25 U C5' C 13 64.992 . . 1 . . . . A 25 U C5' . 36202 1 349 . 1 . 1 25 25 U C6 C 13 142.753 . . 1 . . . . A 25 U C6 . 36202 1 350 . 1 . 1 25 25 U N3 N 15 162.810 . . 1 . . . . A 25 U N3 . 36202 1 351 . 1 . 1 26 26 G H1 H 1 10.763 . . 1 . . . . A 26 G H1 . 36202 1 352 . 1 . 1 26 26 G H1' H 1 5.711 . . 1 . . . . A 26 G H1' . 36202 1 353 . 1 . 1 26 26 G H5' H 1 4.428 . . . . . . . A 26 G H5' . 36202 1 354 . 1 . 1 26 26 G H8 H 1 7.726 . . 1 . . . . A 26 G H8 . 36202 1 355 . 1 . 1 26 26 G C1' C 13 90.683 . . 1 . . . . A 26 G C1' . 36202 1 356 . 1 . 1 26 26 G C5' C 13 63.746 . . 1 . . . . A 26 G C5' . 36202 1 357 . 1 . 1 26 26 G N1 N 15 143.964 . . 1 . . . . A 26 G N1 . 36202 1 358 . 1 . 1 27 27 C H1' H 1 5.406 . . 1 . . . . A 27 C H1' . 36202 1 359 . 1 . 1 27 27 C H2' H 1 4.124 . . 1 . . . . A 27 C H2' . 36202 1 360 . 1 . 1 27 27 C H3' H 1 4.434 . . 1 . . . . A 27 C H3' . 36202 1 361 . 1 . 1 27 27 C H4' H 1 4.345 . . 1 . . . . A 27 C H4' . 36202 1 362 . 1 . 1 27 27 C H5 H 1 5.302 . . 1 . . . . A 27 C H5 . 36202 1 363 . 1 . 1 27 27 C H5' H 1 4.479 . . . . . . . A 27 C H5' . 36202 1 364 . 1 . 1 27 27 C H6 H 1 7.623 . . 1 . . . . A 27 C H6 . 36202 1 365 . 1 . 1 27 27 C H41 H 1 8.277 . . . . . . . A 27 C H41 . 36202 1 366 . 1 . 1 27 27 C H42 H 1 6.902 . . . . . . . A 27 C H42 . 36202 1 367 . 1 . 1 27 27 C C1' C 13 94.126 . . 1 . . . . A 27 C C1' . 36202 1 368 . 1 . 1 27 27 C C2' C 13 75.724 . . 1 . . . . A 27 C C2' . 36202 1 369 . 1 . 1 27 27 C C3' C 13 71.665 . . 1 . . . . A 27 C C3' . 36202 1 370 . 1 . 1 27 27 C C4' C 13 82.191 . . 1 . . . . A 27 C C4' . 36202 1 371 . 1 . 1 27 27 C C5 C 13 97.996 . . 1 . . . . A 27 C C5 . 36202 1 372 . 1 . 1 27 27 C C5' C 13 63.988 . . 1 . . . . A 27 C C5' . 36202 1 373 . 1 . 1 27 27 C C6 C 13 141.077 . . 1 . . . . A 27 C C6 . 36202 1 374 . 1 . 1 27 27 C N3 N 15 197.167 . . 1 . . . . A 27 C N3 . 36202 1 375 . 1 . 1 27 27 C N4 N 15 99.400 . . 1 . . . . A 27 C N4 . 36202 1 376 . 1 . 1 28 28 C H1' H 1 5.723 . . 1 . . . . A 28 C H1' . 36202 1 377 . 1 . 1 28 28 C H2' H 1 3.988 . . 1 . . . . A 28 C H2' . 36202 1 378 . 1 . 1 28 28 C H3' H 1 4.147 . . 1 . . . . A 28 C H3' . 36202 1 379 . 1 . 1 28 28 C H4' H 1 4.134 . . 1 . . . . A 28 C H4' . 36202 1 380 . 1 . 1 28 28 C H5 H 1 5.421 . . 1 . . . . A 28 C H5 . 36202 1 381 . 1 . 1 28 28 C H5' H 1 4.415 . . . . . . . A 28 C H5' . 36202 1 382 . 1 . 1 28 28 C H6 H 1 7.631 . . 1 . . . . A 28 C H6 . 36202 1 383 . 1 . 1 28 28 C H41 H 1 8.334 . . . . . . . A 28 C H41 . 36202 1 384 . 1 . 1 28 28 C H42 H 1 6.922 . . . . . . . A 28 C H42 . 36202 1 385 . 1 . 1 28 28 C C1' C 13 93.059 . . 1 . . . . A 28 C C1' . 36202 1 386 . 1 . 1 28 28 C C2' C 13 77.588 . . 1 . . . . A 28 C C2' . 36202 1 387 . 1 . 1 28 28 C C3' C 13 69.720 . . 1 . . . . A 28 C C3' . 36202 1 388 . 1 . 1 28 28 C C4' C 13 83.447 . . 1 . . . . A 28 C C4' . 36202 1 389 . 1 . 1 28 28 C C5' C 13 65.146 . . 1 . . . . A 28 C C5' . 36202 1 390 . 1 . 1 28 28 C C6 C 13 142.012 . . 1 . . . . A 28 C C6 . 36202 1 391 . 1 . 1 28 28 C N4 N 15 99.788 . . 1 . . . . A 28 C N4 . 36202 1 stop_ save_