BMRB - Biological Magnetic Resonance Bank

BMRB Query Grid

Select desired data type(s) and optionally limit polymer type(s). You can select multiple values by holding the "control" key (Windows, Linux) or "option" key (MacOS) while clicking. All data type selections are applied using a logical AND operator. Polymer selection join type can be selected. Click a column header to sort by that column.

Data type(s): Polymer type(s): Polymer join type:

Number of entries returned: 573

Download all matching entries in NMR-STAR as a compressed file or download the results displayed on this page in CSV format.

BMRB ID	Entry Title	Protein	DNA	RNA	Other
4103	1H, 13C and 15N Chemical Shift Assignments of the 14mer DNA Duplex BS2		X
4104	1H, 13C and 15N Chemical Shift Assignments of the 14mer DNA Duplex BS2 in the Complex with the Antennapedia Homeodomain	X	X
4141	vnd/NK-2 Homeodomain DNA Complex Protein 1H, 13C, and 15N Chemical Shifts and HNHA Coupling Constant	X	X
4165	1H, 13C, and 15N Chemical Shift Assignments for Tn916 N-terminal DNA Binding Domain complex with DNA	X	X
4170	2'-Deoxy-Isoguanosine Base Paired to Thymidine, NMR Minimized Average Structure		X
4172	Response Element of the Orphan Nuclear Receptor Rev-erb Beta		X
4176	NMR Solution Structure of a DNA Dodecamer Containing Single G:T Mismatches		X
4187	Nuclear Magnetic Resonance Structure of d(GCATATGATAG).d(CTATCATATGC): A Consensus Sequence for Promoters Recognized by Sigma-K RNA Polymerase		X
4235	NMR Solution Structure of [d(GCGAATTCGC)2]		X
4240	Minor conformer of a benzo[a]pyrene diol epoxide adduct of DA in duplex DNA		X
4243	Intercalated d(TCCCGTTTCCA) dimer		X
4244	NMR Solution Structure of [d(GCGAAT-3'-3'-alphaT-5'-5'-CGC)2]		X
4247	1H Chemical Shift Assignments of the 8mer Chimeric Hybrid Duplex r(GCAGUGGC).r(RCCA)d(CTGC)		X	X
4248	LEF1 HMG Domain (From Mouse), Complexed with DNA (15bp), NMR, 12 Structures	X	X
4256	1H, 15N and 13C Assignments of the DNA Binding Domain of Transcription Factor Mbp1 from S. cerevisiae in Both Its Free and DNA Bound Forms, and 1H Assignments of the Free DNA	X	X
4258	1H Chemical Shift Assignments of the Palindromic 12mer d(TTTGACGCGTCAA)2 (MCB12T) which Contains the Recognition Site for the Yeast Transcription Factor Mbp1.		X
4359	NMR studies of the Pbx1 TALE Homeodomain Protein free in Solution and bound to DNA : Proposal for a Mechanism of HoxB1-Pbx1-DNA Complex Assembly	X	X
4361	Structure determination by restrained molecular dynamics using NMR pseudocontact shifts as experimentally determined constraints		X		X
4362	Structure determination by restrained molecular dynamics using NMR pseudocontact shifts as experimentally determined constraints		X		X
4368	Chemical Shift Assignments for A35T vnd/NK2 Mutant Homeodomain	X	X
4372	Solution Structure of a Quadraplex Forming DNA and Its Intermediate		X
4392	Binding of AR-1-144, a tri-imidazole DNA minor groove binder, to CCGG sequence analyzed by NMR spectroscopy		X
4400	Structure and Mechanism of Formation of the H-y5 ismomer of an Intramolecular DNA Triple Helix.		X
4409	DNA DECAMER DUPLEX CONTAINING T-T DEWAR PHOTOPRODUCT		X
4412	DNA DECAMER DUPLEX CONTAINING T5-T6 PHOTOADDUCT		X
4415	Solution-state structure of a DNA dodecamer duplex containing a cis-syn thymine cyclobutane dimer.		X
4416	Solution-State Structure of a DNA Dodecamer Duplex Containing a Cis-Syn Thymine Cyclobutane Dimer.		X
4488	DNA decamer duplex containing T-T (6-4) photoadduct		X
4536	Structural basis for uracil DNA glycosylase interaction with uracil: NMR study		X
4542	Solution structure of a uracil containing hairpin DNA		X
4547	Solution structure of a DNA.RNA hybrid containing an alpha-anomeric thymidine and polarity reversals: d(ATGG-3'-3'-(alpha-T)-5'-5'-GCTC).r(gagcaccau)		X	X
4550	NMR structure of the palindromic DNA decamer d(GCGTTAACGC)2		X
4555	31P NMR analysis of the DNA conformation induced by protein binding:SRY-DNA complexes		X
4556	31P NMR analysis of the DNA conformation induced by protein binding:SRY-DNA complexes		X
4576	Solution Structure of [d(CGC)r(aaa)d(TTTGCG)]2 Hybrid Junctions Flanked by DNA Duplexes		X
4609	NMR observation of T-tetrads in a parallel stranded DNA quadruplex formed by Saccharomyces cerevisiae telomere sequence		X
4610	NMR Observation of A-tetrad in a DNA Quadruplex		X
4612	NMR observation of a novel C-tetrad in a DNA quadruplex		X
4618	The Solution Structure of [d(CGC)r(aaa)d(TTTGCG)]2: Hybrid Junctions Flanked by DNA Duplexes		X
4646	Structural NMR characterization of an 11-mer DNA Duplex Containing a 2'-deoxyaristeromycin 8-oxo-Guanine pair, nonhydrolyzable substrate analog for the DNA repair enzyme MutY		X
4647	HPRT Gene Mutation Hotspot with a BPDE2(10R) Adduct		X
4687	1H chemical shift assignments of the dimeric form of d		X
4692	SOLUTION STRUCTURE OF A HUMAN TELOMERE FRAGMENT		X
4694	NMR structure of two cyclic oligonucleotides. A monomer-dimer equlilibrium between dumbbell and quadruplex structures.		X
4708	WT1-KTS/DNA complex	X	X
4710	WT1+KTS/DNA complex	X	X
4733	HMG-D complexed to a bulge DNA: an NMR study		X
4734	HMG-D complexed to a bulge DNA: an NMR study	X	X
4746	Average solution structure of d(TTGGCCAA)2 bound to Chromomycin-A3 and cobalt		X		X
4749	NMR structure of a DNA three-way junction		X
4753	Average solution structure of d(TTGGCCAA)2 bound to Chromomycin-A3 and zinc		X		X
4813	NMR structure of lac repressor HP62-DNA complex	X	X
4835	NMR Structure of the palindromic DNA decamer D(GCGTTAACGC)2		X
5032	1H, 13C and 15N Resonance Assignments of the DNA Binding Domain of the Human Forkhead Transcription Factor AFX	X	X
5134	Solution Structure of dAAUAA DNA Bulge		X
5135	Solution Structure of dAATAA DNA Bulge		X
5164	NMR Structure of a Parallel Stranded DNA Duplex at Atomic Resolution		X
5167	NMR Structure of an AT-Rich DNA with the GAA-Hairpin Loop		X
5232	1H, 13C, and 15N resonance assignments of the DNA-binding domain of the essential protein Cdc13 complexed with single-stranded telomeric DNA	X	X
5243	Solution Structure of the 17mer TF1 Binding Site		X
5245	Heteroduplex of chirally pure R-methylphosphonate/DNA duplex		X
5252	Structural Differences in the NOE-derived Structure of G-T Mismatched DNA relative to Normal DNA are Correlated with Differences in (13)C Relaxation-based Internal Dynamics		X
5253	Structural Differences in the NOE-derived Structure of G-T Mismatched DNA relative to Normal DNA are Correlated with Differences in (13)C Relaxation-based Internal Dynamics		X
5282	Refinement of d(GCGAAGC) Hairpin Structure Using One- and Two-Bonds Residual Dipolar Couplings		X
5339	NMR minimized average structure of d(CGTACG)2		X
5345	Assignment of lac repressor headpiece complexed of its natural operator	X	X
5349	PBX Homeodomain-DNA complex	X	X
5361	Solution Structure of the DNA Complex of Human TRF1	X	X
5363	1H, 13C, and 15N Chemical shifts for hERR2 Protein, 1H chemical shifts for DNA	X	X
5370	Structure of a Beta-Alanine-Linked Polyamide Bound to a Full Helical Turn of Purine Tract DNA in the 1:1 Motif		X
5385	Chemical shift assignments for the 8OG:G mismatched duplex		X
5517	NMR studies of the DNA-binding domain of B-Myb	X	X
5562	NMR conformational study of proposed quadruplex hexanucleotide d(CCGCGG)2 in solution		X
5634	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS1		X
5635	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS2		X
5636	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS3		X
5637	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS4		X
5638	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS5		X
5639	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS6		X
5640	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS7		X
5641	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS8		X
5642	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS9		X
5643	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS10		X
5644	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS11		X
5645	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS12		X
5646	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS13		X
5647	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS14		X
5648	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS15		X
5649	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS16		X
5671	Overall structure and sugar dynamics of a DNA dodecamer from homo and heteronuclear dipolar couplings and 31P chemical shift anisotropy		X
5681	DIMERIC SOLUTION STRUCTURE OF THE CYCLIC OCTAMER CD(CGCTCATT)		X
5714	1H Chemical shift assignments of the major conformation of a 11-mer DNA duplex containing an AG Mismatch		X
5716	CHEMICAL SHIFTS OF THE CK14 DNA DUPLEX: A PORTION OF THE KNOWN NF-kB SEQUENCE CK1		X
5717	NMR STRUCTURE OF THE CK14 DNA DUPLEX: A PORTION OF THE KNOWN NF-kB SEQUENCE CK1		X
5718	Chemical Shifts for the XBY2 DNA Duplex		X
5730	1H Chemical Shift Assignments for a DNA Duplex with N6-Deoxyadenosine Adduct of (9S,10R)-9,10-Epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene		X
5737	Structure of the parallel-stranded DNA quadruplex d(TTAGGGA)4 containing the human telomeric repeat: evidence for A-tetrad formation from NMR and molecular dynamics simulation.		X
5739	Mispairing of the Deoxycytosine with Deoxyadenosine 5' to the 8, 9-Dihydro-8-(N7-guanyl)-9-Hydroxy-Aflatoxin B1 Adduct : Structural study based on NMR		X
5775	5'(dCCUCCUU)3':3'(rAGGAGGAAA)5'		X	X
5776	sPrODN1:RNA [5'-R(AAAGGAGGA)-3'/5'-D(CXXXXXX)-3']		X	X
5777	PODN:RNA [5'-R(AAAGGAGGA)-3'/5'-D(XXXXXXX)-3']		X	X
5781	The Solution Structure of a DNA.RNA Duplex Containing 5-Propynyl U and C Comparison with 5-Me Modifications		X	X
5791	Solution structure of a dimeric lactose DNA-binding domain complexed to a nonspecific DNA sequence	X	X
5927	NMR Structure of a Cyclic Polyamide-DNA Complex		X
5979	A parallel stranded DNA duplex with an A-G mismatch base-pair		X
5993	1H shifts for the DNA duplex containing 5-hydroxy Uracil lesion		X
6009	NMR structure of the thrombin-binding DNA aptamer stabilized by Sr2+		X
6186	Structure of DNA sequence d-TGATCA by two-dimensional nuclear magnetic resonance spec and restrained molecular dynamics		X
6273	1H and 31P chemical shift assignments for the triloop DNA hairpin 5'- GTTCACAGAAC - 3'		X
6274	1H chemical shift assignments for the triloop DNA hairpin 5'- GTACACAGTAC - 3'		X
6276	1H, 13C and 15N resonance assignments for the six-zinc finger domain of the MTF-1 metalloregulatory protein in the DNA bound state	X	X
6307	The Solution Structure of d(G3T4G4)2		X
6319	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Nkx2.5 Homeodomain plus NK2 Specific Domain in the DNA Bound State	X	X
6353	1H, 15N and 13C resonance assignments of the BRCT Region of the large subunit of human Replication Factor C	X	X
6430	1H and 31P chemical shift assignments for HIV-1 integrase inhibitor 93del		X
6445	Backbone 1H, 13C, and 15N and 13CB Chemical Shift Assignments for Six C2H2 Zinc Fingers (F1-6) of MTF-1 in the DNA Bound State (22 bp)	X	X
6537	Small Molecule Ligand Induces Nucleotide Flipping in (CAG)n Trinucleotide Repeats		X
6605	E. Coli Ada in a complex with DNA	X	X
6877	NMR assignments of the Human Papillomavirus type 16 E2C DNA-bound form	X	X
6906	1H, 13C, and 15N Chemical Shift Assignments for the Bicoid Homedomain	X	X
6975	1H chemical shift assignments for Bcl2MidG4		X
7097	DNA recognition by the Brinker nuclear repressor - an extreme case of the coupling between binding and folding	X	X
7105	1H, 13C and 15N chemical shift assignments for SRY.B in complex with 16-mer DNA	X	X
7319	Polymerase Beta and Double gap double hairpin DNA	X	X
7354	NMR STRUCTURE OF A PROTEIN-DNA COMPLEX OF AN ALTERED SPECIFICITY MUTANT OF THE LAC REPRESSOR THAT MIMICS THE GAL REPRESSOR	X	X
7377	Resonance assignments of the metal sensor CzrA in the apo-, Zn2- and DNA-bound (42 kDa) states	X	X
11045	Mhr1p-bound ssDNA	X	X
11046	hsRad51-bound ssDNA	X	X
11047	RecO-bound ssDNA	X	X
11048	RecT-bound ssDNA	X	X
11437	DNA oligmer containing propylene cross-linked cyclic 2' -deoxyuridylate dimer		X
11438	DNA oligomer containing ethylene cross-linked cyclic 2'-deoxyuridylate dimer		X
11528	STRUCTURE OF METALLO-DNA IN SOLUTION		X
11608	SOLUTION STRUCTURE OF DNA CONTAINING METALLO-BASE-PAIR		X
15026	NMR Structure of the IQ-modified Dodecamer CTCGGC[IQ]GCCATC		X
15027	NMR Structure of the B-DNA Dodecamer CTCGGCGCCATC		X
15033	Dimeric solution structure of the cyclic octamer d(CCGTCCGT)		X
15083	NMR Structure of the Sigma-54 RpoN Domain Bound to the-24 Promoter Element	X	X
15213	Assignments of {lambda}-IntCB bound to a DNA half-site	X	X
15223	Duplex DNA containing an abasic site with an opposite G (alpha anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)		X
15224	Duplex DNA containing an abasic site with an opposite G (beta anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)		X
15227	Duplex DNA containing an abasic site with an opposite T (alpha anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)		X
15228	Duplex DNA containing an abasic site with an opposite T (beta anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)		X
15238	Duplex DNA containing an abasic site with an opposite dC (alpha anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)		X
15239	Duplex DNA containing an abasic site with an opposite dC (beta anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)		X
15360	Solution Structures of a DNA Dodecamer Duplex		X
15376	SOLUTION STRUCTURE OF A DNA DUPLEX CONTAINING THE UNIVERSAL BASE 5-NITROINDOLE-3-CARBOXAMIDE		X
15527	1H, 13C, and 31P Chemical Shift Assignments for 14-mer Base Pair Non-self Complementary DNA Duplex ( Mbp1_14) which Contains the Consensus Binding Site of the Yeast Transcription Factor Mbp-1		X
15533	Structure of the Wilms' Tumor Suppressor Protein Zinc Finger Domain Bound to DNA	X	X
15613	SOLUTION STRUCTURE OF THE BIS-C2-2-NAPHTHYLPYRROLO[2,1-c][1,4]BENZODIAZEPINE (DA046) DNA ADDUCT: THE MOLECULAR BASIS FOR DNA HELIX STABILIZATION.		X
15860	NMR solution structure of modified DNA containing imidazole nucleosides at acidic, neutral and basic pH		X
15898	H1, C13, 31P chemical shifts of dGCGAAAGC		X
16054	Dimeric solution structure of the DNA loop d(TGCTTCGT)		X
16055	Dimeric solution structure of the cyclic octamer d(pCGCTCCGT)		X
16138	NMR solution structure of metal-modified DNA		X
16212	Dimeric solution structure of the DNA loop d(TCGTTGCT)		X
16222	NMR Structure of Aflatoxin Formamidopyrimidine alpha-anomer in duplex DNA		X
16223	Aflatoxin Formamidopyrimidine alpha anomer in single strand DNA		X
16225	Solution Structure of cis-5R,6S-thymine glycol opposite complementary adenine in duplex DNA		X
16226	Solution Structure of cis-5R,6S-thymine glycol opposite complementary guanine in duplex DNA		X
16280	d(GAGCTC)2 assignments		X
16281	d(GAGCTC)2 plus dqdppn		X
16282	d(AGAGCTCT)2 assignments		X
16286	d(CGAGCTCG)2 assignments		X
16287	d(AGAGCTCT)2 plus dqdppn 1:2 assignments		X
16288	d(CGAGCTCG)2 plus dqdppn 1:2 assignments		X
16289	d(GCTATAGC)2 assignments		X
16290	d(GCTATAGC)2 1:1 complex with dqdppn assignments		X
16291	d(AGAGCTCT)2 plus Ru ligand 1:2 assignments		X
16292	d(CGAGCTCG)2 plus Ru ligand 1:2 assignments		X
16356	Structure of a two-G-tetrad intramolecular G-quadruplex formed by a variant human telomeric sequence in K+ solution		X
16449	Structure of the XPF-single strand DNA complex	X	X
16485	Solution structure of the THAP zinc finger of THAP1 in complex with its DNA target	X	X
16577	Backbone Chemical Shift Assignments of Mouse HOXA13 DNA Binding Domain in Complex with DNA Duplex	X	X
16812	data-driven model of MED1:DNA complex	X	X
16834	NMR structure of fully methylated GATC site		X
16936	Solution structure and dynamic analysis of chicken MBD2 methyl binding domain bound to a target methylated DNA sequence	X	X
17094	NMR and molecular modeling studies of the interaction of berenil and pentamidine with d(CGCAAATTTGCG)2		X
17129	Chemical shifts of the 25-mer oligonucleotide encompassing the variable region of a MUC1 DNA aptamer.		X
17130	Zif 268 with 12bp DNA	X	X
17216	How the HIV-1 Nucleocapsid Protein Binds and Destabilises the (-)Primer Binding Site During Reverse Transcription	X	X
17217	Solution Structure of the C-terminal Dimerization Domain of SARS Coronavirus Nucleocapsid Protein Solved by the SAIL-NMR Method	X	X
17222	lac repressor-lac operator interaction: NMR observations	X	X
17225	The Solution Structure and DNA-binding Properties of the Cold-shock Domain of the Human Y-box Protein YB-1	X	X
17229	C-terminal zinc knuckle of the HIVNCp7 with DNA	X	X
17339	The Solution Structure of a Fungal AREA Protein-DNA Complex: An Alternative Binding Mode for a Basic Carboxyl Tail of GATA factors	X	X
17379	QUI/G-quadruplex complex		X
17397	Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence		X
17409	A biocompatible backbone modification? - Structure and dynamics of a triazole-linked DNA duplex		X
17422	Solution Structure of a DNA Duplex Containing the Potent Anti-Poxvirus Agent Cidofovir		X
17423	Solution Structure of a DNA Duplex Containing the Potent Anti-Poxvirus Agent Cidofovir		X
17452	Chemical Shifts of the Pitx2 Homeodomain in complex with a TAAGCT non-consensus DNA site	X	X
17535	DNA / RNA Hybrid containing a central stereo specific Rp borano phosphate linkage		X	X
17562	N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenal		X
17580	Myc G-quadruplex formed at the 5'-end of NHEIII element		X
17592	Backbone assignments of Anabaena Sensory Rhodopsin Transducer with DNA	X	X
17655	Structure of Human Telomeric DNA in Crowded Solution		X
17697	Structure of a dimeric all-parallel-stranded G-quadruplex stacked via the 5'-to-5' interface		X
17708	Solution-state structures of monomeric and dimeric G-quadruplexes adopted by a sequence from N-myc		X
17709	Solution-state structures of monomeric and dimeric G-quadruplexes formed by a sequence from N-myc		X
17729	Structure of the DNA complex of the C-Terminal domain of Ler	X	X
17732	Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA	X	X
17746	Oligonucleotide duplex contaning (5'S)-8,5'-cyclo-2'-deoxyguansine		X
17786	Structure of the duplex when (5'S)-8,5'-cyclo-2'-deoxyguanosine is placed opposite dT		X
17787	Structure of the duplex when (5'S)-8,5'-cyclo-2'-deoxyguanosine is placed opposite dA		X
17788	Minor conformer of the DNA-peptide conjugate bridged by trimethylene tether	X	X
17789	structure of the duplex containing (5'S)-8,5'-cyclo-2'-deoxyadenosine		X
17790	Structure of the duplex containing HNE derived (6S,8R,11S) N2-dG cyclic hemiacetal when placed opposite dT		X
17791	Structure of the duplex containing HNE derived (6S,8R,11S) gamma-HO-PdG when placed opposite dT		X
17814	Structure of DNA Containing an Aristolactam II-dA Lesion.		X
17859	Solution Structure of a DNA duplex Containing an Unnatural, Hydrophobic Base Pair		X
17885	Solution NMR structure of a DNA dodecamer containing the 7-aminomethyl-7-deaza-2'-deoxyguanosine adduct		X
17887	DNA sequence context conceals alpha anomeric lesion		X
17980	Monomer-dimer equilibrium for 5 -5 stacking of propeller-type parallel-stranded G-quadruplexes: NMR structural study		X
18015	Chemical shift assignments for the homeodomain of Pitx2 in complex with a TAATCC DNA binding site	X	X
18040	DNA TT mismatch and 2,7-BisNP		X
18050	Structure of a bis-naphthalene bound to a thymine-thymine DNA mismatch		X
18199	Structural Basis for Bifunctional Zn(II) Macrocyclic Complex Recognition of Thymine Bulges in DNA. Structure of a Thymine bulge.		X
18209	Solution-state structure of an intramolecular G-quadruplex w th propeller, diagonal and edgewise loops		X
18279	human CEB25 minisatellite G-quadruplex		X
18427	Solution structure of 2'F-ANA and ANA self-complementary duplex		X
18430	Structure and Stability of Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine: An Oxidative Lesion Repair by NER.		X
18452	Solution structure of a mini i-motif	X	X
18453	NMR structure of duplex DNA containing the -OH-PdG dA base pair: A mutagenic intermediate of acrolein		X
18454	NMR structure of duplex DNA containing the -OH-PdG dA base pair: A mutagenic intermediate of acrolein		X
18462	Solution NMR structure of Kaiso zinc finger DNA binding domain in complex with Kaiso binding site DNA	X	X
18496	Solution NMR Structure of YdbC:dT19G1 complex. Northeast Structural Genomics Consortium (NESG) Target KR150	X	X
18524	Solution structure of a parallel-stranded oligoisoguanine DNA pentaplex formed by d(T(iG)4T) in the presence of Cs ions		X
18625	NMR Structure of the Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'.		X
18626	NMR Structure of the Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin		X
18638	Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion		X
18639	Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion		X
18640	Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion		X
18690	MOMERIC PIL-E G-QUADRUPLEX DNA FROM NEISSERIA GONORRHOEAE		X
18699	DIMERIC PIL-E G-QUADRUPLEX DNA FROM NEISSERIA GONORRHOEAE, N STRUCTURES		X
18724	FUC_TBA		X
18762	NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing		X
18780	DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link		X
18781	DNA duplex containing mispair-aligned O6G-heptylene-O6G interstrand cross-link		X
18835	Structure of perimidinone-derived synthetic nucleoside paired with guanine in DNA duplex		X
18862	Parallel human telomeric quadruplex containing 2'F-ANA substitutions		X
18881	NMR solution structure of the d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid		X	X
18902	Solution structure of the major G-quadruplex formed in the human VEGF promoter: Insights into loop interactions of the parallel G-quadruplexes		X
18907	Solution structure of Duplex DNA		X
18935	African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNA	X	X
18973	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : alpha anomer		X
18979	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer		X
18981	DNA containing a cluster of 8-oxo-guanine and THF lesion		X
18984	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : alpha anomer (AP6, 8OG 14)		X
18985	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer (6AP, 8OG14)		X
19017	Solution structure of an intramolecular propeller-type G-quadruplex containing a single bulge		X
19035	G-rich VEGF aptamer with LNA modifications		X
19138	ERG DNA Complex	X	X
19158	Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions		X
19159	Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions		X
19222	NMR Studies of DNA Support the Role of Pre-Existing Minor Groove Variations in Nucleosome Indirect Readout		X
19276	Structure of d[CGCGAAGCATTCGCG] hairpin		X
19277	Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid		X
19278	Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid		X
19279	Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid		X
19280	Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid		X
19281	Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid		X
19367	Solution structure of the complex formed by the region 2 of E. coli sigmaE and its cognate -10 non template element TGTCAAA	X	X
19375	NMR Structure of N2-IQ-dG at the G3 position in the NarI recognition sequence		X
19381	Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes		X
19386	parallel-stranded G-quadruplex in DNA poly-G stretches		X
19387	Solution structure of an intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative		X
19389	Solution structure of a stacked dimeric G-quadruplex formed by a segment of the human CEB1 minisatellite		X
19391	Solution structure of MBD3 methylcytosine binding domain while bound to hydroxymethylated DNA	X	X
19402	Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution)		X
19435	Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence		X
19440	NMR structure of DNA duplex		X
19441	NMR structure of spermine modified DNA duplex		X
19448	Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence		X
19511	NMR Structure of the homeodomain transcription factor Gbx1 from Homo sapiens solved in the presence of the DNA sequence CGACTAATTAGTCG	X	X
19540	haddock model of MyT1 F4F5 - DNA complex	X	X
19571	Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions.		X
19572	Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions.		X
19592	Molecular Binding of TFF1 Estrogen Response Element by a DNA Bis-intercalating Anticancer Drug XR5944		X
19594	Solution structure of a G-quadruplex bound to the bisquinolinium compound Phen-DC3		X
19620	Solution structure of DNA duplex containing N3T-ethylene-N1I interstrand cross-link		X
19653	RRM domain from C. elegans SUP-12	X	X
19659	Structure of Exocyclic R,R N6,N6-(2,3-Dihydroxy-1,4-butadiyl)-2'-Deoxyadenosine Adduct Induced by 1,2,3,4-Diepoxybutane in DNA		X
19661	Structure of Exocyclic S,S N6,N6-(2,3-Dihydroxy-1,4-butadiyl)-2'-Deoxyadenosine Adduct Induced by 1,2,3,4-Diepoxybutane in DNA		X
19695	NMR studies of N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA: Impact of adduct stereochemistry, size, and local DNA structure on solution conformations		X
19696	Nuclear magnetic resonance studies of N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA: Impact of adduct stereochemistry, size, and local DNA structure on solution conformations		X
19728	A tetrahelical DNA fold adopted by alternating GGG and GCG tracts		X
19734	Complete chemical shift assignment of the ssDNA in the filamentous bacteriophage fd report on its conformation and on its interface with the capsid shell	X	X
19745	Solution NMR structure of a mismatch DNA		X
19747	13C and 15N Chemical Shift Assignments for the M13 Bacteriophage	X	X
19784	Solution structure of the G-triplex truncated-TBA		X
19805	13C and 15N Chemical Shift Assignments for the dsDNA in Bacteriophage T7		X
19853	AFB1 FAPY modified AGA duplex		X
19861	AFB1 FAPY modified AGT duplex		X
19862	E isomer of AFB1 FAPY modified AGC duplex		X
19863	AFB1 FAPY modified AG(7-deaza)G duplex		X
19886	MINOR GROOVE RECOGNITION OF DNA BY THIAZOTROPSIN ANALOGUES		X
19888	MINOR GROOVE RECOGNITION OF DNA BY THIAZOTROPSIN ANALOGUES		X
19889	MINOR GROOVE RECOGNITION OF DNA BY THIAZOTROPSIN ANALOGUES		X
19890	MINOR GROOVE RECOGNITION OF DNA BY THIAZOTROPSIN ANALOGUES		X
19912	MAJOR GROOVE ORIENTATION OF THE (2S)-N6-(2-HYDROXY-3-BUTEN-1-YL)-2'-DEOXYADENOSINE DNA ADDUCT INDUCED BY 1,2-EPOXY-3-BUTENE		X
19917	Solution NMR structure of DNA dodecamer containing the 5-hydroxycytosine		X
19925	Solution NMR structure of DNA dodecamer with A:C mismatch		X
19939	Solution structure of MBD4 methyl-cytosine binding domain bound to methylated DNA	X	X
19957	Assignment of DNA-MC1 protein complex	X	X
25092	truncated EcMazE-DNA complex	X	X
25099	Dimeric structure of the Human A-box		X
25107	Human Telomeric G-quadruplex DNA sequence (TTAGGGT)4 complexed with Flavonoid Quercetin		X
25110	Solution structure of a left-handed G-quadruplex		X
25369	Solution Structure of DNA Dodecamer with 8-oxoguanine at 10th Position.		X
25378	A structure of G-quadruplex		X
25407	Structure of the DNA complex of the C-Terminal domain of MvaT	X	X
25528	Solution Structure of DNA Dodecamer with 8-oxoguanine at 4th Position		X
25531	N2-dG-IQ modified DNA at the G1 position of the NarI recognition sequence		X
25582	structure of a protein	X	X
25596	Structure of DNA G-quadruplex adopted by ALS and FTD related GGGGCC repeat with G21 to Br-G21 substitution		X
25651	Isolation and structural characterization of an active G-quadruplex motif from AGRO100		X
25672	Base-displaced intercalated structure of the N-(2'deoxyguanosin-8-yl)-3-aminobenzanthrone DNA adduct		X
25686	Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome		X
25701	Backbone assignments and ILV methyl assignments for EcoRV bound to 16-mer double stranded DNA (GCAAAGATATCTTTCG) without Lu3+	X	X
25723	Universal Base oligonucleotide structure		X
25724	Universal base control oligonucleotide structure		X
25746	G-quadruplex structure		X
25752	Backbone assignments and ILV methyl assignments for EcoRV bound to 16-mer double stranded DNA (GCAAAGATATCTTTCG) with Lu3+	X	X
25759	Solution structure for quercetin complexed with c-myc G-quadruplex DNA		X
25840	Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC at acidic pH		X
25882	Structural basis for DNA cleavage by the potent antiproliferative agent (-)-lomaiviticin A		X
25888	1H, 13C and 15N chemical shift assignments and solution structure for PARP-1 F1F2 domains in complex with a DNA single-strand break	X	X
25890	1H chemical shift assignments for 45 nucleotide DNA dumbbell (model for single-strand break with one-nucleotide gap)		X
25891	1H, 13C and 15N chemical shift assignments for PARP-1 F1F2F3 domains in complex with a DNA single-strand break	X	X
25894	1H and 15N chemical shift assignments for PARP-1 F1F2F3 domains in complex with PARP-1 WGR domain and a DNA single-strand break	X	X
25903	Glucose as non natural nucleobase		X
25906	Glucose as a nuclease mimic in DNA		X
25915	Photoswitchable G-quadruplex		X
26620	Amide/Methyl/Aromatic chemical shift and order parameter of Barnase-dCGAC	X	X
26731	Structural and dynamics studies of Pax5 reveal asymmetry in stability and DNA binding by the Paired domain	X	X
26808	Egr-1 - DNA complex	X	X
26931	Backbone chemical shifts of the MBD2/3 methyl-cytosine binding domain from Ephydatia muelleri	X	X
26978	MeCP2 bound to methylated DNA	X	X
27053	NMR chemical shift assignments of a 22mer G-quadruplex formed within the KRAS proto-oncogene promoter region		X
27144	DNA with compounds		X
27173	1H, 13C, and 15N resonance assignments of a 22mer G-quadruplex forming within KRAS oncogene promoter region at physiological temperature		X
27364	Backbone 1H, 15N chemical shift assignments of Kaiso zinc finger DNA binding domain in complex with its double CpG-methylated DNA consensus binding site (MeCG2)	X	X
27366	Backbone 1H, 15N chemical shift assignments of Kaiso E535Q zinc finger DNA binding domain in complex with its double CpG-methylated DNA consensus binding site (MeCG2)	X	X
27367	Backbone 1H, 15N chemical shift assignments of Kaiso E535A zinc finger DNA binding domain in complex with its double CpG-methylated DNA consensus binding site	X	X
27368	Backbone 1H, 15N chemical shift assignments of Kaiso zinc finger DNA binding domain in complex with a double CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	X	X
27369	Backbone 1H, 15N chemical shift assignments of Kaiso E535Q zinc finger DNA binding domain in complex with a double CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	X	X
27370	Backbone 1H, 15N chemical shift assignments of Kaiso E535A zinc finger DNA binding domain in complex with a double CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	X	X
27371	Backbone 1H, 15N chemical shift assignments of Kaiso zinc finger DNA binding domain in complex with a semi-CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	X	X
27372	Backbone 1H, 15N chemical shift assignments of Kaiso zinc finger DNA binding domain in complex with a hemi-CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	X	X
27404	1H, 15N, 13C backbone resonance assignments of the nuclease core residues 2-336 of K93A human flap endonuclease-1 in complex with dual-hairpin DNA substrate	X	X
27409	Ile and Met methyl 1H and 13C chemical shifts of DNA polymerase beta and 1-nucleotide gapped double hairpin DNA binary complex	X	X
27410	Ile and Met methyl 1H and 13C chemical shifts of DNA polymerase beta, 1-nucleotide gapped double hairpin DNA and dAMPCPP ternary complex	X	X
27560	protein-gapped DNA complex (Polymerase beta) ILV Methyl Assignments	X	X
27561	protein-gapped DNA-nucelotide complex (Polymerase beta) ILV Methyl Assignments	X	X
27652	NZ118		X
27828	Chemical shifts for d(CGATATCG)2; free form		X
27829	Chemical shifts for intercalation complex between d(CGATATCG)2 and C-1305		X
27958	Spin-labeled DNA duplex		X
28059	1H-15N backbone Heteronuclear NOE values for free and ssDNA complex forms of Human YB1 cold shock domain.	X	X
28081	Trimolecular G-quadruplex		X
30012	NMR structure of a new G-quadruplex forming sequence within the KRAS proto-oncogene promoter region		X
30015	DNA duplex containing a ribonolactone lesion		X
30016	DNA duplex containing a ribonolactone lesion		X
30038	Solution Structure of DNA Dodecamer with 8-oxoguanine at 4th Position		X
30044	Solution Structure of DNA Dodecamer with 8-oxoguanine at 10th Position		X
30045	DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium		X
30052	NMR solution structure of [Rp, Rp]-PT dsDNA		X
30053	Solution NMR structure of PT-free dsDNA from Streptomyces lividans		X
30054	NMR solution structure of [Sp, Sp]-PT dsDNA		X
30055	DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTTGG) in sodium		X
30056	DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTGG) in sodium		X
30058	DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium		X
30105	Structural impact of single ribonucleotides in DNA		X		X
30111	Structural impact of single ribonucleotides in DNA		X
30112	Structural impact of single ribonucleotides in DNA		X
30113	Structural impact of single ribonucleotides in DNA		X		X
30114	Structural impact of single ribonucleotides in DNA		X		X
30115	Structural impact of single ribonucleotides in DNA		X		X
30116	Structural impact of single ribonucleotides in DNA		X		X
30117	Structural impact of single ribonucleotides in DNA		X		X
30148	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd Position		X
30151	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 9th Position		X
30191	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd Position and 9th position		X
30198	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd Position and 9th position		X
30250	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd position and 8-oxoguanine at the 10th position		X
30251	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd and 9th position and 8-oxoguanine at the 10th position		X
30252	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 9th position and 8-oxoguanine at the 10th position		X
30253	Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A2-DNA structure		X
30254	Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A6-DNA structure		X
30255	Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A6-DNAm1A16 structure		X
30328	Solution structure of a DNA dodecamer with 5-methylcytosine at the 3rd and 9th position and 8-oxoguanine at the 4th position		X
30329	Solution structure of a DNA dodecamer with 5-methylcytosine at the 3rd and 8-oxoguanine at the 4th position		X
30335	NMR and Restrained Molecular Dynamics Determination of the Structure of an Aza-Benzimidazole Derivative Complex with the DNA Minor Groove of an -AAGATA- Sequence		X
30336	NMR and Restrained Molecular Dynamics Determination of the Structure of an Aza-Benzimidazole Derivative Complex with the DNA Minor Groove of an -AAGATA Sequence		X
30402	Hybrid-2 form Human Telomeric G Quadruplex in Complex with Epiberberine		X
30473	NMR structure for Sp1 transcription factor duplex 5'-d(GGGGCGGGG)		X
30484	NMR structure for Sp1 transcription factor duplex 5'-d(GGGGCGGGA)		X
30485	NMR structure for Sp1 transcription factor duplex 5'-d(TGGGCGGGG)		X
30506	NMR structure for Sp1 transcription factor duplex 5'-d(TGGGCGGGA)		X
30552	MYC Promoter G-Quadruplex with 1:6:1 loop length		X
30577	NMR structure of the 2:1 complex of a carbazole derivative BMVC bound to c-MYC G-quadruplex		X
30688	Molecular Recognition of Guanine Metabolites and Drugs by Vacancy-Bearing G-Quadruplex in the PDGFR-b Promoter		X
30759	Structure of a Stable Interstrand DNA Crosslink Involving an dA Amino Group and an Abasic Site		X
30803	Solution structure of the major MYC promoter G-quadruplex with a wild-type flanking sequence		X
30804	Solution structure of the major MYC promoter G-quadruplex with a wild-type flanking in complex with NSC85697, a quinoline derivative		X
30805	Solution structure of the major MYC promoter G-quadruplex in complex with NSC85697, a quinoline derivative		X
30822	Deoxyuridine in DNA Structure: Solution Structure of [d(CGUGAATTCGCG)]2		X
30823	1,N6-ethenoadnine (E) in dsDNA sequence (5'-CGCGEATTCGCG-3')		X
30907	Solution Structure of Berberine Bound to a dGMP Fill-in G-Quadruplex in the PDGFR-b Promoter		X
30923	Solution structure of the MYC promoter G-quadruplex in complex with berberine: conformer A		X
30924	Solution structure of the MYC promoter G-quadruplex in complex with berberine: conformer B		X
30940	Hairpin near 3'-Splice Site of Influenza A Segment 7 Bound to 5-nt Oligonucleotide		X	X
34025	G-Quadruplex formed at the 5'-end of NHEIII_1 Element in human c-MYC promoter bound to triangulenium based fluorescence probe DAOTA-M2		X
34034	A two-quartet G-quadruplex formed by human telomere in KCl solution at neutral pH		X
34035	A two-quartet G-quadruplex formed by human telomere in KCl solution at pH 5.0		X
34051	Structure of DNA AGCGA-quadruplex adopted by 15-mer d(GCGAGGGAGCGAGGG), VK34, oligonucleotide found in regulatory region of the PLEKHG3 human gene		X
34053	Structure of a stable G-hairpin		X
34054	Structure of DNA tetrameric AGCGA-quadruplex adopted by 15-mer d(GCGAGGGAGCGAGGG), VK34, oligonucleotide found in regulatory region of the PLEKHG3 human gene		X
34056	Structure of DNA AGCGA-quadruplex adopted by 15-mer oligonucleotide found in regulatory region of the PLEKHG3 human gene with G11 to I11 mutation, d(GCGAGGGAGCIAGGG),VK34_I11		X
34062	Quadruplex with flipped tetrad formed by a human telomeric sequence		X
34063	Quadruplex with flipped tetrad formed by an artificial sequence		X
34071	2'F-ANA/DNA Chimeric TBA Quadruplex structure		X
34083	G-quadruplex formed within promoters of Plasmodium falciparum B var genes		X
34084	G-quadruplex formed within promoters of Plasmodium falciparum B var genes - form I		X
34086	Solution structure of a human G-Quadruplex hybrid-2 form in complex with a Gold-ligand		X
34118	An i-motif containing the neutral cytidine protonated analogue pseudoisocytidine		X
34135	M2 G-quadruplex dilute solution		X
34136	M2 G-quadruplex 20 wt% ethylene glycol		X
34137	M2 G-quadruplex 10 wt% PEG8000		X
34145	G-quadruplex of Human papillomavirus type 52		X
34157	NtMe polyamide in complex with 5'CGATGTACATCG3'- hairpin polyamides studies		X
34158	NtiPr polyamide in complex with 5'CGATGTACTACG3		X
34159	Im polyamide in complex with 5'CGATGTACATCG3'- hairpin polyamides studies		X
34162	Structure of minimal i-motif domain		X
34168	G-quadruplex structure of DNA oligonucleotide containing GGGGCC repeats linked to ALS and FTD		X
34172	NMR structure of the complex formed by an engineered region 2 of sigmaE in complex with GTAAAA	X	X
34174	2'F-ANA-G modified quadruplex with a flipped tetrad		X
34186	Quadruplex with flipped tetrad formed by the c-myc promoter sequence		X
34210	2'F-araG modified quadruplex with flipped G-tract and central tetrad		X
34221	The 1,8-bis(aminomethyl)anthracene and Quadruplex-duplex junction complex		X
34244	Concerted dynamics of metallo-base pairs in an A/B-form helical transition (major species)		X
34245	Concerted dynamics of metallo-base pairs in an A/B-form helical transition (minor species)		X
34269	Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure		X
34276	Tc-DNA/RNA duplex		X	X
34277	tc-DNA/tc-DNA duplex		X
34280	Tc-DNA/DNA duplex		X
34290	Hybrid structure of the pRN1 helix bundle domain in complex with DNA and 2 ATP molecules	X	X
34291	NMR structure of the DNA-bound helix bundle domain from the functional pRN1 primase	X	X
34296	Polyamide - DNA complex NMR structure		X
34297	Adenine-driven structural switch from two- to three-quartet DNA G-quadruplex		X
34302	The major G-quadruplex form of HIV-1 LTR		X
34328	Dodecamer DNA containing the synthetic base pair P-Z		X
34331	Human telomeric G-quadruplex with 8-oxo-G substitution in the central G-quartet		X
34332	Human telomeric G-quadruplex with 8-oxo-G substitution in the outer G-quartet		X
34353	TINA-conjugated antiparallel DNA triplex		X
34378	Structure of kiteplatinated dsDNA		X
34386	SC14 G-hairpin		X
34389	A quadruplex hybrid structure with lpp loop orientation and 3 syn residues		X
34390	A quadruplex hybrid structure with lpp loop orientation and 5 syn residues		X
34397	Imidazole Polyamide-DNA complex NMR structure (5'-CGATGTACATCG-3')		X
34398	Concerted dynamics of metallo-base pairs in an A/B-form helical transition (apo species)		X
34403	2'-F-riboguanosine modified G-quadruplex with V-loop		X
34431	NMR structure of KRAS32R G9T conformer G-quadruplex within KRAS promoter region		X
34435	Intercalation of heterocyclic ligand between quartets in G-rich tetrahelical structure		X
34436	Guanine-rich oligonucleotide with 5'-GC end form G-quadruplex with A(GGGG)A hexad, GCGC- and G-quartets and two symmetric GG and AA base pairs		X
34438	Guanine-rich oligonucleotide with 5'- and 3'-GC ends form G-quadruplex with A(GGGG)A hexad, GCGC- and G-quartets and two symmetric GG and AA base pair		X
34441	NMR structure of KRAS32R G25T conformer G-quadruplex within KRAS promoter region		X
34444	2'-F-arabinoguanosine and 2'-F-riboguanosine modified hybrid type G-quadruplex with V-loop		X
34445	2'-F-riboguanosine and 2'-F-arabinoguanosine modified G-quadruplex with V-loop and all-syn G-tract		X
34467	Pre-folded structures govern folding pathways of human telomeric G-quadruplexes		X
34499	2'-F-riboguanosine and LNA modified hybrid type G-quadruplex with V-loop		X
34502	LNA modified G-quadruplex with flipped G-tract and central tetrad		X
34516	Parallel 17-mer DNA G-quadruplex		X
34524	Structure of a parallel c-Myc modified with 3' duplex stem-loop overhang		X
34525	Structure of a parallel c-Myc modified with 5' duplex stem-loop overhang		X
34529	G-quadruplex with a G-A bulge		X
34533	Structure of a parallel c-myc modified with 5' duplex stem-loop and 3' diagonal snap-back loop		X
34542	Antiparallel basket-type G-quadruplex DNA structure formed in human Bcl-2 promoter containing 8-oxoG		X
34543	Antiparallel basket-type G-quadruplex DNA structure formed in human Bcl-2 promoter		X
34565	NMR structure of a DNA G-quadruplex containing two SP1 binding sites from HIV-1 promoter		X
34571	G-quadruplex with V-shaped loop from the first repeat of KCNN4 minisatellite		X
34579	Synthetic DNA duplex dodecamer		X
34580	Single modified phosphoryl guanidine DNA duplex, Sp diastereomer		X
34581	DNA duplex with phosphoryl guanidine moiety, Rp-diastereomer		X
34587	deoxyxylose nucleic acid hairpin		X
34588	deoxyxylose nucleic acid hairpin		X
34590	GA repetition with i-motif clip at 5'-end		X
34591	GA attached to an i-motif clip at 3'-end		X
34592	AG repetition attached to a compact i-motif clip at 3'-end		X
34593	AG repetition attached to an extended i-motif clip at 3'-end		X
34594	Solution structure of DNA duplex containing a 2'-deoxy-2'2'-difluorodeoxycytidine (gemcitabine) modification		X
34595	Solution structure of DNA:RNA hybrid containing a 2'-deoxy-2'2'-difluorodeoxycytidine (gemcitabine) modification		X	X
34596	Solution structure of DNA duplex containing a 7,8-dihydro-8-oxo-1,N6-ethenoadenine base modification that induces exclusively A->T transversions in Escherichia coli		X
34599	Solution structure of DNA:RNA hybrid duplex		X	X
34611	Three-quartet c-kit2 G-quadruplex stabilized by a pyrene conjugate		X
34615	Hybrid-2R quadruplex-duplex with (-p-p-l) topology and 3 syn residues		X
34616	The structure of an i-motif/duplex junction at neutral pH		X
34623	A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine		X
34624	A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine		X
34625	A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine		X
34626	A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine		X
34631	G-quadruplex structure of the C. elegans telomeric repeat: A two tetrads basket type conformation stabilised by a Hoogsteen C-T base-pair		X
34654	Pre-catalytic complex of 10-23 DNAzyme with RNA target		X	X
34664	Parallel Q-D hybrid with 3' duplex stem-loop as a lateral snapback loop		X
34665	Solution structure of 1:1 complex of an indoloquinoline derivative SYUIQ-5 to parallel quadruplex-duplex (Q-D) hybrid		X
34679	10bp DNA/DNA duplex		X
34685	Solution structure of a lanthanide-binding DNA aptamer		X
34714	Phen-DC3 intercalation causes hybrid-to-antiparallel transformation of human telomeric DNA G-quadruplex		X
34721	Structure of a hybrid-type G-quadruplex with a snapback loop (hybrid 1R')		X
34722	Structure of a parallel G-quadruplex with a snapback loop		X
34723	Structure of a hybrid-type G-quadruplex with a snapback loop and an all-syn G-column (hybrid-1R)		X
34735	Dimeric i-motif from 2'Farabinocytidine-modified TC5		X
34740	Solution structure of Phen-DC3 intercalating into a quadruplex-duplex hybrid		X
34741	Solution structure of a phenyl-indoloquinoline intercalating into a quadruplex-duplex hybrid		X
34768	Hairpin adopted by modified oligonucleotide A32_mod found in the promoter of AUTS2 gene.		X
34769	Hairpin of adopted by oligonucleotide A36 found in the promoter of AUTS2 gene.		X
34770	Hairpin adopted by oligonucleotide A38 found in the promoter of AUTS2 gene.		X
34772	An i-motif domain able to undergo pH-dependent conformational transitions (acidic structure)		X
34774	An i-motif domain able to undergo pH-dependent conformational transitions (neutral structure)		X
36001	Structure model of a protein-DNA complex	X	X
36020	Structure of two CCTG repeats		X
36022	Structure of two TTTA repeats		X
36116	The structure of a chair-type G-quadruplex of the human telomeric variant in K+ solution		X
36159	Solution structure for the 1:1 complex of a platinum(II)-based tripod bound to a hybrid-1 human telomeric G-quadruplex		X
36160	Solution structure for the unique dimeric 4:2 complex of a platinum(II)-based tripod bound to a hybrid-1 human telomeric G-quadruplex		X
36168	Solution structure of G-quadruplex formed in vegfr-2 proximal promoter sequence		X
36174	SOLUTION NMR STRUCTURE OF A 14-MER DOUBLE STRANDED DNA DUPLEX CGCGAAATTTCGCG		X
36186	Solution Structure of the DNA complex of the C-terminal Domain of Rok	X	X
36378	NMR solution structures of the DNA minidumbbell formed by 5'-mCTTGXmCTTG-3'		X
36379	NMR solution structures of the DNA minidumbbell formed by two CmCTG repeats at pH 5		X
36380	NMR solution structures of the DNA minidumbbell formed by two CCTG repeats at pH 5		X
36404	Solution structure of the C-clamp domain from human HDBP1 in complex with DNA	X	X
36411	Aptamer enhancing peroxidase activity of myoglobin		X
50109	Nonexchangeable proton shifts for d(GTATGGCCATAC)2		X
50278	Canonical and modified dsDNA 12mers		X
50378	M2, M2-L1, M2-L3, M2-L1L3 G-quadruplexes + Trisubstituted Naphtalene Diimide NDI-5		X
50604	Human Histone H2A type-2A in Nucleosome	X	X
50610	T9 DNA		X
50611	U9 DNA		X
50613	U8 DNA		X
50614	dhU3 DNA		X
50615	DDD DNA		X
50616	A3T3 DNA		X
50617	MeC9 DNA		X
50625	A (3+1) hybrid G-quadruplex containing right loop progression		X
50805	Histone H3 tail within tetrasome	X	X
50806	Histone H3 tail within nucleosome	X	X
50807	Histone H3 tail within hexasome	X	X
50831	1H, 15N, 13C, backbone resonance assignment of the 5'-GG(m6A)CT-3' bound human Alkbh5, pH 6.0	X	X
50847	ZEBRA-responsive element 2 DNA		X
50848	methylated ZEBRA-responsive element 2 DNA		X
50986	Proton NMR chemical shifts of GGCCTG2		X
50987	Proton NMR chemical shifts of GGCCTG3		X
50988	Proton NMR chemical shifts of GGCCTG3-T2		X
50989	Proton NMR chemical shifts of GGCCTG4		X
51032	loxP spacer 10-mer		X
51035	loxP spacer 12-mer		X
51036	loxP spacer 16-mer		X
51037	loxP spacer 22-mer		X
51047	lox4 spacer 16-mer		X
51140	H3 tail in 193-bp nucleosome	X	X
51141	H3 tail in 145-bp nucleosome	X	X
51142	H3 tail in 145-bp nucleosome	X	X
51143	H3 tail in 193-bp nucleosome	X	X
51161	Backbone assignments of p65 DNA binding domain in complex with DNA.	X	X
51177	Histone H2A and H2B tails within 112-bp hexasome	X	X
51178	Histone H2A and H2B tails within 112-bp DNA/pAID nucleosome	X	X
51337	5caC-containing dsDNA 12mers at three pH conditions		X
51612	Uracil-DNA glycosylase efficiency is modulated by substrate rigidity		X
51704	Histone H3 Core Domain in Chromatin with Different DNA Linker Lengths Studied by 1H-Detected Solid-State NMR Spectrsocopy	X	X
51705	Histone H3 Core Domain in Chromatin with Different DNA Linker Lengths Studied by 1H-Detected Solid-State NMR Spectrsocopy	X	X
51706	Histone H3 Core Domain in Chromatin with Different DNA Linker Lengths Studied by 1H-Detected Solid-State NMR Spectrsocopy	X	X