BMRB - Biological Magnetic Resonance Bank

BMRB Query Grid

Select desired data type(s) and optionally limit polymer type(s). You can select multiple values by holding the "control" key (Windows, Linux) or "option" key (MacOS) while clicking. All data type selections are applied using a logical AND operator. Polymer selection join type can be selected. Click a column header to sort by that column.

Data type(s): Polymer type(s): Polymer join type:

Number of entries returned: 565

Download all matching entries in NMR-STAR as a compressed file or download the results displayed on this page in CSV format.

BMRB ID	Entry Title	Any chemical shifts	Protein	DNA	RNA	Other
4103	1H, 13C and 15N Chemical Shift Assignments of the 14mer DNA Duplex BS2	468		X
4104	1H, 13C and 15N Chemical Shift Assignments of the 14mer DNA Duplex BS2 in the Complex with the Antennapedia Homeodomain	456	X	X
4141	vnd/NK-2 Homeodomain DNA Complex Protein 1H, 13C, and 15N Chemical Shifts and HNHA Coupling Constant	1313	X	X
4165	1H, 13C, and 15N Chemical Shift Assignments for Tn916 N-terminal DNA Binding Domain complex with DNA	978	X	X
4170	2'-Deoxy-Isoguanosine Base Paired to Thymidine, NMR Minimized Average Structure	131		X
4172	Response Element of the Orphan Nuclear Receptor Rev-erb Beta	296		X
4176	NMR Solution Structure of a DNA Dodecamer Containing Single G:T Mismatches	123		X
4187	Nuclear Magnetic Resonance Structure of d(GCATATGATAG).d(CTATCATATGC): A Consensus Sequence for Promoters Recognized by Sigma-K RNA Polymerase	204		X
4235	NMR Solution Structure of [d(GCGAATTCGC)2]	91		X
4240	Minor conformer of a benzo[a]pyrene diol epoxide adduct of DA in duplex DNA	109		X
4243	Intercalated d(TCCCGTTTCCA) dimer	94		X
4244	NMR Solution Structure of [d(GCGAAT-3'-3'-alphaT-5'-5'-CGC)2]	103		X
4247	1H Chemical Shift Assignments of the 8mer Chimeric Hybrid Duplex r(GCAGUGGC).r(RCCA)d(CTGC)	145		X	X
4248	LEF1 HMG Domain (From Mouse), Complexed with DNA (15bp), NMR, 12 Structures	1212	X	X
4256	1H, 15N and 13C Assignments of the DNA Binding Domain of Transcription Factor Mbp1 from S. cerevisiae in Both Its Free and DNA Bound Forms, and 1H Assignments of the Free DNA	690	X	X
4258	1H Chemical Shift Assignments of the Palindromic 12mer d(TTTGACGCGTCAA)2 (MCB12T) which Contains the Recognition Site for the Yeast Transcription Factor Mbp1.	94		X
4359	NMR studies of the Pbx1 TALE Homeodomain Protein free in Solution and bound to DNA : Proposal for a Mechanism of HoxB1-Pbx1-DNA Complex Assembly	219	X	X
4361	Structure determination by restrained molecular dynamics using NMR pseudocontact shifts as experimentally determined constraints	239		X		X
4362	Structure determination by restrained molecular dynamics using NMR pseudocontact shifts as experimentally determined constraints	263		X		X
4368	Chemical Shift Assignments for A35T vnd/NK2 Mutant Homeodomain	890	X	X
4372	Solution Structure of a Quadraplex Forming DNA and Its Intermediate	117		X
4392	Binding of AR-1-144, a tri-imidazole DNA minor groove binder, to CCGG sequence analyzed by NMR spectroscopy	91		X
4400	Structure and Mechanism of Formation of the H-y5 ismomer of an Intramolecular DNA Triple Helix.	247		X
4409	DNA DECAMER DUPLEX CONTAINING T-T DEWAR PHOTOPRODUCT	163		X
4412	DNA DECAMER DUPLEX CONTAINING T5-T6 PHOTOADDUCT	169		X
4415	Solution-state structure of a DNA dodecamer duplex containing a cis-syn thymine cyclobutane dimer.	215		X
4416	Solution-State Structure of a DNA Dodecamer Duplex Containing a Cis-Syn Thymine Cyclobutane Dimer.	215		X
4488	DNA decamer duplex containing T-T (6-4) photoadduct	165		X
4536	Structural basis for uracil DNA glycosylase interaction with uracil: NMR study	197		X
4542	Solution structure of a uracil containing hairpin DNA	206		X
4547	Solution structure of a DNA.RNA hybrid containing an alpha-anomeric thymidine and polarity reversals: d(ATGG-3'-3'-(alpha-T)-5'-5'-GCTC).r(gagcaccau)	184		X	X
4550	NMR structure of the palindromic DNA decamer d(GCGTTAACGC)2	83		X
4555	31P NMR analysis of the DNA conformation induced by protein binding:SRY-DNA complexes	269		X
4556	31P NMR analysis of the DNA conformation induced by protein binding:SRY-DNA complexes	151		X
4576	Solution Structure of [d(CGC)r(aaa)d(TTTGCG)]2 Hybrid Junctions Flanked by DNA Duplexes	104		X
4609	NMR observation of T-tetrads in a parallel stranded DNA quadruplex formed by Saccharomyces cerevisiae telomere sequence	59		X
4610	NMR Observation of A-tetrad in a DNA Quadruplex	29		X
4612	NMR observation of a novel C-tetrad in a DNA quadruplex	62		X
4618	The Solution Structure of [d(CGC)r(aaa)d(TTTGCG)]2: Hybrid Junctions Flanked by DNA Duplexes	104		X
4646	Structural NMR characterization of an 11-mer DNA Duplex Containing a 2'-deoxyaristeromycin 8-oxo-Guanine pair, nonhydrolyzable substrate analog for the DNA repair enzyme MutY	161		X
4647	HPRT Gene Mutation Hotspot with a BPDE2(10R) Adduct	195		X
4687	1H chemical shift assignments of the dimeric form of d	88		X
4692	SOLUTION STRUCTURE OF A HUMAN TELOMERE FRAGMENT	266		X
4694	NMR structure of two cyclic oligonucleotides. A monomer-dimer equlilibrium between dumbbell and quadruplex structures.	89		X
4708	WT1-KTS/DNA complex	443	X	X
4710	WT1+KTS/DNA complex	416	X	X
4733	HMG-D complexed to a bulge DNA: an NMR study	203		X
4734	HMG-D complexed to a bulge DNA: an NMR study	581	X	X
4746	Average solution structure of d(TTGGCCAA)2 bound to Chromomycin-A3 and cobalt	214		X		X
4749	NMR structure of a DNA three-way junction	282		X
4753	Average solution structure of d(TTGGCCAA)2 bound to Chromomycin-A3 and zinc	238		X		X
4813	NMR structure of lac repressor HP62-DNA complex	830	X	X
4835	NMR Structure of the palindromic DNA decamer D(GCGTTAACGC)2	82		X
5032	1H, 13C and 15N Resonance Assignments of the DNA Binding Domain of the Human Forkhead Transcription Factor AFX	297	X	X
5134	Solution Structure of dAAUAA DNA Bulge	275		X
5135	Solution Structure of dAATAA DNA Bulge	267		X
5164	NMR Structure of a Parallel Stranded DNA Duplex at Atomic Resolution	232		X
5167	NMR Structure of an AT-Rich DNA with the GAA-Hairpin Loop	252		X
5232	1H, 13C, and 15N resonance assignments of the DNA-binding domain of the essential protein Cdc13 complexed with single-stranded telomeric DNA	2245	X	X
5243	Solution Structure of the 17mer TF1 Binding Site	363		X
5245	Heteroduplex of chirally pure R-methylphosphonate/DNA duplex	122		X
5252	Structural Differences in the NOE-derived Structure of G-T Mismatched DNA relative to Normal DNA are Correlated with Differences in (13)C Relaxation-based Internal Dynamics	82		X
5253	Structural Differences in the NOE-derived Structure of G-T Mismatched DNA relative to Normal DNA are Correlated with Differences in (13)C Relaxation-based Internal Dynamics	88		X
5282	Refinement of d(GCGAAGC) Hairpin Structure Using One- and Two-Bonds Residual Dipolar Couplings	118		X
5339	NMR minimized average structure of d(CGTACG)2	45		X
5345	Assignment of lac repressor headpiece complexed of its natural operator	1803	X	X
5349	PBX Homeodomain-DNA complex	1184	X	X
5361	Solution Structure of the DNA Complex of Human TRF1	908	X	X
5363	1H, 13C, and 15N Chemical shifts for hERR2 Protein, 1H chemical shifts for DNA	1276	X	X
5370	Structure of a Beta-Alanine-Linked Polyamide Bound to a Full Helical Turn of Purine Tract DNA in the 1:1 Motif	217		X
5385	Chemical shift assignments for the 8OG:G mismatched duplex	116		X
5517	NMR studies of the DNA-binding domain of B-Myb	1015	X	X
5562	NMR conformational study of proposed quadruplex hexanucleotide d(CCGCGG)2 in solution	49		X
5634	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS1	167		X
5635	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS2	165		X
5636	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS3	167		X
5637	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS4	165		X
5638	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS5	163		X
5639	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS6	165		X
5640	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS7	163		X
5641	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS8	165		X
5642	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS9	167		X
5643	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS10	165		X
5644	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS11	167		X
5645	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS12	165		X
5646	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS13	163		X
5647	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS14	165		X
5648	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS15	163		X
5649	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS16	165		X
5671	Overall structure and sugar dynamics of a DNA dodecamer from homo and heteronuclear dipolar couplings and 31P chemical shift anisotropy	22		X
5681	DIMERIC SOLUTION STRUCTURE OF THE CYCLIC OCTAMER CD(CGCTCATT)	99		X
5714	1H Chemical shift assignments of the major conformation of a 11-mer DNA duplex containing an AG Mismatch	219		X
5716	CHEMICAL SHIFTS OF THE CK14 DNA DUPLEX: A PORTION OF THE KNOWN NF-kB SEQUENCE CK1	200		X
5717	NMR STRUCTURE OF THE CK14 DNA DUPLEX: A PORTION OF THE KNOWN NF-kB SEQUENCE CK1	100		X
5718	Chemical Shifts for the XBY2 DNA Duplex	198		X
5730	1H Chemical Shift Assignments for a DNA Duplex with N6-Deoxyadenosine Adduct of (9S,10R)-9,10-Epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene	220		X
5737	Structure of the parallel-stranded DNA quadruplex d(TTAGGGA)4 containing the human telomeric repeat: evidence for A-tetrad formation from NMR and molecular dynamics simulation.	63		X
5739	Mispairing of the Deoxycytosine with Deoxyadenosine 5' to the 8, 9-Dihydro-8-(N7-guanyl)-9-Hydroxy-Aflatoxin B1 Adduct : Structural study based on NMR	191		X
5775	5'(dCCUCCUU)3':3'(rAGGAGGAAA)5'	147		X	X
5776	sPrODN1:RNA [5'-R(AAAGGAGGA)-3'/5'-D(CXXXXXX)-3']	152		X	X
5777	PODN:RNA [5'-R(AAAGGAGGA)-3'/5'-D(XXXXXXX)-3']	157		X	X
5781	The Solution Structure of a DNA.RNA Duplex Containing 5-Propynyl U and C Comparison with 5-Me Modifications	175		X	X
5791	Solution structure of a dimeric lactose DNA-binding domain complexed to a nonspecific DNA sequence	761	X	X
5927	NMR Structure of a Cyclic Polyamide-DNA Complex	197		X
5979	A parallel stranded DNA duplex with an A-G mismatch base-pair	229		X
5993	1H shifts for the DNA duplex containing 5-hydroxy Uracil lesion	118		X
6009	NMR structure of the thrombin-binding DNA aptamer stabilized by Sr2+	176		X
6186	Structure of DNA sequence d-TGATCA by two-dimensional nuclear magnetic resonance spec and restrained molecular dynamics	47		X
6273	1H and 31P chemical shift assignments for the triloop DNA hairpin 5'- GTTCACAGAAC - 3'	111		X
6274	1H chemical shift assignments for the triloop DNA hairpin 5'- GTACACAGTAC - 3'	101		X
6276	1H, 13C and 15N resonance assignments for the six-zinc finger domain of the MTF-1 metalloregulatory protein in the DNA bound state	769	X	X
6307	The Solution Structure of d(G3T4G4)2	178		X
6319	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Nkx2.5 Homeodomain plus NK2 Specific Domain in the DNA Bound State	558	X	X
6353	1H, 15N and 13C resonance assignments of the BRCT Region of the large subunit of human Replication Factor C	1182	X	X
6430	1H and 31P chemical shift assignments for HIV-1 integrase inhibitor 93del	163		X
6445	Backbone 1H, 13C, and 15N and 13CB Chemical Shift Assignments for Six C2H2 Zinc Fingers (F1-6) of MTF-1 in the DNA Bound State (22 bp)	820	X	X
6537	Small Molecule Ligand Induces Nucleotide Flipping in (CAG)n Trinucleotide Repeats	164		X
6605	E. Coli Ada in a complex with DNA	1273	X	X
6877	NMR assignments of the Human Papillomavirus type 16 E2C DNA-bound form	664	X	X
6906	1H, 13C, and 15N Chemical Shift Assignments for the Bicoid Homedomain	864	X	X
6975	1H chemical shift assignments for Bcl2MidG4	199		X
7097	DNA recognition by the Brinker nuclear repressor - an extreme case of the coupling between binding and folding	912	X	X
7105	1H, 13C and 15N chemical shift assignments for SRY.B in complex with 16-mer DNA	2275	X	X
7319	Polymerase Beta and Double gap double hairpin DNA	1311	X	X
7354	NMR STRUCTURE OF A PROTEIN-DNA COMPLEX OF AN ALTERED SPECIFICITY MUTANT OF THE LAC REPRESSOR THAT MIMICS THE GAL REPRESSOR	876	X	X
7377	Resonance assignments of the metal sensor CzrA in the apo-, Zn2- and DNA-bound (42 kDa) states	745	X	X
11045	Mhr1p-bound ssDNA	37	X	X
11046	hsRad51-bound ssDNA	37	X	X
11047	RecO-bound ssDNA	37	X	X
11048	RecT-bound ssDNA	37	X	X
11437	DNA oligmer containing propylene cross-linked cyclic 2' -deoxyuridylate dimer	213		X
11438	DNA oligomer containing ethylene cross-linked cyclic 2'-deoxyuridylate dimer	211		X
11528	STRUCTURE OF METALLO-DNA IN SOLUTION	220		X
11608	SOLUTION STRUCTURE OF DNA CONTAINING METALLO-BASE-PAIR	244		X
15026	NMR Structure of the IQ-modified Dodecamer CTCGGC[IQ]GCCATC	204		X
15027	NMR Structure of the B-DNA Dodecamer CTCGGCGCCATC	203		X
15033	Dimeric solution structure of the cyclic octamer d(CCGTCCGT)	67		X
15083	NMR Structure of the Sigma-54 RpoN Domain Bound to the-24 Promoter Element	948	X	X
15213	Assignments of {lambda}-IntCB bound to a DNA half-site	392	X	X
15223	Duplex DNA containing an abasic site with an opposite G (alpha anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	228		X
15224	Duplex DNA containing an abasic site with an opposite G (beta anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	228		X
15227	Duplex DNA containing an abasic site with an opposite T (alpha anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	225		X
15228	Duplex DNA containing an abasic site with an opposite T (beta anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	225		X
15238	Duplex DNA containing an abasic site with an opposite dC (alpha anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	205		X
15239	Duplex DNA containing an abasic site with an opposite dC (beta anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	204		X
15360	Solution Structures of a DNA Dodecamer Duplex	288		X
15376	SOLUTION STRUCTURE OF A DNA DUPLEX CONTAINING THE UNIVERSAL BASE 5-NITROINDOLE-3-CARBOXAMIDE	185		X
15527	1H, 13C, and 31P Chemical Shift Assignments for 14-mer Base Pair Non-self Complementary DNA Duplex ( Mbp1_14) which Contains the Consensus Binding Site of the Yeast Transcription Factor Mbp-1	368		X
15533	Structure of the Wilms' Tumor Suppressor Protein Zinc Finger Domain Bound to DNA	236	X	X
15613	SOLUTION STRUCTURE OF THE BIS-C2-2-NAPHTHYLPYRROLO[2,1-c][1,4]BENZODIAZEPINE (DA046) DNA ADDUCT: THE MOLECULAR BASIS FOR DNA HELIX STABILIZATION.	121		X
15860	NMR solution structure of modified DNA containing imidazole nucleosides at acidic, neutral and basic pH	502		X
15898	H1, C13, 31P chemical shifts of dGCGAAAGC	121		X
16054	Dimeric solution structure of the DNA loop d(TGCTTCGT)	83		X
16055	Dimeric solution structure of the cyclic octamer d(pCGCTCCGT)	79		X
16138	NMR solution structure of metal-modified DNA	332		X
16212	Dimeric solution structure of the DNA loop d(TCGTTGCT)	81		X
16222	NMR Structure of Aflatoxin Formamidopyrimidine alpha-anomer in duplex DNA	220		X
16223	Aflatoxin Formamidopyrimidine alpha anomer in single strand DNA	46		X
16225	Solution Structure of cis-5R,6S-thymine glycol opposite complementary adenine in duplex DNA	251		X
16226	Solution Structure of cis-5R,6S-thymine glycol opposite complementary guanine in duplex DNA	230		X
16280	d(GAGCTC)2 assignments	35		X
16281	d(GAGCTC)2 plus dqdppn	35		X
16282	d(AGAGCTCT)2 assignments	55		X
16286	d(CGAGCTCG)2 assignments	53		X
16287	d(AGAGCTCT)2 plus dqdppn 1:2 assignments	46		X
16288	d(CGAGCTCG)2 plus dqdppn 1:2 assignments	41		X
16289	d(GCTATAGC)2 assignments	55		X
16290	d(GCTATAGC)2 1:1 complex with dqdppn assignments	42		X
16291	d(AGAGCTCT)2 plus Ru ligand 1:2 assignments	40		X
16292	d(CGAGCTCG)2 plus Ru ligand 1:2 assignments	43		X
16356	Structure of a two-G-tetrad intramolecular G-quadruplex formed by a variant human telomeric sequence in K+ solution	210		X
16449	Structure of the XPF-single strand DNA complex	707	X	X
16485	Solution structure of the THAP zinc finger of THAP1 in complex with its DNA target	1337	X	X
16577	Backbone Chemical Shift Assignments of Mouse HOXA13 DNA Binding Domain in Complex with DNA Duplex	423	X	X
16812	data-driven model of MED1:DNA complex	509	X	X
16834	NMR structure of fully methylated GATC site	137		X
16936	Solution structure and dynamic analysis of chicken MBD2 methyl binding domain bound to a target methylated DNA sequence	959	X	X
17129	Chemical shifts of the 25-mer oligonucleotide encompassing the variable region of a MUC1 DNA aptamer.	418		X
17130	Zif 268 with 12bp DNA	339	X	X
17229	C-terminal zinc knuckle of the HIVNCp7 with DNA	153	X	X
17379	QUI/G-quadruplex complex	197		X
17397	Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence	209		X
17409	A biocompatible backbone modification? - Structure and dynamics of a triazole-linked DNA duplex	306		X
17422	Solution Structure of a DNA Duplex Containing the Potent Anti-Poxvirus Agent Cidofovir	166		X
17423	Solution Structure of a DNA Duplex Containing the Potent Anti-Poxvirus Agent Cidofovir	157		X
17452	Chemical Shifts of the Pitx2 Homeodomain in complex with a TAAGCT non-consensus DNA site	786	X	X
17535	DNA / RNA Hybrid containing a central stereo specific Rp borano phosphate linkage	183		X	X
17562	N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenal	147		X
17580	Myc G-quadruplex formed at the 5'-end of NHEIII element	161		X
17592	Backbone assignments of Anabaena Sensory Rhodopsin Transducer with DNA	492	X	X
17655	Structure of Human Telomeric DNA in Crowded Solution	189		X
17697	Structure of a dimeric all-parallel-stranded G-quadruplex stacked via the 5'-to-5' interface	127		X
17708	Solution-state structures of monomeric and dimeric G-quadruplexes adopted by a sequence from N-myc	130		X
17709	Solution-state structures of monomeric and dimeric G-quadruplexes formed by a sequence from N-myc	115		X
17729	Structure of the DNA complex of the C-Terminal domain of Ler	847	X	X
17732	Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA	815	X	X
17746	Oligonucleotide duplex contaning (5'S)-8,5'-cyclo-2'-deoxyguansine	160		X
17786	Structure of the duplex when (5'S)-8,5'-cyclo-2'-deoxyguanosine is placed opposite dT	167		X
17787	Structure of the duplex when (5'S)-8,5'-cyclo-2'-deoxyguanosine is placed opposite dA	164		X
17788	Minor conformer of the DNA-peptide conjugate bridged by trimethylene tether	187	X	X
17789	structure of the duplex containing (5'S)-8,5'-cyclo-2'-deoxyadenosine	171		X
17790	Structure of the duplex containing HNE derived (6S,8R,11S) N2-dG cyclic hemiacetal when placed opposite dT	137		X
17791	Structure of the duplex containing HNE derived (6S,8R,11S) gamma-HO-PdG when placed opposite dT	131		X
17814	Structure of DNA Containing an Aristolactam II-dA Lesion.	82		X
17859	Solution Structure of a DNA duplex Containing an Unnatural, Hydrophobic Base Pair	155		X
17885	Solution NMR structure of a DNA dodecamer containing the 7-aminomethyl-7-deaza-2'-deoxyguanosine adduct	73		X
17887	DNA sequence context conceals alpha anomeric lesion	251		X
17980	Monomer-dimer equilibrium for 5 -5 stacking of propeller-type parallel-stranded G-quadruplexes: NMR structural study	159		X
18015	Chemical shift assignments for the homeodomain of Pitx2 in complex with a TAATCC DNA binding site	833	X	X
18040	DNA TT mismatch and 2,7-BisNP	222		X
18050	Structure of a bis-naphthalene bound to a thymine-thymine DNA mismatch	188		X
18199	Structural Basis for Bifunctional Zn(II) Macrocyclic Complex Recognition of Thymine Bulges in DNA. Structure of a Thymine bulge.	48		X
18209	Solution-state structure of an intramolecular G-quadruplex w th propeller, diagonal and edgewise loops	153		X
18279	human CEB25 minisatellite G-quadruplex	314		X
18427	Solution structure of 2'F-ANA and ANA self-complementary duplex	79		X
18430	Structure and Stability of Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine: An Oxidative Lesion Repair by NER.	149		X
18452	Solution structure of a mini i-motif	116	X	X
18453	NMR structure of duplex DNA containing the -OH-PdG dA base pair: A mutagenic intermediate of acrolein	150		X
18454	NMR structure of duplex DNA containing the -OH-PdG dA base pair: A mutagenic intermediate of acrolein	150		X
18462	Solution NMR structure of Kaiso zinc finger DNA binding domain in complex with Kaiso binding site DNA	2059	X	X
18496	Solution NMR Structure of YdbC:dT19G1 complex. Northeast Structural Genomics Consortium (NESG) Target KR150	1055	X	X
18524	Solution structure of a parallel-stranded oligoisoguanine DNA pentaplex formed by d(T(iG)4T) in the presence of Cs ions	455		X
18625	NMR Structure of the Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'.	200		X
18626	NMR Structure of the Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin	175		X
18638	Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion	142		X
18639	Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion	150		X
18640	Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion	150		X
18690	MOMERIC PIL-E G-QUADRUPLEX DNA FROM NEISSERIA GONORRHOEAE	188		X
18699	DIMERIC PIL-E G-QUADRUPLEX DNA FROM NEISSERIA GONORRHOEAE, N STRUCTURES	134		X
18724	FUC_TBA	171		X
18762	NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing	140		X
18780	DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link	81		X
18781	DNA duplex containing mispair-aligned O6G-heptylene-O6G interstrand cross-link	80		X
18835	Structure of perimidinone-derived synthetic nucleoside paired with guanine in DNA duplex	109		X
18862	Parallel human telomeric quadruplex containing 2'F-ANA substitutions	111		X
18881	NMR solution structure of the d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid	385		X	X
18902	Solution structure of the major G-quadruplex formed in the human VEGF promoter: Insights into loop interactions of the parallel G-quadruplexes	202		X
18907	Solution structure of Duplex DNA	225		X
18935	African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNA	1212	X	X
18973	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : alpha anomer	199		X
18979	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer	199		X
18981	DNA containing a cluster of 8-oxo-guanine and THF lesion	206		X
18984	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : alpha anomer (AP6, 8OG 14)	202		X
18985	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer (6AP, 8OG14)	202		X
19017	Solution structure of an intramolecular propeller-type G-quadruplex containing a single bulge	183		X
19035	G-rich VEGF aptamer with LNA modifications	189		X
19138	ERG DNA Complex	633	X	X
19158	Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions	367		X
19159	Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions	450		X
19222	NMR Studies of DNA Support the Role of Pre-Existing Minor Groove Variations in Nucleosome Indirect Readout	264		X
19276	Structure of d[CGCGAAGCATTCGCG] hairpin	139		X
19277	Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid	240		X
19278	Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid	266		X
19279	Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid	245		X
19280	Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid	263		X
19281	Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid	260		X
19367	Solution structure of the complex formed by the region 2 of E. coli sigmaE and its cognate -10 non template element TGTCAAA	1104	X	X
19375	NMR Structure of N2-IQ-dG at the G3 position in the NarI recognition sequence	213		X
19381	Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes	186		X
19386	parallel-stranded G-quadruplex in DNA poly-G stretches	164		X
19387	Solution structure of an intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative	233		X
19389	Solution structure of a stacked dimeric G-quadruplex formed by a segment of the human CEB1 minisatellite	134		X
19391	Solution structure of MBD3 methylcytosine binding domain while bound to hydroxymethylated DNA	814	X	X
19402	Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution)	229		X
19435	Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence	196		X
19440	NMR structure of DNA duplex	174		X
19441	NMR structure of spermine modified DNA duplex	178		X
19448	Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence	196		X
19511	NMR Structure of the homeodomain transcription factor Gbx1 from Homo sapiens solved in the presence of the DNA sequence CGACTAATTAGTCG	816	X	X
19540	haddock model of MyT1 F4F5 - DNA complex	217	X	X
19571	Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions.	345		X
19572	Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions.	180		X
19592	Molecular Binding of TFF1 Estrogen Response Element by a DNA Bis-intercalating Anticancer Drug XR5944	287		X
19594	Solution structure of a G-quadruplex bound to the bisquinolinium compound Phen-DC3	168		X
19620	Solution structure of DNA duplex containing N3T-ethylene-N1I interstrand cross-link	116		X
19653	RRM domain from C. elegans SUP-12	1250	X	X
19659	Structure of Exocyclic R,R N6,N6-(2,3-Dihydroxy-1,4-butadiyl)-2'-Deoxyadenosine Adduct Induced by 1,2,3,4-Diepoxybutane in DNA	201		X
19661	Structure of Exocyclic S,S N6,N6-(2,3-Dihydroxy-1,4-butadiyl)-2'-Deoxyadenosine Adduct Induced by 1,2,3,4-Diepoxybutane in DNA	198		X
19695	NMR studies of N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA: Impact of adduct stereochemistry, size, and local DNA structure on solution conformations	137		X
19696	Nuclear magnetic resonance studies of N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA: Impact of adduct stereochemistry, size, and local DNA structure on solution conformations	140		X
19728	A tetrahelical DNA fold adopted by alternating GGG and GCG tracts	112		X
19734	Complete chemical shift assignment of the ssDNA in the filamentous bacteriophage fd report on its conformation and on its interface with the capsid shell	44	X	X
19745	Solution NMR structure of a mismatch DNA	212		X
19747	13C and 15N Chemical Shift Assignments for the M13 Bacteriophage	291	X	X
19784	Solution structure of the G-triplex truncated-TBA	194		X
19805	13C and 15N Chemical Shift Assignments for the dsDNA in Bacteriophage T7	53		X
19853	AFB1 FAPY modified AGA duplex	161		X
19861	AFB1 FAPY modified AGT duplex	140		X
19862	E isomer of AFB1 FAPY modified AGC duplex	133		X
19863	AFB1 FAPY modified AG(7-deaza)G duplex	128		X
19886	MINOR GROOVE RECOGNITION OF DNA BY THIAZOTROPSIN ANALOGUES	98		X
19888	MINOR GROOVE RECOGNITION OF DNA BY THIAZOTROPSIN ANALOGUES	82		X
19889	MINOR GROOVE RECOGNITION OF DNA BY THIAZOTROPSIN ANALOGUES	96		X
19890	MINOR GROOVE RECOGNITION OF DNA BY THIAZOTROPSIN ANALOGUES	82		X
19912	MAJOR GROOVE ORIENTATION OF THE (2S)-N6-(2-HYDROXY-3-BUTEN-1-YL)-2'-DEOXYADENOSINE DNA ADDUCT INDUCED BY 1,2-EPOXY-3-BUTENE	163		X
19917	Solution NMR structure of DNA dodecamer containing the 5-hydroxycytosine	70		X
19925	Solution NMR structure of DNA dodecamer with A:C mismatch	72		X
19939	Solution structure of MBD4 methyl-cytosine binding domain bound to methylated DNA	892	X	X
19957	Assignment of DNA-MC1 protein complex	1054	X	X
25092	truncated EcMazE-DNA complex	126	X	X
25099	Dimeric structure of the Human A-box	100		X
25107	Human Telomeric G-quadruplex DNA sequence (TTAGGGT)4 complexed with Flavonoid Quercetin	61		X
25110	Solution structure of a left-handed G-quadruplex	267		X
25369	Solution Structure of DNA Dodecamer with 8-oxoguanine at 10th Position.	160		X
25378	A structure of G-quadruplex	232		X
25407	Structure of the DNA complex of the C-Terminal domain of MvaT	750	X	X
25528	Solution Structure of DNA Dodecamer with 8-oxoguanine at 4th Position	162		X
25531	N2-dG-IQ modified DNA at the G1 position of the NarI recognition sequence	156		X
25582	structure of a protein	209	X	X
25596	Structure of DNA G-quadruplex adopted by ALS and FTD related GGGGCC repeat with G21 to Br-G21 substitution	166		X
25651	Isolation and structural characterization of an active G-quadruplex motif from AGRO100	247		X
25672	Base-displaced intercalated structure of the N-(2'deoxyguanosin-8-yl)-3-aminobenzanthrone DNA adduct	184		X
25686	Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome	209		X
25701	Backbone assignments and ILV methyl assignments for EcoRV bound to 16-mer double stranded DNA (GCAAAGATATCTTTCG) without Lu3+	787	X	X
25723	Universal Base oligonucleotide structure	152		X
25724	Universal base control oligonucleotide structure	149		X
25746	G-quadruplex structure	114		X
25752	Backbone assignments and ILV methyl assignments for EcoRV bound to 16-mer double stranded DNA (GCAAAGATATCTTTCG) with Lu3+	779	X	X
25759	Solution structure for quercetin complexed with c-myc G-quadruplex DNA	57		X
25840	Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC at acidic pH	51		X
25882	Structural basis for DNA cleavage by the potent antiproliferative agent (-)-lomaiviticin A	163		X
25888	1H, 13C and 15N chemical shift assignments and solution structure for PARP-1 F1F2 domains in complex with a DNA single-strand break	1564	X	X
25890	1H chemical shift assignments for 45 nucleotide DNA dumbbell (model for single-strand break with one-nucleotide gap)	340		X
25891	1H, 13C and 15N chemical shift assignments for PARP-1 F1F2F3 domains in complex with a DNA single-strand break	1018	X	X
25894	1H and 15N chemical shift assignments for PARP-1 F1F2F3 domains in complex with PARP-1 WGR domain and a DNA single-strand break	888	X	X
25903	Glucose as non natural nucleobase	212		X
25906	Glucose as a nuclease mimic in DNA	235		X
25915	Photoswitchable G-quadruplex	82		X
26620	Amide/Methyl/Aromatic chemical shift and order parameter of Barnase-dCGAC	438	X	X
26731	Structural and dynamics studies of Pax5 reveal asymmetry in stability and DNA binding by the Paired domain	694	X	X
26808	Egr-1 - DNA complex	1017	X	X
26931	Backbone chemical shifts of the MBD2/3 methyl-cytosine binding domain from Ephydatia muelleri	304	X	X
26978	MeCP2 bound to methylated DNA	643	X	X
27053	NMR chemical shift assignments of a 22mer G-quadruplex formed within the KRAS proto-oncogene promoter region	218		X
27144	DNA with compounds	207		X
27173	1H, 13C, and 15N resonance assignments of a 22mer G-quadruplex forming within KRAS oncogene promoter region at physiological temperature	351		X
27364	Backbone 1H, 15N chemical shift assignments of Kaiso zinc finger DNA binding domain in complex with its double CpG-methylated DNA consensus binding site (MeCG2)	222	X	X
27366	Backbone 1H, 15N chemical shift assignments of Kaiso E535Q zinc finger DNA binding domain in complex with its double CpG-methylated DNA consensus binding site (MeCG2)	222	X	X
27367	Backbone 1H, 15N chemical shift assignments of Kaiso E535A zinc finger DNA binding domain in complex with its double CpG-methylated DNA consensus binding site	222	X	X
27368	Backbone 1H, 15N chemical shift assignments of Kaiso zinc finger DNA binding domain in complex with a double CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	228	X	X
27369	Backbone 1H, 15N chemical shift assignments of Kaiso E535Q zinc finger DNA binding domain in complex with a double CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	228	X	X
27370	Backbone 1H, 15N chemical shift assignments of Kaiso E535A zinc finger DNA binding domain in complex with a double CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	228	X	X
27371	Backbone 1H, 15N chemical shift assignments of Kaiso zinc finger DNA binding domain in complex with a semi-CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	228	X	X
27372	Backbone 1H, 15N chemical shift assignments of Kaiso zinc finger DNA binding domain in complex with a hemi-CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	228	X	X
27404	1H, 15N, 13C backbone resonance assignments of the nuclease core residues 2-336 of K93A human flap endonuclease-1 in complex with dual-hairpin DNA substrate	544	X	X
27409	Ile and Met methyl 1H and 13C chemical shifts of DNA polymerase beta and 1-nucleotide gapped double hairpin DNA binary complex	116	X	X
27410	Ile and Met methyl 1H and 13C chemical shifts of DNA polymerase beta, 1-nucleotide gapped double hairpin DNA and dAMPCPP ternary complex	116	X	X
27560	protein-gapped DNA complex (Polymerase beta) ILV Methyl Assignments	304	X	X
27561	protein-gapped DNA-nucelotide complex (Polymerase beta) ILV Methyl Assignments	304	X	X
27652	NZ118	111		X
27828	Chemical shifts for d(CGATATCG)2; free form	50		X
27829	Chemical shifts for intercalation complex between d(CGATATCG)2 and C-1305	100		X
27958	Spin-labeled DNA duplex	618		X
28081	Trimolecular G-quadruplex	203		X
30012	NMR structure of a new G-quadruplex forming sequence within the KRAS proto-oncogene promoter region	218		X
30015	DNA duplex containing a ribonolactone lesion	190		X
30016	DNA duplex containing a ribonolactone lesion	187		X
30038	Solution Structure of DNA Dodecamer with 8-oxoguanine at 4th Position	200		X
30044	Solution Structure of DNA Dodecamer with 8-oxoguanine at 10th Position	200		X
30045	DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium	210		X
30052	NMR solution structure of [Rp, Rp]-PT dsDNA	162		X
30053	Solution NMR structure of PT-free dsDNA from Streptomyces lividans	172		X
30054	NMR solution structure of [Sp, Sp]-PT dsDNA	130		X
30055	DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTTGG) in sodium	193		X
30056	DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTGG) in sodium	161		X
30058	DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium	256		X
30105	Structural impact of single ribonucleotides in DNA	144		X		X
30111	Structural impact of single ribonucleotides in DNA	145		X
30112	Structural impact of single ribonucleotides in DNA	145		X
30113	Structural impact of single ribonucleotides in DNA	144		X		X
30114	Structural impact of single ribonucleotides in DNA	144		X		X
30115	Structural impact of single ribonucleotides in DNA	144		X		X
30116	Structural impact of single ribonucleotides in DNA	144		X		X
30117	Structural impact of single ribonucleotides in DNA	144		X		X
30148	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd Position	192		X
30151	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 9th Position	190		X
30191	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd Position and 9th position	190		X
30198	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd Position and 9th position	170		X
30250	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd position and 8-oxoguanine at the 10th position	170		X
30251	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd and 9th position and 8-oxoguanine at the 10th position	176		X
30252	Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 9th position and 8-oxoguanine at the 10th position	172		X
30253	Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A2-DNA structure	300		X
30254	Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A6-DNA structure	308		X
30255	Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A6-DNAm1A16 structure	305		X
30328	Solution structure of a DNA dodecamer with 5-methylcytosine at the 3rd and 9th position and 8-oxoguanine at the 4th position	176		X
30329	Solution structure of a DNA dodecamer with 5-methylcytosine at the 3rd and 8-oxoguanine at the 4th position	174		X
30335	NMR and Restrained Molecular Dynamics Determination of the Structure of an Aza-Benzimidazole Derivative Complex with the DNA Minor Groove of an -AAGATA- Sequence	131		X
30336	NMR and Restrained Molecular Dynamics Determination of the Structure of an Aza-Benzimidazole Derivative Complex with the DNA Minor Groove of an -AAGATA Sequence	132		X
30402	Hybrid-2 form Human Telomeric G Quadruplex in Complex with Epiberberine	269		X
30473	NMR structure for Sp1 transcription factor duplex 5'-d(GGGGCGGGG)	244		X
30484	NMR structure for Sp1 transcription factor duplex 5'-d(GGGGCGGGA)	138		X
30485	NMR structure for Sp1 transcription factor duplex 5'-d(TGGGCGGGG)	133		X
30506	NMR structure for Sp1 transcription factor duplex 5'-d(TGGGCGGGA)	139		X
30552	MYC Promoter G-Quadruplex with 1:6:1 loop length	292		X
30577	NMR structure of the 2:1 complex of a carbazole derivative BMVC bound to c-MYC G-quadruplex	203		X
30688	Molecular Recognition of Guanine Metabolites and Drugs by Vacancy-Bearing G-Quadruplex in the PDGFR-b Promoter	171		X
30759	Structure of a Stable Interstrand DNA Crosslink Involving an dA Amino Group and an Abasic Site	196		X
30803	Solution structure of the major MYC promoter G-quadruplex with a wild-type flanking sequence	234		X
30804	Solution structure of the major MYC promoter G-quadruplex with a wild-type flanking in complex with NSC85697, a quinoline derivative	228		X
30805	Solution structure of the major MYC promoter G-quadruplex in complex with NSC85697, a quinoline derivative	205		X
30822	Deoxyuridine in DNA Structure: Solution Structure of [d(CGUGAATTCGCG)]2	78		X
30823	1,N6-ethenoadnine (E) in dsDNA sequence (5'-CGCGEATTCGCG-3')	85		X
30907	Solution Structure of Berberine Bound to a dGMP Fill-in G-Quadruplex in the PDGFR-b Promoter	171		X
30923	Solution structure of the MYC promoter G-quadruplex in complex with berberine: conformer A	230		X
30924	Solution structure of the MYC promoter G-quadruplex in complex with berberine: conformer B	230		X
30940	Hairpin near 3'-Splice Site of Influenza A Segment 7 Bound to 5-nt Oligonucleotide	189		X	X
34025	G-Quadruplex formed at the 5'-end of NHEIII_1 Element in human c-MYC promoter bound to triangulenium based fluorescence probe DAOTA-M2	138		X
34034	A two-quartet G-quadruplex formed by human telomere in KCl solution at neutral pH	182		X
34035	A two-quartet G-quadruplex formed by human telomere in KCl solution at pH 5.0	172		X
34051	Structure of DNA AGCGA-quadruplex adopted by 15-mer d(GCGAGGGAGCGAGGG), VK34, oligonucleotide found in regulatory region of the PLEKHG3 human gene	137		X
34053	Structure of a stable G-hairpin	109		X
34054	Structure of DNA tetrameric AGCGA-quadruplex adopted by 15-mer d(GCGAGGGAGCGAGGG), VK34, oligonucleotide found in regulatory region of the PLEKHG3 human gene	103		X
34056	Structure of DNA AGCGA-quadruplex adopted by 15-mer oligonucleotide found in regulatory region of the PLEKHG3 human gene with G11 to I11 mutation, d(GCGAGGGAGCIAGGG),VK34_I11	79		X
34062	Quadruplex with flipped tetrad formed by a human telomeric sequence	243		X
34063	Quadruplex with flipped tetrad formed by an artificial sequence	184		X
34071	2'F-ANA/DNA Chimeric TBA Quadruplex structure	146		X
34083	G-quadruplex formed within promoters of Plasmodium falciparum B var genes	301		X
34084	G-quadruplex formed within promoters of Plasmodium falciparum B var genes - form I	305		X
34086	Solution structure of a human G-Quadruplex hybrid-2 form in complex with a Gold-ligand	250		X
34118	An i-motif containing the neutral cytidine protonated analogue pseudoisocytidine	75		X
34135	M2 G-quadruplex dilute solution	182		X
34136	M2 G-quadruplex 20 wt% ethylene glycol	184		X
34137	M2 G-quadruplex 10 wt% PEG8000	184		X
34145	G-quadruplex of Human papillomavirus type 52	248		X
34157	NtMe polyamide in complex with 5'CGATGTACATCG3'- hairpin polyamides studies	482		X
34158	NtiPr polyamide in complex with 5'CGATGTACTACG3	431		X
34159	Im polyamide in complex with 5'CGATGTACATCG3'- hairpin polyamides studies	484		X
34162	Structure of minimal i-motif domain	116		X
34168	G-quadruplex structure of DNA oligonucleotide containing GGGGCC repeats linked to ALS and FTD	176		X
34172	NMR structure of the complex formed by an engineered region 2 of sigmaE in complex with GTAAAA	1256	X	X
34174	2'F-ANA-G modified quadruplex with a flipped tetrad	191		X
34186	Quadruplex with flipped tetrad formed by the c-myc promoter sequence	158		X
34210	2'F-araG modified quadruplex with flipped G-tract and central tetrad	167		X
34221	The 1,8-bis(aminomethyl)anthracene and Quadruplex-duplex junction complex	219		X
34244	Concerted dynamics of metallo-base pairs in an A/B-form helical transition (major species)	292		X
34245	Concerted dynamics of metallo-base pairs in an A/B-form helical transition (minor species)	150		X
34269	Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure	193		X
34276	Tc-DNA/RNA duplex	349		X	X
34277	tc-DNA/tc-DNA duplex	190		X
34280	Tc-DNA/DNA duplex	293		X
34290	Hybrid structure of the pRN1 helix bundle domain in complex with DNA and 2 ATP molecules	1330	X	X
34291	NMR structure of the DNA-bound helix bundle domain from the functional pRN1 primase	1186	X	X
34296	Polyamide - DNA complex NMR structure	200		X
34297	Adenine-driven structural switch from two- to three-quartet DNA G-quadruplex	156		X
34302	The major G-quadruplex form of HIV-1 LTR	229		X
34328	Dodecamer DNA containing the synthetic base pair P-Z	181		X
34331	Human telomeric G-quadruplex with 8-oxo-G substitution in the central G-quartet	165		X
34332	Human telomeric G-quadruplex with 8-oxo-G substitution in the outer G-quartet	157		X
34353	TINA-conjugated antiparallel DNA triplex	178		X
34378	Structure of kiteplatinated dsDNA	200		X
34386	SC14 G-hairpin	135		X
34389	A quadruplex hybrid structure with lpp loop orientation and 3 syn residues	136		X
34390	A quadruplex hybrid structure with lpp loop orientation and 5 syn residues	164		X
34397	Imidazole Polyamide-DNA complex NMR structure (5'-CGATGTACATCG-3')	214		X
34398	Concerted dynamics of metallo-base pairs in an A/B-form helical transition (apo species)	304		X
34403	2'-F-riboguanosine modified G-quadruplex with V-loop	149		X
34431	NMR structure of KRAS32R G9T conformer G-quadruplex within KRAS promoter region	469		X
34435	Intercalation of heterocyclic ligand between quartets in G-rich tetrahelical structure	217		X
34436	Guanine-rich oligonucleotide with 5'-GC end form G-quadruplex with A(GGGG)A hexad, GCGC- and G-quartets and two symmetric GG and AA base pairs	126		X
34438	Guanine-rich oligonucleotide with 5'- and 3'-GC ends form G-quadruplex with A(GGGG)A hexad, GCGC- and G-quartets and two symmetric GG and AA base pair	145		X
34441	NMR structure of KRAS32R G25T conformer G-quadruplex within KRAS promoter region	304		X
34444	2'-F-arabinoguanosine and 2'-F-riboguanosine modified hybrid type G-quadruplex with V-loop	137		X
34445	2'-F-riboguanosine and 2'-F-arabinoguanosine modified G-quadruplex with V-loop and all-syn G-tract	156		X
34467	Pre-folded structures govern folding pathways of human telomeric G-quadruplexes	50		X
34499	2'-F-riboguanosine and LNA modified hybrid type G-quadruplex with V-loop	134		X
34502	LNA modified G-quadruplex with flipped G-tract and central tetrad	149		X
34516	Parallel 17-mer DNA G-quadruplex	153		X
34524	Structure of a parallel c-Myc modified with 3' duplex stem-loop overhang	285		X
34525	Structure of a parallel c-Myc modified with 5' duplex stem-loop overhang	237		X
34529	G-quadruplex with a G-A bulge	185		X
34533	Structure of a parallel c-myc modified with 5' duplex stem-loop and 3' diagonal snap-back loop	242		X
34542	Antiparallel basket-type G-quadruplex DNA structure formed in human Bcl-2 promoter containing 8-oxoG	180		X
34543	Antiparallel basket-type G-quadruplex DNA structure formed in human Bcl-2 promoter	166		X
34565	NMR structure of a DNA G-quadruplex containing two SP1 binding sites from HIV-1 promoter	316		X
34571	G-quadruplex with V-shaped loop from the first repeat of KCNN4 minisatellite	170		X
34579	Synthetic DNA duplex dodecamer	265		X
34580	Single modified phosphoryl guanidine DNA duplex, Sp diastereomer	285		X
34581	DNA duplex with phosphoryl guanidine moiety, Rp-diastereomer	235		X
34587	deoxyxylose nucleic acid hairpin	252		X
34588	deoxyxylose nucleic acid hairpin	233		X
34590	GA repetition with i-motif clip at 5'-end	70		X
34591	GA attached to an i-motif clip at 3'-end	43		X
34592	AG repetition attached to a compact i-motif clip at 3'-end	50		X
34593	AG repetition attached to an extended i-motif clip at 3'-end	54		X
34594	Solution structure of DNA duplex containing a 2'-deoxy-2'2'-difluorodeoxycytidine (gemcitabine) modification	120		X
34595	Solution structure of DNA:RNA hybrid containing a 2'-deoxy-2'2'-difluorodeoxycytidine (gemcitabine) modification	113		X	X
34596	Solution structure of DNA duplex containing a 7,8-dihydro-8-oxo-1,N6-ethenoadenine base modification that induces exclusively A->T transversions in Escherichia coli	146		X
34599	Solution structure of DNA:RNA hybrid duplex	121		X	X
34611	Three-quartet c-kit2 G-quadruplex stabilized by a pyrene conjugate	166		X
34615	Hybrid-2R quadruplex-duplex with (-p-p-l) topology and 3 syn residues	203		X
34616	The structure of an i-motif/duplex junction at neutral pH	222		X
34623	A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine	105		X
34624	A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine	108		X
34625	A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine	67		X
34626	A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine	72		X
34631	G-quadruplex structure of the C. elegans telomeric repeat: A two tetrads basket type conformation stabilised by a Hoogsteen C-T base-pair	253		X
34654	Pre-catalytic complex of 10-23 DNAzyme with RNA target	547		X	X
34664	Parallel Q-D hybrid with 3' duplex stem-loop as a lateral snapback loop	292		X
34665	Solution structure of 1:1 complex of an indoloquinoline derivative SYUIQ-5 to parallel quadruplex-duplex (Q-D) hybrid	273		X
34679	10bp DNA/DNA duplex	188		X
34685	Solution structure of a lanthanide-binding DNA aptamer	858		X
34714	Phen-DC3 intercalation causes hybrid-to-antiparallel transformation of human telomeric DNA G-quadruplex	205		X
34721	Structure of a hybrid-type G-quadruplex with a snapback loop (hybrid 1R')	164		X
34722	Structure of a parallel G-quadruplex with a snapback loop	174		X
34723	Structure of a hybrid-type G-quadruplex with a snapback loop and an all-syn G-column (hybrid-1R)	148		X
34735	Dimeric i-motif from 2'Farabinocytidine-modified TC5	126		X
34740	Solution structure of Phen-DC3 intercalating into a quadruplex-duplex hybrid	290		X
34741	Solution structure of a phenyl-indoloquinoline intercalating into a quadruplex-duplex hybrid	213		X
34768	Hairpin adopted by modified oligonucleotide A32_mod found in the promoter of AUTS2 gene.	200		X
34769	Hairpin of adopted by oligonucleotide A36 found in the promoter of AUTS2 gene.	233		X
34770	Hairpin adopted by oligonucleotide A38 found in the promoter of AUTS2 gene.	236		X
34772	An i-motif domain able to undergo pH-dependent conformational transitions (acidic structure)	183		X
34774	An i-motif domain able to undergo pH-dependent conformational transitions (neutral structure)	172		X
36001	Structure model of a protein-DNA complex	1148	X	X
36020	Structure of two CCTG repeats	82		X
36022	Structure of two TTTA repeats	90		X
36116	The structure of a chair-type G-quadruplex of the human telomeric variant in K+ solution	175		X
36159	Solution structure for the 1:1 complex of a platinum(II)-based tripod bound to a hybrid-1 human telomeric G-quadruplex	260		X
36160	Solution structure for the unique dimeric 4:2 complex of a platinum(II)-based tripod bound to a hybrid-1 human telomeric G-quadruplex	262		X
36168	Solution structure of G-quadruplex formed in vegfr-2 proximal promoter sequence	271		X
36174	SOLUTION NMR STRUCTURE OF A 14-MER DOUBLE STRANDED DNA DUPLEX CGCGAAATTTCGCG	258		X
36186	Solution Structure of the DNA complex of the C-terminal Domain of Rok	1409	X	X
36378	NMR solution structures of the DNA minidumbbell formed by 5'-mCTTGXmCTTG-3'	102		X
36379	NMR solution structures of the DNA minidumbbell formed by two CmCTG repeats at pH 5	85		X
36380	NMR solution structures of the DNA minidumbbell formed by two CCTG repeats at pH 5	76		X
36404	Solution structure of the C-clamp domain from human HDBP1 in complex with DNA	611	X	X
36411	Aptamer enhancing peroxidase activity of myoglobin	220		X
50109	Nonexchangeable proton shifts for d(GTATGGCCATAC)2	83		X
50278	Canonical and modified dsDNA 12mers	159		X
50378	M2, M2-L1, M2-L3, M2-L1L3 G-quadruplexes + Trisubstituted Naphtalene Diimide NDI-5	763		X
50604	Human Histone H2A type-2A in Nucleosome	72	X	X
50610	T9 DNA	172		X
50611	U9 DNA	252		X
50613	U8 DNA	248		X
50614	dhU3 DNA	241		X
50615	DDD DNA	241		X
50616	A3T3 DNA	155		X
50617	MeC9 DNA	155		X
50625	A (3+1) hybrid G-quadruplex containing right loop progression	237		X
50805	Histone H3 tail within tetrasome	134	X	X
50806	Histone H3 tail within nucleosome	130	X	X
50807	Histone H3 tail within hexasome	231	X	X
50831	1H, 15N, 13C, backbone resonance assignment of the 5'-GG(m6A)CT-3' bound human Alkbh5, pH 6.0	1803	X	X
50847	ZEBRA-responsive element 2 DNA	42		X
50848	methylated ZEBRA-responsive element 2 DNA	42		X
50986	Proton NMR chemical shifts of GGCCTG2	93		X
50987	Proton NMR chemical shifts of GGCCTG3	123		X
50988	Proton NMR chemical shifts of GGCCTG3-T2	101		X
50989	Proton NMR chemical shifts of GGCCTG4	158		X
51032	loxP spacer 10-mer	117		X
51035	loxP spacer 12-mer	81		X
51036	loxP spacer 16-mer	258		X
51037	loxP spacer 22-mer	33		X
51047	lox4 spacer 16-mer	149		X
51140	H3 tail in 193-bp nucleosome	290	X	X
51141	H3 tail in 145-bp nucleosome	422	X	X
51142	H3 tail in 145-bp nucleosome	83	X	X
51143	H3 tail in 193-bp nucleosome	86	X	X
51161	Backbone assignments of p65 DNA binding domain in complex with DNA.	268	X	X
51177	Histone H2A and H2B tails within 112-bp hexasome	102	X	X
51178	Histone H2A and H2B tails within 112-bp DNA/pAID nucleosome	839	X	X
51337	5caC-containing dsDNA 12mers at three pH conditions	297		X
51704	Histone H3 Core Domain in Chromatin with Different DNA Linker Lengths Studied by 1H-Detected Solid-State NMR Spectrsocopy	302	X	X
51705	Histone H3 Core Domain in Chromatin with Different DNA Linker Lengths Studied by 1H-Detected Solid-State NMR Spectrsocopy	303	X	X
51706	Histone H3 Core Domain in Chromatin with Different DNA Linker Lengths Studied by 1H-Detected Solid-State NMR Spectrsocopy	410	X	X