BMRB - Biological Magnetic Resonance Bank

BMRB Query Grid

Select desired data type(s) and optionally limit polymer type(s). You can select multiple values by holding the "control" key (Windows, Linux) or "option" key (MacOS) while clicking. All data type selections are applied using a logical AND operator. Polymer selection join type can be selected. Click a column header to sort by that column.

Data type(s): Polymer type(s): Polymer join type:

Number of entries returned: 90

Download all matching entries in NMR-STAR as a compressed file or download the results displayed on this page in CSV format.

BMRB ID	Entry Title	Carbon shifts	Nitrogen shifts	Phosphorus shifts	Hydrogen shifts	Other shifts	Protein	DNA	RNA	Other
4141	vnd/NK-2 Homeodomain DNA Complex Protein 1H, 13C, and 15N Chemical Shifts and HNHA Coupling Constant	291	100	18	904	0	X	X
4172	Response Element of the Orphan Nuclear Receptor Rev-erb Beta	0	0	28	268	0		X
4235	NMR Solution Structure of [d(GCGAATTCGC)2]	0	0	9	82	0		X
4243	Intercalated d(TCCCGTTTCCA) dimer	0	0	10	84	0		X
4244	NMR Solution Structure of [d(GCGAAT-3'-3'-alphaT-5'-5'-CGC)2]	0	0	9	94	0		X
4361	Structure determination by restrained molecular dynamics using NMR pseudocontact shifts as experimentally determined constraints	80	0	7	152	0		X		X
4362	Structure determination by restrained molecular dynamics using NMR pseudocontact shifts as experimentally determined constraints	96	0	7	160	0		X		X
4415	Solution-state structure of a DNA dodecamer duplex containing a cis-syn thymine cyclobutane dimer.	0	0	22	193	0		X
4416	Solution-State Structure of a DNA Dodecamer Duplex Containing a Cis-Syn Thymine Cyclobutane Dimer.	0	0	22	193	0		X
4547	Solution structure of a DNA.RNA hybrid containing an alpha-anomeric thymidine and polarity reversals: d(ATGG-3'-3'-(alpha-T)-5'-5'-GCTC).r(gagcaccau)	0	0	16	168	0		X	X
4555	31P NMR analysis of the DNA conformation induced by protein binding:SRY-DNA complexes	0	0	26	243	0		X
4556	31P NMR analysis of the DNA conformation induced by protein binding:SRY-DNA complexes	0	0	14	137	0		X
4646	Structural NMR characterization of an 11-mer DNA Duplex Containing a 2'-deoxyaristeromycin 8-oxo-Guanine pair, nonhydrolyzable substrate analog for the DNA repair enzyme MutY	0	0	17	144	0		X
4692	SOLUTION STRUCTURE OF A HUMAN TELOMERE FRAGMENT	0	0	21	245	0		X
4746	Average solution structure of d(TTGGCCAA)2 bound to Chromomycin-A3 and cobalt	80	0	7	127	0		X		X
4753	Average solution structure of d(TTGGCCAA)2 bound to Chromomycin-A3 and zinc	96	0	7	135	0		X		X
5134	Solution Structure of dAAUAA DNA Bulge	0	0	27	248	0		X
5135	Solution Structure of dAATAA DNA Bulge	0	0	26	241	0		X
5245	Heteroduplex of chirally pure R-methylphosphonate/DNA duplex	0	0	13	109	0		X
5282	Refinement of d(GCGAAGC) Hairpin Structure Using One- and Two-Bonds Residual Dipolar Couplings	35	9	6	68	0		X
5671	Overall structure and sugar dynamics of a DNA dodecamer from homo and heteronuclear dipolar couplings and 31P chemical shift anisotropy	0	0	22	0	0		X
5681	DIMERIC SOLUTION STRUCTURE OF THE CYCLIC OCTAMER CD(CGCTCATT)	0	0	8	91	0		X
6009	NMR structure of the thrombin-binding DNA aptamer stabilized by Sr2+	0	0	14	162	0		X
6273	1H and 31P chemical shift assignments for the triloop DNA hairpin 5'- GTTCACAGAAC - 3'	0	0	10	101	0		X
6430	1H and 31P chemical shift assignments for HIV-1 integrase inhibitor 93del	0	0	15	148	0		X
15033	Dimeric solution structure of the cyclic octamer d(CCGTCCGT)	20	0	4	43	0		X
15360	Solution Structures of a DNA Dodecamer Duplex	0	0	22	266	0		X
15376	SOLUTION STRUCTURE OF A DNA DUPLEX CONTAINING THE UNIVERSAL BASE 5-NITROINDOLE-3-CARBOXAMIDE	0	0	15	170	0		X
15527	1H, 13C, and 31P Chemical Shift Assignments for 14-mer Base Pair Non-self Complementary DNA Duplex ( Mbp1_14) which Contains the Consensus Binding Site of the Yeast Transcription Factor Mbp-1	116	0	25	227	0		X
15898	H1, C13, 31P chemical shifts of dGCGAAAGC	42	0	7	72	0		X
16225	Solution Structure of cis-5R,6S-thymine glycol opposite complementary adenine in duplex DNA	0	0	20	231	0		X
16282	d(AGAGCTCT)2 assignments	0	0	7	48	0		X
16286	d(CGAGCTCG)2 assignments	0	0	7	46	0		X
16289	d(GCTATAGC)2 assignments	0	0	7	48	0		X
17129	Chemical shifts of the 25-mer oligonucleotide encompassing the variable region of a MUC1 DNA aptamer.	139	0	25	254	0		X
17535	DNA / RNA Hybrid containing a central stereo specific Rp borano phosphate linkage	36	0	16	130	1		X	X
17887	DNA sequence context conceals alpha anomeric lesion	56	0	18	177	0		X
18040	DNA TT mismatch and 2,7-BisNP	0	0	20	202	0		X
18050	Structure of a bis-naphthalene bound to a thymine-thymine DNA mismatch	0	0	9	179	0		X
18279	human CEB25 minisatellite G-quadruplex	56	0	25	233	0		X
18973	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : alpha anomer	0	0	20	179	0		X
18979	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer	0	0	20	179	0		X
18981	DNA containing a cluster of 8-oxo-guanine and THF lesion	0	0	21	185	0		X
18984	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : alpha anomer (AP6, 8OG 14)	0	0	20	182	0		X
18985	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer (6AP, 8OG14)	0	0	20	182	0		X
19158	Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions	0	0	18	349	0		X
19159	Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions	0	0	22	428	0		X
19222	NMR Studies of DNA Support the Role of Pre-Existing Minor Groove Variations in Nucleosome Indirect Readout	0	0	264	0	0		X
19387	Solution structure of an intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative	0	0	23	210	0		X
19440	NMR structure of DNA duplex	0	0	14	160	0		X
19441	NMR structure of spermine modified DNA duplex	0	0	14	164	0		X
19734	Complete chemical shift assignment of the ssDNA in the filamentous bacteriophage fd report on its conformation and on its interface with the capsid shell	39	0	5	0	0	X	X
19784	Solution structure of the G-triplex truncated-TBA	66	0	9	119	0		X
25723	Universal Base oligonucleotide structure	0	0	16	136	0		X
25724	Universal base control oligonucleotide structure	0	0	16	133	0		X
30038	Solution Structure of DNA Dodecamer with 8-oxoguanine at 4th Position	0	0	14	186	0		X
30044	Solution Structure of DNA Dodecamer with 8-oxoguanine at 10th Position	0	0	14	186	0		X
30052	NMR solution structure of [Rp, Rp]-PT dsDNA	0	0	18	144	0		X
30053	Solution NMR structure of PT-free dsDNA from Streptomyces lividans	0	0	16	156	0		X
30054	NMR solution structure of [Sp, Sp]-PT dsDNA	0	0	18	112	0		X
30105	Structural impact of single ribonucleotides in DNA	0	0	16	128	0		X		X
30111	Structural impact of single ribonucleotides in DNA	0	0	16	129	0		X
30112	Structural impact of single ribonucleotides in DNA	0	0	16	129	0		X
30113	Structural impact of single ribonucleotides in DNA	0	0	16	128	0		X		X
30114	Structural impact of single ribonucleotides in DNA	0	0	16	128	0		X		X
30115	Structural impact of single ribonucleotides in DNA	0	0	16	128	0		X		X
30116	Structural impact of single ribonucleotides in DNA	0	0	16	128	0		X		X
30117	Structural impact of single ribonucleotides in DNA	0	0	16	128	0		X		X
30253	Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A2-DNA structure	113	10	22	155	0		X
30254	Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A6-DNA structure	115	10	22	161	0		X
30255	Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A6-DNAm1A16 structure	115	10	20	160	0		X
30473	NMR structure for Sp1 transcription factor duplex 5'-d(GGGGCGGGG)	70	0	10	164	0		X
30940	Hairpin near 3'-Splice Site of Influenza A Segment 7 Bound to 5-nt Oligonucleotide	0	0	12	177	0		X	X
34157	NtMe polyamide in complex with 5'CGATGTACATCG3'- hairpin polyamides studies	107	0	22	353	0		X
34158	NtiPr polyamide in complex with 5'CGATGTACTACG3	105	0	22	304	0		X
34159	Im polyamide in complex with 5'CGATGTACATCG3'- hairpin polyamides studies	112	0	22	350	0		X
34328	Dodecamer DNA containing the synthetic base pair P-Z	72	0	11	98	0		X
34436	Guanine-rich oligonucleotide with 5'-GC end form G-quadruplex with A(GGGG)A hexad, GCGC- and G-quartets and two symmetric GG and AA base pairs	0	0	11	115	0		X
34438	Guanine-rich oligonucleotide with 5'- and 3'-GC ends form G-quadruplex with A(GGGG)A hexad, GCGC- and G-quartets and two symmetric GG and AA base pair	0	0	13	132	0		X
34580	Single modified phosphoryl guanidine DNA duplex, Sp diastereomer	11	0	16	258	0		X
34581	DNA duplex with phosphoryl guanidine moiety, Rp-diastereomer	6	0	17	212	0		X
34685	Solution structure of a lanthanide-binding DNA aptamer	0	0	79	779	0		X
36168	Solution structure of G-quadruplex formed in vegfr-2 proximal promoter sequence	11	0	24	236	0		X
50610	T9 DNA	0	0	88	84	0		X
50611	U9 DNA	0	0	88	164	0		X
50613	U8 DNA	0	0	88	160	0		X
50614	dhU3 DNA	0	0	77	164	0		X
50615	DDD DNA	0	0	77	164	0		X
50616	A3T3 DNA	0	0	77	78	0		X
50617	MeC9 DNA	0	0	77	78	0		X