4141 | vnd/NK-2 Homeodomain DNA Complex Protein 1H, 13C, and 15N Chemical Shifts and
HNHA Coupling Constant | 1NK2 | X | X | | |
4172 | Response Element of the Orphan Nuclear Receptor Rev-erb Beta | 1BN9 | | X | | |
4176 | NMR Solution Structure of a DNA Dodecamer Containing Single G:T Mismatches | 1BJD | | X | | |
4187 | Nuclear Magnetic Resonance Structure of d(GCATATGATAG).d(CTATCATATGC): A
Consensus Sequence for Promoters Recognized by Sigma-K RNA Polymerase | 1SKP | | X | | |
4235 | NMR Solution Structure of [d(GCGAATTCGC)2] | 1BWT | | X | | |
4243 | Intercalated d(TCCCGTTTCCA) dimer | 1C11 | | X | | |
4244 | NMR Solution Structure of [d(GCGAAT-3'-3'-alphaT-5'-5'-CGC)2] | 1BX5 | | X | | |
4248 | LEF1 HMG Domain (From Mouse), Complexed with DNA (15bp), NMR, 12 Structures | 2LEF | X | X | | |
4372 | Solution Structure of a Quadraplex Forming DNA and Its Intermediate | 1C32 1C34 | | X | | |
4392 | Binding of AR-1-144, a tri-imidazole DNA minor groove binder, to CCGG sequence
analyzed by NMR spectroscopy | 1B0S 1CYZ | | X | | |
4400 | Structure and Mechanism of Formation of the H-y5 ismomer of an Intramolecular
DNA Triple Helix. | 1B4Y | | X | | |
4409 | DNA DECAMER DUPLEX CONTAINING T-T DEWAR PHOTOPRODUCT | 1QKG | | X | | |
4412 | DNA DECAMER DUPLEX CONTAINING T5-T6 PHOTOADDUCT | 1QL5 | | X | | |
4415 | Solution-state structure of a DNA dodecamer duplex containing a cis-syn thymine cyclobutane dimer. | 1TTD | | X | | |
4416 | Solution-State Structure of a DNA Dodecamer Duplex Containing a Cis-Syn Thymine
Cyclobutane Dimer. | 1COC | | X | | |
4488 | DNA decamer duplex containing T-T (6-4) photoadduct | 1CFL | | X | | |
4536 | Structural basis for uracil DNA glycosylase interaction with uracil: NMR study | 1DGO | | X | | |
4542 | Solution structure of a uracil containing hairpin DNA | 1QE7 | | X | | |
4547 | Solution structure of a DNA.RNA hybrid containing an alpha-anomeric thymidine
and polarity reversals: d(ATGG-3'-3'-(alpha-T)-5'-5'-GCTC).r(gagcaccau) | 1C2Q | | X | X | |
4550 | NMR structure of the palindromic DNA decamer d(GCGTTAACGC)2 | 1CQO | | X | | |
4609 | NMR observation of T-tetrads in a parallel stranded DNA quadruplex formed by
Saccharomyces cerevisiae telomere sequence | 1EMQ | | X | | |
4610 | NMR Observation of A-tetrad in a DNA Quadruplex | 1EVM | | X | | |
4612 | NMR observation of a novel C-tetrad in a DNA quadruplex | 1EVO | | X | | |
4618 | The Solution Structure of [d(CGC)r(aaa)d(TTTGCG)]2: Hybrid Junctions Flanked by
DNA Duplexes | 1DXN | | X | | |
4646 | Structural NMR characterization of an 11-mer DNA Duplex Containing a
2'-deoxyaristeromycin 8-oxo-Guanine pair, nonhydrolyzable substrate analog for
the DNA repair enzyme MutY | 1FYI | | X | | |
4647 | HPRT Gene Mutation Hotspot with a BPDE2(10R) Adduct | 1FYY | | X | | |
4692 | SOLUTION STRUCTURE OF A HUMAN TELOMERE FRAGMENT | 1EL2 | | X | | |
5134 | Solution Structure of dAAUAA DNA Bulge | 1JS7 1JS5 | | X | | |
5135 | Solution Structure of dAATAA DNA Bulge | 1JRW 1JRV | | X | | |
5164 | NMR Structure of a Parallel Stranded DNA Duplex at Atomic Resolution | 1JUU | | X | | |
5167 | NMR Structure of an AT-Rich DNA with the GAA-Hairpin Loop | 1JVE | | X | | |
5232 | 1H, 13C, and 15N resonance assignments of the DNA-binding domain of the
essential protein Cdc13 complexed with single-stranded telomeric DNA | 1KXL | X | X | | |
5243 | Solution Structure of the 17mer TF1 Binding Site | 1IR5 | | X | | |
5245 | Heteroduplex of chirally pure R-methylphosphonate/DNA duplex | 1K1R | | X | | |
5252 | Structural Differences in the NOE-derived Structure of G-T Mismatched DNA
relative to Normal DNA are Correlated with Differences in (13)C Relaxation-based
Internal Dynamics | 1KKV | | X | | |
5253 | Structural Differences in the NOE-derived Structure of G-T Mismatched DNA
relative to Normal DNA are Correlated with Differences in (13)C Relaxation-based
Internal Dynamics | 1KKW | | X | | |
5282 | Refinement of d(GCGAAGC) Hairpin Structure Using One- and Two-Bonds Residual
Dipolar Couplings | 1KR8 1PQT | | X | | |
5339 | NMR minimized average structure of d(CGTACG)2 | 1K2K | | X | | |
5345 | Assignment of lac repressor headpiece complexed of its natural operator | 1L1M | X | X | | |
5349 | PBX Homeodomain-DNA complex | 1LFU | X | X | | |
5361 | Solution Structure of the DNA Complex of Human TRF1 | 1IV6 | X | X | | |
5363 | 1H, 13C, and 15N Chemical shifts for hERR2 Protein, 1H chemical shifts for DNA | 1LO1 | X | X | | |
5370 | Structure of a Beta-Alanine-Linked Polyamide Bound to a Full Helical Turn of
Purine Tract DNA in the 1:1 Motif | 1LEJ | | X | | |
5385 | Chemical shift assignments for the 8OG:G mismatched duplex | 1N2W | | X | | |
5517 | NMR studies of the DNA-binding domain of B-Myb | 1A5J | X | X | | |
5562 | NMR conformational study of proposed quadruplex hexanucleotide d(CCGCGG)2 in
solution | 1N1K | | X | | |
5671 | Overall structure and sugar dynamics of a DNA dodecamer from homo and
heteronuclear dipolar couplings and 31P chemical shift anisotropy | 1NAJ | | X | | |
5681 | DIMERIC SOLUTION STRUCTURE OF THE CYCLIC OCTAMER CD(CGCTCATT) | 1N96 | | X | | |
5714 | 1H Chemical shift assignments of the major conformation of a 11-mer DNA duplex
containing an AG Mismatch | 1ONM | | X | | |
5716 | CHEMICAL SHIFTS OF THE CK14 DNA DUPLEX: A PORTION OF THE KNOWN NF-kB SEQUENCE CK1 | 1K8J 1K8N 1K8L | | X | | |
5717 | NMR STRUCTURE OF THE CK14 DNA DUPLEX: A PORTION OF THE KNOWN NF-kB SEQUENCE CK1 | 1K8J 1K8N 1K8L | | X | | |
5718 | Chemical Shifts for the XBY2 DNA Duplex | 1K8J 1K8N 1K8L | | X | | |
5730 | 1H Chemical Shift Assignments for a DNA Duplex with N6-Deoxyadenosine Adduct of
(9S,10R)-9,10-Epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene | 1N8C | | X | | |
5737 | Structure of the parallel-stranded DNA quadruplex d(TTAGGGA)4 containing the
human telomeric repeat: evidence for A-tetrad formation from NMR and molecular
dynamics simulation. | 1NP9 | | X | | |
5739 | Mispairing of the Deoxycytosine with Deoxyadenosine 5' to the 8,
9-Dihydro-8-(N7-guanyl)-9-Hydroxy-Aflatoxin B1 Adduct : Structural study based
on NMR | 1N1N | | X | | |
5775 | 5'(dCCUCCUU)3':3'(rAGGAGGAAA)5' | 1NTQ | | X | X | |
5776 | sPrODN1:RNA [5'-R(AAAGGAGGA)-3'/5'-D(CXXXXXX)-3'] | 1NTS | | X | X | |
5777 | PODN:RNA [5'-R(AAAGGAGGA)-3'/5'-D(XXXXXXX)-3'] | 1NTT | | X | X | |
5781 | The Solution Structure of a DNA.RNA Duplex Containing 5-Propynyl U and C
Comparison with 5-Me Modifications | 1OO7 | | X | X | |
5791 | Solution structure of a dimeric lactose DNA-binding domain complexed to a
nonspecific DNA sequence | 1OSL | X | X | | |
5927 | NMR Structure of a Cyclic Polyamide-DNA Complex | 1PQQ | | X | | |
5979 | A parallel stranded DNA duplex with an A-G mismatch base-pair | 1R2L | | X | | |
6009 | NMR structure of the thrombin-binding DNA aptamer stabilized by Sr2+ | 1RDE | | X | | |
6186 | Structure of DNA sequence d-TGATCA by two-dimensional nuclear magnetic resonance spec and restrained molecular dynamics | 1SY8 | | X | | |
6307 | The Solution Structure of d(G3T4G4)2 | 1U64 | | X | | |
6975 | 1H chemical shift assignments for Bcl2MidG4 | 2F8U | | X | | |
7097 | DNA recognition by the Brinker nuclear repressor - an extreme case of the
coupling between binding and folding | 2GLO | X | X | | |
7354 | NMR STRUCTURE OF A PROTEIN-DNA COMPLEX OF AN ALTERED SPECIFICITY MUTANT OF THE LAC REPRESSOR THAT MIMICS THE GAL REPRESSOR | 2BJC | X | X | | |
11045 | Mhr1p-bound ssDNA | 2RPD | X | X | | |
11046 | hsRad51-bound ssDNA | 2RPE | X | X | | |
11048 | RecT-bound ssDNA | 2RPH | X | X | | |
11437 | DNA oligmer containing propylene cross-linked cyclic 2' -deoxyuridylate dimer | 2RRQ | | X | | |
11438 | DNA oligomer containing ethylene cross-linked cyclic 2'-deoxyuridylate dimer | 2RRR | | X | | |
11528 | STRUCTURE OF METALLO-DNA IN SOLUTION | 2RT8 | | X | | |
11608 | SOLUTION STRUCTURE OF DNA CONTAINING METALLO-BASE-PAIR | 2RVP | | X | | |
15083 | NMR Structure of the Sigma-54 RpoN Domain Bound to the-24 Promoter Element | 2O8K 2O9L | X | X | | |
15533 | Structure of the Wilms' Tumor Suppressor Protein Zinc Finger Domain Bound to DNA | 2JPA | X | X | | |
15613 | SOLUTION STRUCTURE OF THE BIS-C2-2-NAPHTHYLPYRROLO[2,1-c][1,4]BENZODIAZEPINE (DA046) DNA ADDUCT: THE MOLECULAR BASIS FOR DNA HELIX STABILIZATION. | 2K4L | | X | | |
15860 | NMR solution structure of modified DNA containing imidazole nucleosides at acidic, neutral and basic pH | 2K67 2K68 2K69 | | X | | |
16054 | Dimeric solution structure of the DNA loop d(TGCTTCGT) | 2K90 | | X | | |
16055 | Dimeric solution structure of the cyclic octamer d(pCGCTCCGT) | 2K97 | | X | | |
16138 | NMR solution structure of metal-modified DNA | 2M54 | | X | | |
16212 | Dimeric solution structure of the DNA loop d(TCGTTGCT) | 2K8Z | | X | | |
16222 | NMR Structure of Aflatoxin Formamidopyrimidine alpha-anomer in duplex DNA | 2KH3 | | X | | |
16223 | Aflatoxin Formamidopyrimidine alpha anomer in single strand DNA | 2KH4 | | X | | |
16225 | Solution Structure of cis-5R,6S-thymine glycol opposite complementary adenine in duplex DNA | 2KH6 | | X | | |
16226 | Solution Structure of cis-5R,6S-thymine glycol opposite complementary guanine in duplex DNA | 2KH7 2KH8 | | X | | |
16356 | Structure of a two-G-tetrad intramolecular G-quadruplex formed by a variant human telomeric sequence in K+ solution | 2KKA | | X | | |
16449 | Structure of the XPF-single strand DNA complex | 2KN7 | X | X | | |
16485 | Solution structure of the THAP zinc finger of THAP1 in complex with its DNA target | 2KO0 | X | X | | |
16577 | Backbone Chemical Shift Assignments of Mouse HOXA13 DNA Binding Domain in Complex with DNA Duplex | 2LD5 | X | X | | |
16812 | data-driven model of MED1:DNA complex | 2KAE | X | X | | |
16834 | NMR structure of fully methylated GATC site | 2KAL | | X | | |
16936 | Solution structure and dynamic analysis of chicken MBD2 methyl binding domain bound to a target methylated DNA sequence | 2KY8 | X | X | | |
17229 | C-terminal zinc knuckle of the HIVNCp7 with DNA | 2L45 | X | X | | |
17379 | QUI/G-quadruplex complex | 2L7V | | X | | |
17397 | Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence | 2L88 | | X | | |
17409 | A biocompatible backbone modification? - Structure and dynamics of a triazole-linked DNA duplex | 2L8I | | X | | |
17422 | Solution Structure of a DNA Duplex Containing the Potent
Anti-Poxvirus Agent Cidofovir | 2L8P | | X | | |
17423 | Solution Structure of a DNA Duplex Containing the Potent Anti-Poxvirus Agent Cidofovir | 2L8Q | | X | | |
17535 | DNA / RNA Hybrid containing a central stereo specific Rp borano phosphate linkage | 2LAR | | X | X | |
17562 | N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenal | 2LBI | | X | | |
17580 | Myc G-quadruplex formed at the 5'-end of NHEIII element | 2LBY | | X | | |
17655 | Structure of Human Telomeric DNA in Crowded Solution | 2LD8 | | X | | |
17697 | Structure of a dimeric all-parallel-stranded G-quadruplex stacked via the 5'-to-5' interface | 2LE6 | | X | | |
17708 | Solution-state structures of monomeric and dimeric G-quadruplexes adopted by a sequence from N-myc | 2LED | | X | | |
17709 | Solution-state structures of monomeric and dimeric G-quadruplexes formed by a sequence from N-myc | 2LEE | | X | | |
17729 | Structure of the DNA complex of the C-Terminal domain of Ler | 2LEV | X | X | | |
17732 | Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA | 2LEX | X | X | | |
17746 | Oligonucleotide duplex contaning (5'S)-8,5'-cyclo-2'-deoxyguansine | 2LFA | | X | | |
17786 | Structure of the duplex when (5'S)-8,5'-cyclo-2'-deoxyguanosine is placed opposite dT | 2LFX | | X | | |
17787 | Structure of the duplex when (5'S)-8,5'-cyclo-2'-deoxyguanosine is placed opposite dA | 2LFY | | X | | |
17789 | structure of the duplex containing (5'S)-8,5'-cyclo-2'-deoxyadenosine | 2LG0 | | X | | |
17790 | Structure of the duplex containing HNE derived (6S,8R,11S) N2-dG cyclic hemiacetal when placed opposite dT | 2LG2 | | X | | |
17791 | Structure of the duplex containing HNE derived (6S,8R,11S) gamma-HO-PdG when placed opposite dT | 2LG3 | | X | | |
17814 | Structure of DNA Containing an Aristolactam II-dA Lesion. | 2LGM | | X | | |
17859 | Solution Structure of a DNA duplex Containing an Unnatural, Hydrophobic Base Pair | 2LHO | | X | | |
17885 | Solution NMR structure of a DNA dodecamer containing the 7-aminomethyl-7-deaza-2'-deoxyguanosine adduct | 2LIA | | X | | |
17887 | DNA sequence context conceals alpha anomeric lesion | 2LIB | | X | | |
17980 | Monomer-dimer equilibrium for 5 -5 stacking of propeller-type parallel-stranded G-quadruplexes: NMR structural study | 2LK7 | | X | | |
18015 | Chemical shift assignments for the homeodomain of Pitx2 in complex with a TAATCC DNA binding site | 2LKX | X | X | | |
18040 | DNA TT mismatch and 2,7-BisNP | 2LL9 | | X | | |
18050 | Structure of a bis-naphthalene bound to a thymine-thymine DNA mismatch | 2LLJ | | X | | |
18199 | Structural Basis for Bifunctional Zn(II) Macrocyclic Complex Recognition of Thymine Bulges in DNA. Structure of a Thymine bulge. | 2LO5 2LO8 2LOA | | X | | |
18209 | Solution-state structure of an intramolecular G-quadruplex w th propeller, diagonal and edgewise loops | 2LOD | | X | | |
18279 | human CEB25 minisatellite G-quadruplex | 2LPW | | X | | |
18427 | Solution structure of 2'F-ANA and ANA self-complementary duplex | 2LSC | | X | | |
18430 | Structure and Stability of Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine: An Oxidative Lesion Repair by NER. | 2LSF | | X | | |
18452 | Solution structure of a mini i-motif | 2LSX | X | X | | |
18453 | NMR structure of duplex DNA containing the -OH-PdG dA base pair: A mutagenic intermediate of acrolein | 2LSZ | | X | | |
18454 | NMR structure of duplex DNA containing the -OH-PdG dA base pair: A mutagenic intermediate of acrolein | 2LT0 | | X | | |
18462 | Solution NMR structure of Kaiso zinc finger DNA binding domain in complex with Kaiso binding site DNA | 2LT7 | X | X | | |
18496 | Solution NMR Structure of YdbC:dT19G1 complex. Northeast Structural Genomics Consortium (NESG) Target KR150 | 2LTT | X | X | | |
18524 | Solution structure of a parallel-stranded oligoisoguanine DNA pentaplex formed by d(T(iG)4T) in the presence of Cs ions | 2LUJ | | X | | |
18625 | NMR Structure of the Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'. | 2LWG | | X | | |
18626 | NMR Structure of the Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin | 2LWH | | X | | |
18638 | Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion | 2LWM | | X | | |
18639 | Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion | 2LWN | | X | | |
18640 | Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion | 2LWO | | X | | |
18690 | MOMERIC PIL-E G-QUADRUPLEX DNA FROM NEISSERIA GONORRHOEAE | 2LXQ | | X | | |
18699 | DIMERIC PIL-E G-QUADRUPLEX DNA FROM NEISSERIA GONORRHOEAE, N STRUCTURES | 2LXV | | X | | |
18724 | FUC_TBA | 2LYG | | X | | |
18762 | NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing | 2LZK | | X | | |
18780 | DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link | 2LZV | | X | | |
18781 | DNA duplex containing mispair-aligned O6G-heptylene-O6G interstrand cross-link | 2LZW | | X | | |
18835 | Structure of perimidinone-derived synthetic nucleoside paired with guanine in DNA duplex | 2M11 | | X | | |
18862 | Parallel human telomeric quadruplex containing 2'F-ANA substitutions | 2M1G | | X | | |
18881 | NMR solution structure of the d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid | 2M1V | | X | X | |
18902 | Solution structure of the major G-quadruplex formed in the human VEGF promoter: Insights into loop interactions of the parallel G-quadruplexes | 2M27 | | X | | |
18907 | Solution structure of Duplex DNA | 2M2C | | X | | |
18935 | African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNA | 2M2V 2M2W | X | X | | |
18973 | DNA containing a cluster of 8-oxo-guanine and abasic site lesion : alpha anomer | 2M3P | | X | | |
18979 | DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer | 2M3Y | | X | | |
18981 | DNA containing a cluster of 8-oxo-guanine and THF lesion | 2M40 | | X | | |
18984 | DNA containing a cluster of 8-oxo-guanine and abasic site lesion : alpha anomer (AP6, 8OG 14) | 2M43 | | X | | |
18985 | DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer (6AP, 8OG14) | 2M44 | | X | | |
19017 | Solution structure of an intramolecular propeller-type G-quadruplex containing a single bulge | 2M4P | | X | | |
19035 | G-rich VEGF aptamer with LNA modifications | 2M53 | | X | | |
19158 | Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions | 2M6V | | X | | |
19159 | Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions | 2M6W | | X | | |
19276 | Structure of d[CGCGAAGCATTCGCG] hairpin | 2M8Y | | X | | |
19277 | Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid | 2M8Z | | X | | |
19278 | Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid | 2M90 | | X | | |
19279 | Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid | 2M91 | | X | | |
19280 | Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid | 2M92 | | X | | |
19281 | Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid | 2M93 | | X | | |
19367 | Solution structure of the complex formed by the region 2 of E. coli sigmaE and its cognate -10 non template element TGTCAAA | 2MAP | X | X | | |
19375 | NMR Structure of N2-IQ-dG at the G3 position in the NarI recognition sequence | 2MAV | | X | | |
19381 | Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes | 2MAY | | X | | |
19386 | parallel-stranded G-quadruplex in DNA poly-G stretches | 2MB2 | | X | | |
19387 | Solution structure of an intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative | 2MB3 | | X | | |
19389 | Solution structure of a stacked dimeric G-quadruplex formed by a segment of the human CEB1 minisatellite | 2MB4 | | X | | |
19391 | Solution structure of MBD3 methylcytosine binding domain while bound to hydroxymethylated DNA | 2MB7 | X | X | | |
19402 | Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution) | 2MBJ | | X | | |
19435 | Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence | 2MCC | | X | | |
19440 | NMR structure of DNA duplex | 2MCI | | X | | |
19441 | NMR structure of spermine modified DNA duplex | 2MCJ | | X | | |
19448 | Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence | 2MCO | | X | | |
19511 | NMR Structure of the homeodomain transcription factor Gbx1 from Homo sapiens solved in the presence of the DNA sequence CGACTAATTAGTCG | 2ME0 | X | X | | |
19540 | haddock model of MyT1 F4F5 - DNA complex | 2MF8 | X | X | | |
19571 | Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions. | 2MFT | | X | | |
19572 | Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions. | 2MFU | | X | | |
19592 | Molecular Binding of TFF1 Estrogen Response Element by a DNA Bis-intercalating Anticancer Drug XR5944 | 2MG8 | | X | | |
19594 | Solution structure of a G-quadruplex bound to the bisquinolinium compound Phen-DC3 | 2MGN | | X | | |
19620 | Solution structure of DNA duplex containing N3T-ethylene-N1I interstrand cross-link | 2MH6 | | X | | |
19653 | RRM domain from C. elegans SUP-12 | 4CH1 | X | X | | |
19659 | Structure of Exocyclic R,R N6,N6-(2,3-Dihydroxy-1,4-butadiyl)-2'-Deoxyadenosine Adduct Induced by 1,2,3,4-Diepoxybutane in DNA | 2MHX | | X | | |
19661 | Structure of Exocyclic S,S N6,N6-(2,3-Dihydroxy-1,4-butadiyl)-2'-Deoxyadenosine Adduct Induced by 1,2,3,4-Diepoxybutane in DNA | 2MHZ | | X | | |
19695 | NMR studies of N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA: Impact of adduct stereochemistry, size, and local DNA structure on solution conformations | 2MIV | | X | | |
19696 | Nuclear magnetic resonance studies of N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA: Impact of adduct stereochemistry, size, and local DNA structure on solution conformations | 2MIW | | X | | |
19728 | A tetrahelical DNA fold adopted by alternating GGG and GCG tracts | 2MJJ | | X | | |
19745 | Solution NMR structure of a mismatch DNA | 2MJX | | X | | |
19747 | 13C and 15N Chemical Shift Assignments for the M13 Bacteriophage | 2MJZ | X | X | | |
19784 | Solution structure of the G-triplex truncated-TBA | 2MKM | | X | | |
19853 | AFB1 FAPY modified AGA duplex | 2MMF | | X | | |
19861 | AFB1 FAPY modified AGT duplex | 2MMQ | | X | | |
19862 | E isomer of AFB1 FAPY modified AGC duplex | 2MMR | | X | | |
19863 | AFB1 FAPY modified AG(7-deaza)G duplex | 2MMS | | X | | |
19886 | MINOR GROOVE RECOGNITION OF DNA BY THIAZOTROPSIN ANALOGUES | 2MNB | | X | | |
19888 | MINOR GROOVE RECOGNITION OF DNA BY THIAZOTROPSIN ANALOGUES | 2MND | | X | | |
19889 | MINOR GROOVE RECOGNITION OF DNA BY THIAZOTROPSIN ANALOGUES | 2MNE | | X | | |
19890 | MINOR GROOVE RECOGNITION OF DNA BY THIAZOTROPSIN ANALOGUES | 2MNF | | X | | |
19912 | MAJOR GROOVE ORIENTATION OF THE (2S)-N6-(2-HYDROXY-3-BUTEN-1-YL)-2'-DEOXYADENOSINE DNA ADDUCT INDUCED BY 1,2-EPOXY-3-BUTENE | 2MNX | | X | | |
19917 | Solution NMR structure of DNA dodecamer containing the 5-hydroxycytosine | 2MO2 | | X | | |
19925 | Solution NMR structure of DNA dodecamer with A:C mismatch | 2MO7 | | X | | |
19939 | Solution structure of MBD4 methyl-cytosine binding domain bound to methylated DNA | 2MOE | X | X | | |
19957 | Assignment of DNA-MC1 protein complex | 2NBJ | X | X | | |
25092 | truncated EcMazE-DNA complex | 2MRU | X | X | | |
25099 | Dimeric structure of the Human A-box | 2MRZ | | X | | |
25107 | Human Telomeric G-quadruplex DNA sequence (TTAGGGT)4 complexed with Flavonoid Quercetin | 2MS6 | | X | | |
25110 | Solution structure of a left-handed G-quadruplex | 2MS9 | | X | | |
25378 | A structure of G-quadruplex | 2MWZ | | X | | |
25407 | Structure of the DNA complex of the C-Terminal domain of MvaT | 2MXF | X | X | | |
25528 | Solution Structure of DNA Dodecamer with 8-oxoguanine at 4th Position | 5IV1 | | X | | |
25531 | N2-dG-IQ modified DNA at the G1 position of the NarI recognition sequence | 2N0Q | | X | | |
25582 | structure of a protein | 2N21 | X | X | | |
25596 | Structure of DNA G-quadruplex adopted by ALS and FTD related GGGGCC repeat with G21 to Br-G21 substitution | 2N2D | | X | | |
25651 | Isolation and structural characterization of an active G-quadruplex motif from AGRO100 | 2N3M | | X | | |
25672 | Base-displaced intercalated structure of the N-(2'deoxyguanosin-8-yl)-3-aminobenzanthrone DNA adduct | 2N4M | | X | | |
25686 | Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome | 2N4Y | | X | | |
25723 | Universal Base oligonucleotide structure | 2N5O | | X | | |
25724 | Universal base control oligonucleotide structure | 2N5P | | X | | |
25746 | G-quadruplex structure | 2N60 | | X | | |
25759 | Solution structure for quercetin complexed with c-myc G-quadruplex DNA | 2N6C | | X | | |
25840 | Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC at acidic pH | 2N89 | | X | | |
25882 | Structural basis for DNA cleavage by the potent antiproliferative agent (-)-lomaiviticin A | 2N96 | | X | | |
25888 | 1H, 13C and 15N chemical shift assignments and solution structure for PARP-1 F1F2 domains in complex with a DNA single-strand break | 2N8A | X | X | | |
25903 | Glucose as non natural nucleobase | 2N9F | | X | | |
25906 | Glucose as a nuclease mimic in DNA | 2N9H | | X | | |
25915 | Photoswitchable G-quadruplex | 2N9Q | | X | | |
27144 | DNA with compounds | 5W77 | | X | | |
27173 | 1H, 13C, and 15N resonance assignments of a 22mer G-quadruplex forming within KRAS oncogene promoter region at physiological temperature | 6T51 | | X | | |
27652 | NZ118 | 6IMS | | X | | |
30012 | NMR structure of a new G-quadruplex forming sequence within the KRAS proto-oncogene promoter region | 5I2V | | X | | |
30015 | DNA duplex containing a ribonolactone lesion | 5HQF | | X | | |
30016 | DNA duplex containing a ribonolactone lesion | 5HQQ | | X | | |
30038 | Solution Structure of DNA Dodecamer with 8-oxoguanine at 4th Position | 5IV1 | | X | | |
30044 | Solution Structure of DNA Dodecamer with 8-oxoguanine at 10th Position | 5IZP | | X | | |
30045 | DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium | 5J05 | | X | | |
30052 | NMR solution structure of [Rp, Rp]-PT dsDNA | 5J3F | | X | | |
30053 | Solution NMR structure of PT-free dsDNA from Streptomyces lividans | 5J3G | | X | | |
30054 | NMR solution structure of [Sp, Sp]-PT dsDNA | 5J3I | | X | | |
30055 | DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTTGG) in sodium | 5J4P | | X | | |
30056 | DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTGG) in sodium | 5J4W | | X | | |
30058 | DIY G-Quadruplexes: Solution Structure of
d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium | 5J6U | | X | | |
30105 | Structural impact of single ribonucleotides in DNA | 5KGV | | X | | X |
30111 | Structural impact of single ribonucleotides in DNA | 5KI4 | | X | | |
30112 | Structural impact of single ribonucleotides in DNA | 5KI5 | | X | | |
30113 | Structural impact of single ribonucleotides in DNA | 5KI7 | | X | | X |
30114 | Structural impact of single ribonucleotides in DNA | 5KIB | | X | | X |
30115 | Structural impact of single ribonucleotides in DNA | 5KIE | | X | | X |
30116 | Structural impact of single ribonucleotides in DNA | 5KIF | | X | | X |
30117 | Structural impact of single ribonucleotides in DNA | 5KIH | | X | | X |
30148 | Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd Position | 5L06 | | X | | |
30151 | Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 9th Position | 5L2G | | X | | |
30191 | Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd Position and 9th position | 6ALT | | X | | |
30198 | Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd Position and 9th position | 5TRN | | X | | |
30250 | Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd position and 8-oxoguanine at the 10th position | 5UZ1 | | X | | |
30251 | Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd and 9th position and 8-oxoguanine at the 10th position | 5UZ2 | | X | | |
30252 | Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 9th position and 8-oxoguanine at the 10th position | 5UZ3 | | X | | |
30253 | Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A2-DNA structure | 5UZD | | X | | |
30254 | Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A6-DNA structure | 5UZF | | X | | |
30255 | Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A6-DNAm1A16 structure | 5UZI | | X | | |
30328 | Solution structure of a DNA dodecamer with 5-methylcytosine at the 3rd and 9th position and 8-oxoguanine at the 4th position | 6ALS | | X | | |
30329 | Solution structure of a DNA dodecamer with 5-methylcytosine at the 3rd and 8-oxoguanine at the 4th position | 6ALU | | X | | |
30335 | NMR and Restrained Molecular Dynamics Determination of the Structure of an Aza-Benzimidazole Derivative Complex with the DNA Minor Groove of an -AAGATA- Sequence | 6ASF | | X | | |
30336 | NMR and Restrained Molecular Dynamics Determination of the Structure of an Aza-Benzimidazole Derivative Complex with the DNA Minor Groove of an -AAGATA Sequence | 6AST | | X | | |
30402 | Hybrid-2 form Human Telomeric G Quadruplex in Complex with Epiberberine | 6CCW | | X | | |
30473 | NMR structure for Sp1 transcription factor duplex 5'-d(GGGGCGGGG) | 6DM7 | | X | | |
30484 | NMR structure for Sp1 transcription factor duplex 5'-d(GGGGCGGGA) | 6DVT | | X | | |
30485 | NMR structure for Sp1 transcription factor duplex 5'-d(TGGGCGGGG) | 6DXM | | X | | |
30506 | NMR structure for Sp1 transcription factor duplex 5'-d(TGGGCGGGA) | 6ED9 | | X | | |
30552 | MYC Promoter G-Quadruplex with 1:6:1 loop length | 6NEB | | X | | |
30577 | NMR structure of the 2:1 complex of a carbazole derivative BMVC bound to c-MYC G-quadruplex | 6O2L | | X | | |
30688 | Molecular Recognition of Guanine Metabolites and Drugs by Vacancy-Bearing G-Quadruplex in the PDGFR-b Promoter | 6V0L | | X | | |
30759 | Structure of a Stable Interstrand DNA Crosslink Involving an dA Amino Group and an Abasic Site | 6XAH | | X | | |
30803 | Solution structure of the major MYC promoter G-quadruplex with a wild-type flanking sequence | 7KBV | | X | | |
30804 | Solution structure of the major MYC promoter G-quadruplex with a wild-type flanking in complex with NSC85697, a quinoline derivative | 7KBW | | X | | |
30805 | Solution structure of the major MYC promoter G-quadruplex in complex with NSC85697, a quinoline derivative | 7KBX | | X | | |
30822 | Deoxyuridine in DNA Structure: Solution Structure of [d(CGUGAATTCGCG)]2 | 7KWL | | X | | |
30823 | 1,N6-ethenoadnine (E) in dsDNA sequence (5'-CGCGEATTCGCG-3') | 7KWR | | X | | |
30907 | Solution Structure of Berberine Bound to a dGMP Fill-in G-Quadruplex in the PDGFR-b Promoter | 7MSV | | X | | |
30923 | Solution structure of the MYC promoter G-quadruplex in complex with berberine: conformer A | 7N7D | | X | | |
30924 | Solution structure of the MYC promoter G-quadruplex in complex with berberine: conformer B | 7N7E | | X | | |
30940 | Hairpin near 3'-Splice Site of Influenza A Segment 7 Bound to 5-nt Oligonucleotide | 7RQ5 | | X | X | |
34025 | G-Quadruplex formed at the 5'-end of NHEIII_1 Element in human c-MYC promoter bound to triangulenium based fluorescence probe DAOTA-M2 | 5LIG | | X | | |
34034 | A two-quartet G-quadruplex formed by human telomere in KCl solution at neutral pH | 5LQG | | X | | |
34035 | A two-quartet G-quadruplex formed by human telomere in KCl solution at pH 5.0 | 5LQH | | X | | |
34051 | Structure of DNA AGCGA-quadruplex adopted by 15-mer d(GCGAGGGAGCGAGGG), VK34, oligonucleotide found in regulatory region of the PLEKHG3 human gene | 5M1L | | X | | |
34053 | Structure of a stable G-hairpin | 5M1W | | X | | |
34054 | Structure of DNA tetrameric AGCGA-quadruplex adopted by 15-mer d(GCGAGGGAGCGAGGG), VK34, oligonucleotide found in regulatory region of the PLEKHG3 human gene | 5M2L | | X | | |
34056 | Structure of DNA AGCGA-quadruplex adopted by 15-mer oligonucleotide found in regulatory region of the PLEKHG3 human gene with G11 to I11 mutation, d(GCGAGGGAGCIAGGG),VK34_I11 | 5M4W | | X | | |
34062 | Quadruplex with flipped tetrad formed by a human telomeric sequence | 5MBR | | X | | |
34063 | Quadruplex with flipped tetrad formed by an artificial sequence | 5MCR | | X | | |
34071 | 2'F-ANA/DNA Chimeric TBA Quadruplex structure | 5MJX | | X | | |
34083 | G-quadruplex formed within promoters of Plasmodium falciparum B var genes | 5MTA | | X | | |
34084 | G-quadruplex formed within promoters of Plasmodium falciparum B var genes - form I | 5MTG | | X | | |
34086 | Solution structure of a human G-Quadruplex hybrid-2 form in complex with a Gold-ligand | 5MVB | | X | | |
34118 | An i-motif containing the neutral cytidine protonated analogue pseudoisocytidine | 5NIP | | X | | |
34135 | M2 G-quadruplex dilute solution | 5NYS | | X | | |
34136 | M2 G-quadruplex 20 wt% ethylene glycol | 5NYT | | X | | |
34137 | M2 G-quadruplex 10 wt% PEG8000 | 5NYU | | X | | |
34145 | G-quadruplex of Human papillomavirus type 52 | 5O4D | | X | | |
34157 | NtMe polyamide in complex with 5'CGATGTACATCG3'- hairpin polyamides studies | 5ODF | | X | | |
34158 | NtiPr polyamide in complex with 5'CGATGTACTACG3 | 5ODM | | X | | |
34159 | Im polyamide in complex with 5'CGATGTACATCG3'- hairpin polyamides studies | 5OE1 | | X | | |
34162 | Structure of minimal i-motif domain | 5OGA | | X | | |
34168 | G-quadruplex structure of DNA oligonucleotide containing GGGGCC repeats linked to ALS and FTD | 5OPH | | X | | |
34172 | NMR structure of the complex formed by an engineered region 2 of sigmaE in complex with GTAAAA | 5OR5 | X | X | | |
34174 | 2'F-ANA-G modified quadruplex with a flipped tetrad | 5OV2 | | X | | |
34186 | Quadruplex with flipped tetrad formed by the c-myc promoter sequence | 6ERL | | X | | |
34210 | 2'F-araG modified quadruplex with flipped G-tract and central tetrad | 6F4Z | | X | | |
34221 | The 1,8-bis(aminomethyl)anthracene and Quadruplex-duplex junction complex | 6FC9 | | X | | |
34244 | Concerted dynamics of metallo-base pairs in an A/B-form helical transition (major species) | 6FY6 | | X | | |
34245 | Concerted dynamics of metallo-base pairs in an A/B-form helical transition (minor species) | 6FY7 | | X | | |
34269 | Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure | 6GH0 | | X | | |
34276 | Tc-DNA/RNA duplex | 6GMY | | X | X | |
34277 | tc-DNA/tc-DNA duplex | 6GN4 | | X | | |
34280 | Tc-DNA/DNA duplex | 6GPI | | X | | |
34290 | Hybrid structure of the pRN1 helix bundle domain in complex with DNA and 2 ATP molecules | 6GVT 6GVQ | X | X | | |
34291 | NMR structure of the DNA-bound helix bundle domain from the functional pRN1 primase | 6GVU | X | X | | |
34296 | Polyamide - DNA complex NMR structure | 6GZ7 | | X | | |
34297 | Adenine-driven structural switch from two- to three-quartet DNA G-quadruplex | 6GZN | | X | | |
34302 | The major G-quadruplex form of HIV-1 LTR | 6H1K | | X | | |
34328 | Dodecamer DNA containing the synthetic base pair P-Z | 6I4O | | X | | |
34331 | Human telomeric G-quadruplex with 8-oxo-G substitution in the central G-quartet | 6IA0 | | X | | |
34332 | Human telomeric G-quadruplex with 8-oxo-G substitution in the outer G-quartet | 6IA4 | | X | | |
34353 | TINA-conjugated antiparallel DNA triplex | 6QHI | | X | | |
34378 | Structure of kiteplatinated dsDNA | 6R14 | | X | | |
34386 | SC14 G-hairpin | 6R8E | | X | | |
34389 | A quadruplex hybrid structure with lpp loop orientation and 3 syn residues | 6R9K | | X | | |
34390 | A quadruplex hybrid structure with lpp loop orientation and 5 syn residues | 6R9L | | X | | |
34397 | Imidazole Polyamide-DNA complex NMR structure (5'-CGATGTACATCG-3') | 6RIO | | X | | |
34398 | Concerted dynamics of metallo-base pairs in an A/B-form helical transition (apo species) | 6RLS | | X | | |
34403 | 2'-F-riboguanosine modified G-quadruplex with V-loop | 6RS3 | | X | | |
34431 | NMR structure of KRAS32R G9T conformer G-quadruplex within KRAS promoter region | 6SUU | | X | | |
34435 | Intercalation of heterocyclic ligand between quartets in G-rich tetrahelical structure | 6SX3 | | X | | |
34436 | Guanine-rich oligonucleotide with 5'-GC end form G-quadruplex with A(GGGG)A hexad, GCGC- and G-quartets and two symmetric GG and AA base pairs | 6SX6 | | X | | |
34438 | Guanine-rich oligonucleotide with 5'- and 3'-GC ends form G-quadruplex with A(GGGG)A hexad, GCGC- and G-quartets and two symmetric GG and AA base pair | 6SYK | | X | | |
34441 | NMR structure of KRAS32R G25T conformer G-quadruplex within KRAS promoter region | 6T2G | | X | | |
34444 | 2'-F-arabinoguanosine and 2'-F-riboguanosine modified hybrid type G-quadruplex with V-loop | 6TC8 | | X | | |
34445 | 2'-F-riboguanosine and 2'-F-arabinoguanosine modified G-quadruplex with V-loop and all-syn G-tract | 6TCG | | X | | |
34467 | Pre-folded structures govern folding pathways of human telomeric G-quadruplexes | 6TR2 | | X | | |
34499 | 2'-F-riboguanosine and LNA modified hybrid type G-quadruplex with V-loop | 6YCV | | X | | |
34502 | LNA modified G-quadruplex with flipped G-tract and central tetrad | 6YEP | | X | | |
34516 | Parallel 17-mer DNA G-quadruplex | 6YY4 | | X | | |
34524 | Structure of a parallel c-Myc modified with 3' duplex stem-loop overhang | 6ZL2 | | X | | |
34525 | Structure of a parallel c-Myc modified with 5' duplex stem-loop overhang | 6ZL9 | | X | | |
34529 | G-quadruplex with a G-A bulge | 6ZRM | | X | | |
34533 | Structure of a parallel c-myc modified with 5' duplex stem-loop and 3' diagonal snap-back loop | 6ZTE | | X | | |
34542 | Antiparallel basket-type G-quadruplex DNA structure formed in human Bcl-2 promoter containing 8-oxoG | 6ZX6 | | X | | |
34543 | Antiparallel basket-type G-quadruplex DNA structure formed in human Bcl-2 promoter | 6ZX7 | | X | | |
34565 | NMR structure of a DNA G-quadruplex containing two SP1 binding sites from HIV-1 promoter | 7ALU | | X | | |
34571 | G-quadruplex with V-shaped loop from the first repeat of KCNN4 minisatellite | 7ATZ | | X | | |
34579 | Synthetic DNA duplex dodecamer | 7B4Z | | X | | |
34580 | Single modified phosphoryl guanidine DNA duplex, Sp diastereomer | 7B71 | | X | | |
34581 | DNA duplex with phosphoryl guanidine moiety, Rp-diastereomer | 7B72 | | X | | |
34587 | deoxyxylose nucleic acid hairpin | 7BFS | | X | | |
34588 | deoxyxylose nucleic acid hairpin | 7BFX | | X | | |
34590 | GA repetition with i-motif clip at 5'-end | 7BI0 | | X | | |
34591 | GA attached to an i-motif clip at 3'-end | 7BL0 | | X | | |
34592 | AG repetition attached to a compact i-motif clip at 3'-end | 7BLM | | X | | |
34593 | AG repetition attached to an extended i-motif clip at 3'-end | 7BMA | | X | | |
34594 | Solution structure of DNA duplex containing a 2'-deoxy-2'2'-difluorodeoxycytidine (gemcitabine) modification | 7NBK | | X | | |
34595 | Solution structure of DNA:RNA hybrid containing a 2'-deoxy-2'2'-difluorodeoxycytidine (gemcitabine) modification | 7NBL | | X | X | |
34596 | Solution structure of DNA duplex containing a 7,8-dihydro-8-oxo-1,N6-ethenoadenine base modification that induces exclusively A->T transversions in Escherichia coli | 7NBP | | X | | |
34599 | Solution structure of DNA:RNA hybrid duplex | 7NEJ | | X | X | |
34611 | Three-quartet c-kit2 G-quadruplex stabilized by a pyrene conjugate | 7NWD | | X | | |
34615 | Hybrid-2R quadruplex-duplex with (-p-p-l) topology and 3 syn residues | 7O1H | | X | | |
34616 | The structure of an i-motif/duplex junction at neutral pH | 7O5E | | X | | |
34623 | A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine | 7OGV | | X | | |
34624 | A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine | 7OHE | | X | | |
34625 | A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine | 7OHJ | | X | | |
34626 | A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine | 7OHM | | X | | |
34631 | G-quadruplex structure of the C. elegans telomeric repeat: A two tetrads basket type conformation stabilised by a Hoogsteen C-T base-pair | 7OQT | | X | | |
34654 | Pre-catalytic complex of 10-23 DNAzyme with RNA target | 7PDU | | X | X | |
34664 | Parallel Q-D hybrid with 3' duplex stem-loop as a lateral snapback loop | 7PNE | | X | | |
34665 | Solution structure of 1:1 complex of an indoloquinoline derivative SYUIQ-5 to parallel quadruplex-duplex (Q-D) hybrid | 7PNG | | X | | |
34679 | 10bp DNA/DNA duplex | 7QA9 | | X | | |
34685 | Solution structure of a lanthanide-binding DNA aptamer | 7QB3 | | X | | |
34714 | Phen-DC3 intercalation causes hybrid-to-antiparallel transformation of human telomeric DNA G-quadruplex | 7Z9L | | X | | |
34721 | Structure of a hybrid-type G-quadruplex with a snapback loop (hybrid 1R') | 7ZEK | | X | | |
34722 | Structure of a parallel G-quadruplex with a snapback loop | 7ZEM | | X | | |
34723 | Structure of a hybrid-type G-quadruplex with a snapback loop and an all-syn G-column (hybrid-1R) | 7ZEO | | X | | |
34735 | Dimeric i-motif from 2'Farabinocytidine-modified TC5 | 7ZYX | | X | | |
34740 | Solution structure of Phen-DC3 intercalating into a quadruplex-duplex hybrid | 8ABD | | X | | |
34741 | Solution structure of a phenyl-indoloquinoline intercalating into a quadruplex-duplex hybrid | 8ABN | | X | | |
34768 | Hairpin adopted by modified oligonucleotide A32_mod found in the promoter of AUTS2 gene. | 8BM4 | | X | | |
34769 | Hairpin of adopted by oligonucleotide A36 found in the promoter of AUTS2 gene. | 8BM6 | | X | | |
34770 | Hairpin adopted by oligonucleotide A38 found in the promoter of AUTS2 gene. | 8BM7 | | X | | |
34772 | An i-motif domain able to undergo pH-dependent conformational transitions (acidic structure) | 8BQY | | X | | |
34774 | An i-motif domain able to undergo pH-dependent conformational transitions (neutral structure) | 8BV6 | | X | | |
36001 | Structure model of a protein-DNA complex | 5B7J | X | X | | |
36020 | Structure of two CCTG repeats | 5GWL | | X | | |
36022 | Structure of two TTTA repeats | 5GWQ | | X | | |
36116 | The structure of a chair-type G-quadruplex of the human telomeric variant in K+ solution | 5YEY | | X | | |
36159 | Solution structure for the 1:1 complex of a platinum(II)-based tripod bound to a hybrid-1 human telomeric G-quadruplex | 5Z80 | | X | | |
36160 | Solution structure for the unique dimeric 4:2 complex of a platinum(II)-based tripod bound to a hybrid-1 human telomeric G-quadruplex | 5Z8F | | X | | |
36168 | Solution structure of G-quadruplex formed in vegfr-2 proximal promoter sequence | 5ZEV | | X | | |
36174 | SOLUTION NMR STRUCTURE OF A 14-MER DOUBLE STRANDED DNA DUPLEX CGCGAAATTTCGCG | 5ZLD | | X | | |
36186 | Solution Structure of the DNA complex of the C-terminal Domain of Rok | 5ZUX | X | X | | |
36378 | NMR solution structures of the DNA minidumbbell formed by 5'-mCTTGXmCTTG-3' | 7D0X | | X | | |
36379 | NMR solution structures of the DNA minidumbbell formed by two CmCTG repeats at pH 5 | 7D0Y | | X | | |
36380 | NMR solution structures of the DNA minidumbbell formed by two CCTG repeats at pH 5 | 7D0Z | | X | | |
36404 | Solution structure of the C-clamp domain from human HDBP1 in complex with DNA | 7DTA | X | X | | |
36411 | Aptamer enhancing peroxidase activity of myoglobin | 7E5P | | X | | |