BMRB - Biological Magnetic Resonance Bank

BMRB Query Grid

Select desired data type(s) and optionally limit polymer type(s). You can select multiple values by holding the "control" key (Windows, Linux) or "option" key (MacOS) while clicking. All data type selections are applied using a logical AND operator. Polymer selection join type can be selected. Click a column header to sort by that column.

Data type(s): Polymer type(s): Polymer join type:

Number of entries returned: 8762

Download all matching entries in NMR-STAR as a compressed file or download the results displayed on this page in CSV format.

BMRB ID	Entry Title	IUPAC CS referencing	Protein	DNA	RNA	Other
246	Polypeptide Chain Fold of Human Transforming Growth Factor alpha Analogous to Those of Mouse and Human Epidermal Growth Factors as Studied by Two-Dimensional 1H NMR	X	X
357	Conformational behavior of fragments of adrenocorticotropin and their antisense peptides determined by NMR spectroscopy and CD spectropolarimetry	X	X
614	The 1H Nuclear-Magnetic-Resonance Spectra and Spatial Structure of the Naja mossambica mossambica Neurotoxin III	X	X
888	pH-Induced Denaturation of Proteins: A Single Salt Bridge Contributes 3-5 kcal/mol to the Free Energy of Folding of T4 Lysozyme	X	X
1175	NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site	X	X
1176	NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site	X	X
1177	NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site	X	X
1475	Isotope-Edited NMR of Cyclosporin A Bound to Cyclophilin: Evidence for a Trans 9,10 Amide Bond	X	X
1486	A characterization of copper/zinc superoxide dismutase mutants at position 124	X	X
1487	A characterization of copper/zinc superoxide dismutase mutants at position 124	X	X
1844	NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site	X	X
1845	NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site	X	X
1846	NMR analysis of site-specific mutants of yeast phosphoglycerate kinase An investigation of the triose-binding site	X	X
2068	Characterization of Phosphate Binding in the Active Site of Barnase by Site-Directed Mutagenesis and NMR	X	X
2069	Characterization of Phosphate Binding in the Active Site of Barnase by Site-Directed Mutagenesis and NMR	X	X
2265	Two-Dimensional NMR Strategies for Carbon-Carbon Correlations and Sequence-Specific Assignments in Carbon-13 Labeled Proteins	X	X
3065	Studies of the structure of bacteriophage lambda cro protein in solution Analysis of the aromatic region of the 1H NMR spectrum	X	X
3127	Proton Nuclear Magnetic Resonance Studies of Porcine Intestinal Calcium Binding Protein	X	X
3128	Proton Nuclear Magnetic Resonance Studies of Porcine Intestinal Calcium Binding Protein	X	X
3433	1H and 15N assignments and secondary structure of the Src Sh3 domain	X	X
4052	Solution structures of Staphylococcal Nuclease from multidimensional, multinuclear NMR: nuclease-H124L and its ternary complex with Ca2+ and Thymidine-3'-5'-bisphosphate	X	X
4053	Solution structures of Staphylococcal Nuclease from multidimensional, multinuclear NMR: nuclease-H124L and its ternary complex with Ca2+ and Thymidine-3'-5'-bisphosphate	X	X
4065	Sequence-Specific Resonance Assignments for a Designed Four-Alpha-Helix-Bundle Protein	X	X
4068	Assignment of 1H, 13C, and 15N Signals of Turkey Ovomucoid Third Domain at pH 2.0	X	X
4072	Sequence Specific 1HA, 15N, 13CA, and 13CB Assignments for RNA-1 Modulator Protein ROM	X	X
4089	Peptide Deformylase Catalytic Core (Residues 1 - 147)	X	X
4097	Backbone 1H, 13C and 15N Chemical Shift Assignment for the HIV-1 RNase H Domain	X	X
4103	1H, 13C and 15N Chemical Shift Assignments of the 14mer DNA Duplex BS2	X		X
4104	1H, 13C and 15N Chemical Shift Assignments of the 14mer DNA Duplex BS2 in the Complex with the Antennapedia Homeodomain	X	X	X
4109	Sequence Specific 1H, 13C and 15N Resonance Assignment of Rat CD2 Domain 1	X	X
4126	Solution Structure and Dynamics of a De Novo Designed Three-helix Bundle Protein	X	X
4133	The Structure of the N-terminus of Striated Muscle Alpha-Tropomyosin in a Chimeric Peptide: Solution Nuclear Magnetic Resonance Structure and Circular Dichroism Studies.	X	X
4140	Sequence-specific 1H, 13C and 15N Assignment of the EH1 Domain of Mouse Eps15	X	X
4141	vnd/NK-2 Homeodomain DNA Complex Protein 1H, 13C, and 15N Chemical Shifts and HNHA Coupling Constant	X	X	X
4145	Assignment of 1H and 15N Resonances of Murine Tec SH3 Domain	X	X
4150	The Signal Transducer gp130: Solution Structure of the Carboxy-terminal Domain of the Cytokine Receptor Homology Region	X	X
4151	1H, 13C, and 15N Assignment and Secondary Structure of the High pH Form of Subunit c of the F1FO ATP Synthase	X	X
4153	High-Resolution Solution Structure of the Retinoid X Receptor DNA-Binding Domain	X	X
4154	13C and Stereospecific 13C and 1H Resonance Assignments for Oxidized Putidaredoxin	X	X
4155	Solution Structure of Eotaxin: A Chemokine that Selectively Recruits Eosinophils in Allergic Inflammation	X	X
4156	The Structure in Solution of the b Domain of Protein Disulfide Isomerase	X	X
4157	Three-dimensional Solution Structure of Lactoferricin B, an Antimicrobial Peptide Derived from Bovine Lactoferrin	X	X
4159	Solution Structure of LSIII, a Long Neurotoxin from the Venom of Laticauda semifasciata	X	X
4160	Resonance Assignments of the Tn916 Integrase DNA-Binding Domain and Integrase: DNA Complex	X	X
4161	1H, 13C and 15N Assignment of the DNA Binding Domain of Interferon Regulatory Factor-2	X	X
4163	1H Chemical Shift Assignments and Interproton 3JNHA and 3JHAHB Coupling Constants of Aesculus hippocastanum Antimicrobial Protein 1 (Ah-AMP1), a Plant Defensin Isolated from Horse Chestnuts.	X	X
4164	Bacterial Iron Transport: 1H NMR Determination of the Three-dimensional Structure of the Gallium Complex of Pyoverdin G4R, the Peptidic Siderophore of Pseudomonas putida G4R	X	X
4165	1H, 13C, and 15N Chemical Shift Assignments for Tn916 N-terminal DNA Binding Domain complex with DNA	X	X	X
4166	Backbone H, CA, N Chemical Shift Assignments for C2A/Ca2+ Binary Complex	X	X
4167	Backbone H, CA, N chemical shift assignments for C2A/Ca2+/6PS ternary complex	X	X
4169	Bacterial Iron Transport: 1H NMR Determination of the Three-dimensional Structure of the Gallium Complex of Pyoverdin G4R, the Peptidic Siderophore of Pseudomonas putida G4R	X	X
4170	2'-Deoxy-Isoguanosine Base Paired to Thymidine, NMR Minimized Average Structure	X		X
4177	Monocyte Chemoattractant Protein-3	X	X
4183	Expression and Assignment of 1H, 15N,and 13C Resonances of the C-terminal Domain of the Diphtheria Toxin Repressor	X	X
4185	1H Chemical Shift Assignments for Gurmarin	X	X
4188	C2 Domain of Cytosolic Phospholipase A2	X	X
4189	Solution Structure of Reduced Horse Heart Cytochrome c	X	X
4194	Structural Studies of D-Pro Melittin	X	X
4195	Solution NMR Structure of the Complex of Alpha-Bungarotoxin with a Library-Derived Peptide (NMR, Average Structure)	X	X
4200	NMR Solution Structure of the c-Myc-Max Heterodimeric Leucine Zipper	X	X
4203	An NMR Conformational Analysis of Synthetic Peptide Cn2(1-15)NH2-S-S-AcetylCn2(52-66)NH2 from the New World Centruroides Noxius 2(Cn2) Scorpion Toxin. Comparison of the Structure with those of the Centruroides Scorpion Toxins.	X	X
4206	Solution NMR Structure of Linked Cell Attachment Modules of Mouse Fibronectin Containing the RGD and Synergy Regions, 20 Structures	X	X
4212	Synthetic peptide corresponding to the major immunogen site of FMD virus	X	X
4219	Effects of Glycosylation on the Structure and Dynamics of Eel Calcitonin	X	X
4223	Solution Structure of a TBP-TAFII230 Complex: Protein Mimicry of the Minor Groove Surface of the TATA Box Unwound by TBP	X	X
4225	NMR structure of Escherichia coli glutaredoxin3-glutathione mixed disulfide complex	X	X
4229	Artificial Fe8S8 ferredoxin: the D13C variant of Bacillus schlegelii Fe7S8 ferredoxin	X	X
4232	N-Domain of Troponin C from Chicken Skeletal Muscle.	X	X
4237	Backbone and side-chain 1H, 15N, and 13C Assignments for the Topological Specificity Domain of the MinE cell Division Protein	X	X
4242	Motile Major Sperm Protein (MSP) of Ascaris suum	X	X
4245	Assessing Potential Bias in the Determination of Rotational Correlation Times of Proteins by NMR Relaxation	X	X
4248	LEF1 HMG Domain (From Mouse), Complexed with DNA (15bp), NMR, 12 Structures	X	X	X
4251	Triple Resonance Assignment for Abl SH(32) and One in the Complex with a Consolidated Ligand	X	X
4252	Triple Resonance Assignment for Abl SH(32) and One in the Complex with a Consolidated Ligand	X	X
4253	An Examination of Coaxial Stacking of Helical Stems in a Pseudoknot Motif: the Gene 32 Messenger RNA Pseudoknot of Bacteriophage T2	X			X
4254	1H, 15N and 13C Assignments of the DNA Binding Domain of Transcription Factor Mbp1 from Sassharomyces cerevisiae in Both Its Free and DNA Bound Forms and 1H Assignments of the Free DNA	X	X
4256	1H, 15N and 13C Assignments of the DNA Binding Domain of Transcription Factor Mbp1 from S. cerevisiae in Both Its Free and DNA Bound Forms, and 1H Assignments of the Free DNA	X	X	X
4260	Effects of Glycosylation on the Structure and Dynamics of Eel Calcitonin in Micelles and Lipid Bilayers Determined by NMR Spectroscopy	X	X
4261	Effects of Glycosylation on the Structure and Dynamics of Eel Calcitonin in Micelles and Lipid Bilayers Determined by NMR Spectroscopy	X	X
4264	Complex of the amino terminal domain of enzyme I and the histidine-containing phosphocarrier protein HPr from Escherichia coli nmr, restrained regularized mean structure	X	X
4268	7-Fe Ferredoxin from Bacillus Schlegelii	X	X
4269	1H, 15N and 13C Chemical Shift Assignments for the Catalytic Core of Resolvase	X	X
4276	Solution Structure and Dynamics of the Plasminogen Kringle 2-AMCHA Complex: 3/1-Helix in Homologous Domains	X	X
4278	Backbone 1H and 15N Chemical Shift Assignments for Long-[L60]-IGF-I, an Insulin-Like Growth Factor 1 Analogue (IGF-I)	X	X
4279	Solution Structure of a beta-Neurotoxin from the New World Scorpion Centruroides sculpturatus Ewing	X	X
4282	1H, 15N, and 13C Resonance Assignments for the N-terminal 20 kDa Domain of the DNA Single-Strand Break Repair Protein XRCC1	X	X
4284	NMR Solution Structure of a Complex of Calmodulin with a Binding Peptide of the Ca2+-Pump	X	X
4285	1H, 13C and 15N NMR Sequence-Specific Resonance Assignments for Rat Apo-S100A1(aa).	X	X
4286	1H and 15N Chemical Shift Assignments of the Unstructured Yeast Vesicular SNARE Snc1.	X	X
4287	1H and 15N Chemical Shift Assignments of the Unstructured Yeast Target Membrane SNARE Sso1.	X	X
4291	Solution Structure of Desulfovibrio Vulgaris (Hildenborough) Ferrocytochrome C3: Structural Basis for Functional Cooperativity	X	X
4295	Titin Module A71 from Human Cardiac Muscle	X	X
4296	1H, 13C, and 15N Chemical Shift Assignments for E. coli Cold-shock Protein A (CspA)	X	X
4298	A Synthetic Cyclic Peptide Corresponding to the Complete V3 Loop of the RF HIV-1 Strain in Water Solution	X	X
4301	1H, 13C and 15N Chemical Shift Assignments of the Pathogenesis-related Protein P14a	X	X
4302	Assignment of 1H, 13C and 15N Resonances of the a' Domain of Protein Disulfide Isomerase	X	X
4304	1H, 13C, and 15N Chemical Shift Assignment of the Extended Neuronal Nitric Oxide Synthase PDZ Domain Complexed with an Associated Peptide	X	X
4305	1H, 13C, 15N Assignment of PIN: A Protein Inhibitor of Neuronal Nitric Oxide Synthase	X	X
4307	1H, 13C, and 15N Chemical Shift Assignments for SHa rPrP(90-231).	X	X
4308	1H and 15N Chemical Shift Assignments for Domain 4 of the Common Beta-Chain of the IL-3, IL-5 and GM-CSF Receptors	X	X
4310	Calmodulin SEF2-1 Complex	X	X
4311	Sequence-Specific 1H, 13C and 15N Chemical Shift Assignment and Secondary Structure of the HTLV-I Capsid Protein	X	X
4312	1H, 15N and 13C Resonance Assignments for the Bromodomain of the Histone Acetyltransferase hsP/CAF	X	X
4313	1H, 13C and 15N NMR Assignments for a Carbon Monoxide Generating Metalloenzyme from Klebsiella pneumoniae, Acireductone Dioxygenase (ARD)	X	X
4314	1H Assignments for the Human Chemokine HCC2	X	X
4315	Assignment of the Backbone of Oxidized Fe-superoxide Dismutase, a 42kDa Paramagnet- containing Enzyme	X	X
4316	1H, 13C and 15N Chemical Shift Assignements for Subunit c of the ATP Synthase from Propionigenium modestum	X	X
4317	1H, 13C, and 15N Chemical Shift Assignments for NS1(1-73)	X	X
4318	Assignment of 1H, 13C, and 15N Resonances of Reduced Escherichia coli Glutaredoxin 2	X	X
4319	1H-15N and 1H-13C Dipolar Splittings and Calculated Dipolar Shifts for Oxidized Clostridium Pasteurianum Rubredoxin	X	X
4320	1H-15N and 1H-13C Dipolar Splittings and Calculated Dipolar Shifts for Reduced Clostridium Pasteurianum Rubredoxin	X	X
4321	1H, 13C, and 15N Chemical Shift Assignments for the Catalytic Domain of Tetrahymena GCN5 Histone Acetyltransferase in Complex with CoA	X	X
4322	1H Chemical Shift Assignment for the Complete Consensus V3 Loop Peptide of the Envelope Protein gp120 of HIV-1 in 20% Trifluoroethanol/Water.	X	X
4326	Complete 1H, 13C, and 15N Chemical Shift Assignments for the N-terminal Domain of DNA Polymerase B (residues 2-87).	X	X
4327	1H, 13C, and 15N Resonance Assignment and Secondary Structure of the N-terminal Inhibitory Domain of Human Tissue Inhibitor of Metalloproteinases-1	X	X
4328	1H, 13C, and 15N Chemical Shift Assignments for Human Rad51(1-114)	X	X
4329	Sequential Assignment and Secondary Structure Analysis of the NADP(H)-Binding Domain of Escherichia coli Transhydrogenase	X	X
4330	A Single-Chain T Cell Receptor	X	X
4331	Backbone 1H, 13C, and 15N Resonance Assignments of Streptomyces Subtilisin Inhibitor	X	X
4333	The Three-dimensional Solution Structure and Dynamic Properties of the Human FADD Death Domain	X	X
4340	Complete 1H, 15N and 13C Assignment of a Recombinant Mouse Major Urinary Protein	X	X
4341	Assignment of the Backbone Resonances of Oxidized Fe-superoxide Dismutase, a 42 kDa Paramagnet-containing Enzyme	X	X
4344	1H and 15N Chemical Shift Assignments for Apo-CopZ	X	X
4349	Backbone Resonance Assignments for the Fv Fragment of the Catalytic Antibody NPN43C9 with Bound p-nitrophenol	X	X
4353	1H, 13C, and 15N Resonance Assignments of C-terminal Domain of MutY	X	X
4355	Backbone 1H, 13C, 15N Chemical Shift Assignments for the Asymmetric Strands of the Tetramerization Domain of the Mnt Repressor	X	X
4365	Dynamics of Stromelysin/Inhibitor Interactions Studied by 15N NMR Relaxation Measurements: Comparison of Ligand Binding to the S1-S3 and S1-S3 Subsites	X	X
4366	Dynamics of Stromelysin/Inhibitor Interactions Studied by 15N NMR Relaxation Measurements: Comparison of Ligand Binding to the S1-S3 and S1-S3 Subsites	X	X
4368	Chemical Shift Assignments for A35T vnd/NK2 Mutant Homeodomain	X	X	X
4371	Sequence-specific 1H, 13C and 15N Resonance Assignments of Recombinant Onconase/P-30 Protein	X	X
4379	NMR Solution Structure of the Human Prion Protein Domain reveals Species Dependent Structural Disorder and Intramolecular Association with the Flexible Tail	X	X
4381	Letter to the Editor:Sequence-specific 1H, 13C, and 15N assignments for the third EH domain of Eps15 (EH3)	X	X
4382	1H, 13C and 15N Assigned Chemical Shifts for a Eukaryotic Rubredoxin from Guillardia theta	X	X
4383	1H Chemicals Shift Assignments for Wheat ns-LTP Complexed with Prostaglandin B2.	X	X
4385	Rapid Fold and Sructure Determination of the Archaeal Translation Elongation Factor 1beta from Methanobacterium thermoautotrophicum	X	X
4387	Solution structure of thanatin, a potent bactericidal and fungicidal insect peptide, determined from 1H-2D NMR	X	X
4388	Backbone NMR Assignments of a High Molecular Weight Protein (47kD), Cyclic AMP Receptor Protein (apo-CRP)	X	X
4389	Backbone NMR Assignment and Secondary Structure of Ribosome Recycling Factor (RRF) from Pseudomonas aeruginosa	X	X
4390	Backbone dynamics of the human CC-chemokine eotaxin	X	X
4392	Binding of AR-1-144, a tri-imidazole DNA minor groove binder, to CCGG sequence analyzed by NMR spectroscopy	X		X
4395	RIBOSOMAL PROTEIN L25 FROM ESCHERICHIA COLI, NMR,	X	X
4396	Anticoagulant protein from the nematode Ancylostoma caninum	X	X
4397	Solution Structure of the CX3C Chemokine Domain of Fractalkine	X	X
4399	Alpha-conotoxin ImI	X	X
4400	Structure and Mechanism of Formation of the H-y5 ismomer of an Intramolecular DNA Triple Helix.	X		X
4401	Structure and Interaction Site of the Regulatory Domain of Troponin-C when Complexed with the 96-148 Region of Troponin-I	X	X
4402	1H, 13C and 15N chemical shift assignment of human prion protein hPrP(23-230)	X	X
4403	1H, 13C and 15N Resonance Assignment and Secondary Structure of the J Domain of Murine Polyomavirus T Antigens	X	X
4406	The cyclic peptide contryphan-R from Conus radiatus	X	X
4408	Minor Form of the Cyclic Peptide Contryphan-R from Conus radiatus	X	X
4411	Backbone 1H and 15N Chemical Shift Assignments for Transforming Growth Factor beta	X	X
4413	STRUCTURE OF THE C-TERMINAL DOMAIN OF P73	X	X
4417	1H, 13C and 15N Chemical Shift Assignments of the Birch Pollen Allergen Bet v 1	X	X
4418	NMR structure with tightly bound water molecules of cytotoxin II (cardiotoxin) from Naja naja oxiana in aqueous solution (minor form)	X	X
4419	NMR structure with tightly bound water molecules of cytotoxin II (cardiotoxin) from Naja naja oxiana in aqueous solution (major form)	X	X
4421	13C,15N and 1H Assigned Chemical Shifts for PhoB DNA-binding Domain.	X	X
4425	Solution structure of apo-biotinyl domain from acetyl coenzyme A carboxylase of Escherichia coli determined by triple-resonance NMR spectroscopy	X	X
4426	Solution Structure of Holo-biotinyl Domain from Acetyl Coenzyme A Carboxylase of Escherichia coli Determined by Triple-Resonance NMR Spectroscopy	X	X
4427	PI7, an orphan peptide isolated from the scorpion Pandinus Imperator: a 1H NMR analysis using a Nano-nmr probe.	X	X
4429	1H and 15N Chemical Shift Assignments for ribosomal protein L7	X	X
4432	1H-NMR Spectral Assignment of Second Transmembrane Segments of Human Glycine Receptor	X	X
4433	1H-NMR Spectral Assignment of Second Transmembrane Segments of Human Glycine Receptor	X	X
4434	NMR Solution Structure of the Human Prion Protein	X	X
4436	Proton Assignment of the Ferrocytochrome C3 from Desulfovibrio gigas.	X	X
4437	Solution structure of an EGF module pair from the Plasmodium falciparum merozoite surface protein 1	X	X
4438	1H, 13C and 15N chemical Shift Assignments for SCP2	X	X
4439	Hyperfine Cys Proton Signals from Oxidized Human Ferredoxin	X	X
4440	Hyperfine Cys Proton Signals from Reduced Human Ferredoxin	X	X
4441	Hyperfine Cys Proton Signals from Anabaena 7120 Vegetative Ferredoxin	X	X
4442	Hyperfine Cys Proton Signals from Reduced Anabaena 7120 Vegetative Ferredoxin	X	X
4444	1H, 13C and 15N chemical shift assignments and secondary structure of Halobacterium salinarum ferredoxin	X	X
4445	1H, 13C, and 15N Chemical Shift Assignments and coupling constants for the HRDC domain from S. cerevisiae Sgs1 RecQ helicase	X	X
4448	1H, 13C and 15N backbone assignment and secondary structure of the 19 kDa diadenosine 5',5'''-P1,P4 tetraphosphate hydrolase from Lupinus angustifolius L.	X	X
4449	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Intramolecular Dimer Antifreeze Protein RD	X	X
4451	Structure of the CAD Domain of Caspase-activated DNase and Interaction with the CAD Domain of its Inhibitor	X	X
4452	The Solution structure of Type II Antifreeze Protein Reveals a New Member of the Lectin Family	X	X
4453	Assignment of the 1H, 13C and 15N Resonances of the C-terminal EF-Hands of Alpha Actinin in a 14 kDa Complex with Z-Repeat 7 of Titin	X	X
4454	1H and 15N Chemical Shift Assignments for Titin Z-repeat 7 in the Complex with Alpha-actinin C-terminal EF-hands	X	X
4455	Glycan-free mutant adhesion domain of human CD58 (LFA-3)	X	X
4456	1H Chemical Shift Assignments for the cytoplasmic domain of aIIb integrin	X	X
4457	Sequence-specific assignments and partial unfolding of extracellular domains II and III of E-cadherin.	X	X
4461	1H NMR Solution Structure of Cycloviolacin O1 - A Macro-cyclic Polypeptide Isolated from Viola odorat	X	X
4463	Sequential NMR assignment of the Ras-binding domain of Byr2	X	X
4464	Chemical shifts of the major form of the cyclic peptide contryphan-Sm	X	X
4465	The Structural role of the Copper-coordinating and Surface-exposed Histidine Residue in the Blue Copper Protein Azurin	X	X
4467	Sequence-specific 1H, 13C, and 15N Assignments of the MAR-binding Domain of Chicken MeCP2/ARBP	X	X
4468	Chemical shifts of the minor form of the cyclic peptide contryphan-Sm	X	X
4469	Chemical shifts of the major form of the cyclic peptide Des[Gly1]-contryphan-R	X	X
4470	Solution Structure of ThiS and Implications for the Evolutionary Roots of Ubiquitin	X	X
4471	Complete 1H, 15N and 13C assignment of the functional domain of Paracoccus denitrificans cytochrome c552 in the reduced state	X	X
4472	1H, 13C, and 15N signal assignments for BeFx-activated CheY from E. coli	X	X
4473	The molecular basis for Protein Kinase A anchoring revealed by solution NMR	X	X
4478	PKD domain 1 from Human polycystein-1	X	X
4493	Solution structure of the designed hydrophobic core mutant of ubiquitin, 1D7	X	X
4506	Solution structure of carnobacteriocin B2	X	X
4522	The restrained and minimized average NMR structure of MAP30.	X	X
4524	Solution Structure of a Type-I Dockerin Domain, a Novel Prokaryotic, Extracellular Calcium-Binding Domain	X	X
4551	SOLUTION STRUCTURE OF THE N-TERMINAL DOMAIN OF RIBOSOMAL PROTEIN L9	X	X
4554	Backbone HN, N, Ca, C' and Cb assignments of the 19 kDa DHFR/NADPH complex at 9C and pH 7.6	X	X
4557	Structure of the active domain of the herpes simplex virus protein ICP47 in water/sodium dodecyl sulfate solution determined by nuclear magnetic resonance spectroscop	X	X
4558	1H, 13C, and 15N Assignments for YopH-NT	X	X
4560	Assignment of 1H, 13C and 15N signals of a recombinant effector protein (T4MOD) in Toluene-4-monooxygenase complex	X	X
4561	Solution Structure of Imperatoxin A (IpTxa) from the scorpion P. imperator Determined by 1H-NMR Spectroscopy	X	X
4563	NMR Structure of the Bovine Prion Protein	X	X
4564	NMR Structure of the Bovine Prion Protein	X	X
4566	Assignment of 1H,13C and 15N signals of Bovine Adrenodoxin	X	X
4567	1H, 15N and 13C resonance assignments for the catalytic domain of the yeast E2, UBC1	X	X
4571	Zinc-bundle Structure of the Essential RNA Polymerase Subunit RPB10 from Methanobacterium thermoautotrophicum	X	X
4572	Conformational changes in the PBX Homeodomain and C-terminal Extension upon Binding DNA and HOX-derived YPWM Peptides	X	X
4575	Letter to the Editor: Backbone resonance assignment of the N-terminal 24 kDa fragment of the gyrase B subunit from S. aureus complexed with novobiocin	X	X
4576	Solution Structure of [d(CGC)r(aaa)d(TTTGCG)]2 Hybrid Junctions Flanked by DNA Duplexes	X		X
4581	Site-site Communication in the EF-hand Ca2+ Binding Protein Calbindin D9k	X	X
4588	Proton and nitrogen chemical shift assignments for the chitin-binding domain of Bacillus circulans WL-12 Chitinase A1	X	X
4604	NMR STRUCTURE OF THE PEPTAIBOL CHRYSOSPERMIN C BOUND TO DPC MICELLES	X	X
4630	NMR STRUCTURE OF THROMBOMODULIN EGF(4-5)	X	X
4631	PEPTIDE FRAGMENT THR671-LEU690 OF THE RABBIT SKELETAL DIHYDROPYRIDINE RECEPTOR	X	X
4632	Solution Structure of a Pro-Apoptotic Protein BAX	X	X
4634	Structural analysis of multi-functional peptide motifs present in human bifunctional tRNA synthetase: Identification of RNA-binding residues and functional implications for tandem repeats	X	X
4635	Solution structure of the interacting domains of the Mad-Sin3 complex: implications for recruitment of a chromatin-modifying complex	X	X
4639	NMR structure of the hRap1 Myb motif reveals a canonical three helix bundle lacking the positive surface charge typical of Myb DNA binding domains	X	X
4650	Sheep prion protein synthetic peptide spanning helix 1 and b strand 2 (residues 142 to 166) shows b hairpin structure in solution	X	X
4661	Solution structure of APAF-1 CARD	X	X
4663	Rotamer Strain as a Determinant of Protein Structural Specificity	X	X
4664	Sequence-Specific Resonance Assignments of Q83, a Lipocalin Highly Expressed in v-myc-Transformed Avian Fibroblasts	X	X
4666	Biotin carboxyl carrier domain of transcarboxylase (TC 1.3S)	X	X
4668	Assignment of 1H, 13C and 15N Resonances of FKBP from Methanococcus thermolithotrophicus	X	X
4669	Structural Analysis of the Immunodominant Antigenic Region of the Hepatitis C Virus Capsid Protein by NMR	X	X
4673	Solution structure of Ileal Lipid Binding Protein in complex with glycocholate	X	X
4680	The Structure of a LysM Domain from E.coli Membrane-bound Lytic Murein Transglycosylase D (MltD)	X	X
4697	Structure of the fMet-tRNAfMet-binding domain of B. stearothermophilus initiation factor IF2	X	X
4702	Structure of the Negative Regulatory Domain of p53 bound to S100B	X	X
4717	1H, 15N, 13C, and 13CO Assignments for ZipA	X	X
4718	Assignments of amide 1H, amide 15N, and Ca, CO, Cb 13C shifts for the replication terminator protein	X	X
4719	Backbone 1H, 13C and 15N chemical shift assignments of the Ras-binding domain (RBD) of AF6	X	X
4720	Backbone 1H, 15N, and 13C Resonance Assignments of Inhibitor-2-- a Protein Inhibitor of Protein Phosphatase-1	X	X
4721	Structure of the Central Core Domain of TFIIEbeta with a Novel Double-stranded DNA-binding Surface	X	X
4728	1H assignments of the EGF-like module 3 from vitamin K-dependent protein S	X	X
4729	1H, 15N, 13CA, 13CB, 13C' assignments of the EGF-like module pair 3-4 from vitamin K-dependent protein S	X	X
4735	Sequence-specific NMR resonance assignments for the backbone atoms of olfactory marker protein (OMP)	X	X
4738	Determination by High Field NMR Spectroscopy of the Longitudinal Electron Relaxation Rate in Cu(II)Plastocyanin from Anabaena variablis.	X	X
4739	NMR solution structure of the calcium-bound C-terminal domain (W81-S161) of Calcium Vector Protein from Amphioxus	X	X
4740	Solution Structure of a 8.3 kDa Protein (gene MTH1184) from Methanobacterium thermoautotrophicum	X	X
4744	1H Chemical Shift Assignments for fully oxidized cytochrome c7 from Desulfuromonas acetoxidans	X	X
4751	Assignment of 1H and 15N resonances of mouse lysozyme	X	X
4762	15N relaxation data and model-free parameters for the N-terminal receiver domain of wild-type unphosphorylated NtrC receiver domain (NtrCr)	X	X
4763	15N relaxation data and model-free parameters for the N-terminal receiver domain of double-mutant (D86N/A89T) unphosphorylated NtrC receiver domain (NtrCr(D86N/A89T))	X	X
4770	Backbone 1HN, 15N and 13C shifts for GDP-loaded Cdc42 from Candida albicans	X	X
4775	Solution structure of the spindle assembly checkpoint protein human MAD2	X	X
4777	Complete 1H, 15N and 13C Assignment of the Functional Domain of Paracoccus denitrificans Cytochrome c552 in the Oxidized state	X	X
4781	NMR Structure of Stem-loop SL2 of the HIV-1 Psi RNA Packaging Signal Reveals a Novel A-U-A Base-triple Platform	X	X		X
4788	1H,15N, and 13C NMR resonance assignments for the Eps15 Homology domain Resp1	X	X
4799	Solution Structure of Human Immunodeficiency Virus Type 1 Vpr (13-33) Peptide in Micells	X	X
4800	Chemical shifts of 1H resonances of the heme protons and of the side chain protons of the two axial ligands, His69 and Met106, and of Trp109 of the isolated c domain of Paracoccus pantotrophus in the reduced state	X	X
4801	Chemical shifts of 1H resonances of the heme protons and of the side chain protons of the two axial ligands, His69 and Met106, of the isolated c domain of Paracoccus pantotrophus in the oxidized state	X	X
4802	1H, 13C, and 15N sequential assignment of the triple labelled N-terminal domain of the Histone like Nucleoid Structuring protein (H-NS) from Salmonella typhimurium (first 64 residues of the protein)	X	X
4815	NMR structure of Cardiotoxin in DPC-micelle	X	X
4818	1H, 15N and 13C Resonance Assignments for the N-Terminal Domain of the MAPK Phosphatase MKP3	X	X
4820	1H and 13Ca Chemical Shift Assignments for the Pheromone Er-22	X	X
4821	Assignment of 1H, 13C, and 15N resonances to the sensory domain of membraneous two-component fumarate sensor (histidine protein kinase) DcuS of Escherichia coli	X	X
4822	Conformations of the Regulatory Domain of Cardiac Troponin C Examined by Residual Dipolar Couplings; Apo form	X	X
4823	Conformations of the Regulatory Domain of Cardiac Troponin C Examined by Residual Dipolar Couplings; Holo form	X	X
4824	Conformations of the Regulatory Domain of Cardiac Troponin C Examined by Residual Dipolar Couplings; Complex with peptide	X	X
4825	1H, 15N and 13C NMR Resonance Assignments of RC-RNase 2	X	X
4829	1H, 15N and 13C resonance assignments for the DNA-binding domain of interleukin enhancer binding factor	X	X
4831	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Lysozyme	X	X
4850	Glutaredoxin 3 from Escherichia coli in the fully oxidized form	X	X
4854	Chemical shift assignments for the isolated N-terminal domain of EPSP synthase	X	X
4858	SOLUTION STRUCTURE OF NUCLEOLIN RBD1	X	X
4863	SOLUTION STRUCTURE OF NUCLEOLIN RBD2	X	X
4864	NMR Chemical shift mapping of the binding site of a protein proteinase inhibitor: changes in the 1H, 13C and 15N NMR chemical shifts of turkey ovomucoid third domain upon binding to bovine chymotrypsin Aa	X	X
4865	Backbone 1H, 13C, 15N Chemical shift Assignment for OMTKY3 bound to bovine Chymotrypsin Aa	X	X
4867	SOLUTION STRUCTURE OF NUCLEOLIN RBD12 IN COMPLEX WITH SNRE RNA	X	X		X
4869	HMG PROTEIN NHP6A FROM SACCHAROMYCES CEREVISIAE	X	X
4870	Sequence-specific 1H, 15N, and 13C resonance assignments for the whole region 4 of Escherichia coli RNA polymerase sigma70 subunit	X	X
4871	1H, 13C and 15N Resonance Assignments and Secondary Structure of the c-Myc Binding Domain (MBD) and the SH3 Domain of the Tumor Suppressor Bin1	X	X
4874	Sequence-specific assignment of the PAH2 domain of Sin3B free and complexed to Mad1	X	X
4878	Three-dimensional Structure Topology of the Calreticulin P-domain based on NMR Assignment	X	X
4881	Backbone 1H, 13C, 15N and 13CB and 1HB chemical shift assignments for Azotobacter vinelandii C69A holoflavodoxin	X	X
4884	1st LIM domain of PINCH protein	X	X
4886	Backbone 1H and 15N and 1HB chemical shift assignments for Azotobacter vinelandii C69A apoflavodoxin	X	X
4888	Backbone 1H and 15N Chemical Shift Assignment of c-Src SH3 in high salt solution	X	X
4889	Backbone 1H and 15N Chemical Shift Assignment of c-Src SH3 complexed with RLP2 ligand in high salt solution	X	X
4890	1H resonance assignments for the N-ter domain of the human TFIIH MAT1 subunit	X	X
4891	1H chemical shift assignments for cobrotoxin II	X	X
4893	1H, 15N and 13C NMR Resonance Assignments of RC-RNase 4	X	X
4896	Sequential Assignment and Secondary Structure of the 14kDa chemotactic Protein CheY2 from Sinorhizobium meliloti	X	X
4897	Sequential assignment, secondary structure and binding site of the carbohydrate-binding domain of papg from Uropathogenic E.coli	X	X
4900	1H and 15N chemical shift assignments of the C-terminal xylan binding module of C. fimi xylanase 11A	X	X
4905	1H, 13C and 15N Chemical Shift Assignments for Urea-denatured G88W-110 Fragment of Staphylococcal Nuclease	X	X
4910	1H and 15N chemical shift assignments for LEKTI domain one (HF6478)	X	X
4911	Structural Basis of Diverse Sequence-dependent Target Recognition by the 8kDa Dynein light chain	X	X
4912	Structural Basis of Diverse Sequence-dependent Target Recognition by the 8kDa Dynein light chain	X	X
4913	Backbone 1H, 15N, and 13C Resonance Assignments of ARPP-19	X	X
4916	RECEPTOR-BOUND CONFORMATION OF PACAP21	X	X
4919	Thioredoxin fold as a Homodimerization Module in the Putative Chaperone ERp29: NMR Structures of the Domains and Experimental Model of the 51 kDa Dimer	X	X
4920	Thioredoxin fold as a Homodimerization Module in the Putative Chaperone ERp29: NMR Structures of the Domains and Experimental Model of the 51 kDa Dimer	X	X
4921	Solution structure of poneratoxin	X	X
4922	Backbone 1H, 13C and 15N chemical shift assignments for unfolded apoplastocyanin	X	X
4924	Interactions of a toxin from the scorpion Tityus serrulatus with a cloned K+ channel from squid (SqKv1A).	X	X
4925	Structural Basis for the Functional switch of the E. Coli Ada Protein	X	X
4926	1H and 15N Chemical Shifts of CI2 with a ten glutamine repeat between residues 59 and 60	X	X
4928	Structure of the PHD Zinc finger from human Williams-Beuren syndrome transcription factor	X	X
4929	The 1H, 15N and 13C resonance assignments for the Tctex1 dynein light chain from Chlamydomonas flagella	X	X
4931	Solution structure of dynein light chain 8 (DLC8) and bim peptide complex	X	X
4934	Structure and functionality of a designed p53 dimer	X	X
4936	1H, 13C and 15N chemical shift assignments of the outer membrane protein OmpX from E.coli in DHPC micelles	X	X
4938	Two Different Neurodegenerative Diseases Caused by Proteins with Similiar Structures	X	X
4941	The Three-dimensional Structure of the C-terminal DNA-binding Domain of Human Ku70	X	X
4943	1H Chemical shift Assignments for Lysozymes marketed by Seikagaku and Sigma companies at pH 3.8, 308K	X	X
4945	VAM3P N-TERMINAL DOMAIN SOLUTION STRUCTURE	X	X
4950	Structure of the Anchor-Domain of Myristoylated and Non-myristoylated HIV-1 Nef Protein	X	X
4951	Structure of the Anchor-Domain of Myristoylated and Non-myristoylated HIV-1 Nef Protein	X	X
4953	Assignment of 1H, 13C and 15N resonances of the PPIase domain of the trigger factor from Mycoplasma genitalium	X	X
4954	1H, 13C and 15N chemical shifts assignments for the N-terminal domain of riboflavin synthase of E. Coli with riboflavin as a bound ligand	X	X
4955	NMR Structure of Cysteinyl-phosphorylated Enzyme IIB of the N,N'-diacetylchitobiose-specific Phosphoenolpyruvate-dependent Phosphotransferase System of Escherichia coli	X	X
4958	1H, 13C and 15N Sequence-specific Resonance Assignment of the PSCD4 Domain of Diatom cell wall Protein Pleuralin-1	X	X
4961	1H, 15N and 13C assignments of the N-terminal domain of Yersinia outer protein H in its apo form and in complex with a phosphotyrosine peptide representing the putative binding site on host protein target p130Cas	X	X
4964	1H, 13C and 15N resonance assignment for barnase	X	X
4966	1H and 13C Chemical Shift Assignments for Cardiotoxin A3 from Naja Atra at Neutral pH	X	X
4967	Letter to the Editor: Backbone resonance assignment of Mason-Pfizer Monkey Virus Protease	X	X
4969	Backbone 1H, 13C and 15N chemical shift assignments for the Brucella D4.4 VH antibody fragment	X	X
4970	NMR Relaxation data for Protein Calmodulin in complex with the smooth muscle myosin light chain kinase calmodulin binding domain	X	X
4971	NMR data for the Carp Granulin 1 3-30 subfragment	X	X
4972	1H, 13C, and 15N assignment of Crh, a protein involved in carbon catabolite repression in B. subtilis	X	X
4973	Sequential Assignment and Secondary Structure of Saratin, an Inhibitor of von Willebrand factor-dependent Platelet Adhesion to Collagen	X	X
4974	Rapid Protein fold Determination using Secondary Chemical Shifts and Cross- hydrogen bond 15N-13C' Scalar Couplings (3hbJNC')	X	X
4977	1H and 15N NMR assignments of the 7kd wheat lipid transfer protein	X	X
4978	NMR assignments for the Ca2+-bound B0 isoform of the C-terminal globular domain of agrin (agrin-G3)	X	X
4981	Identification of the phospholipid binding site of human beta2-glycoprotein I domain V by heteronuclear magnetic resonance	X	X
4983	Backbone 1H, 15N, 13C and side chain 13C assignment of YUH1-Ub in a 35 kDa complex	X	X
4984	The Solution Structure and Interactions of CheW from Thermotoga maritima	X	X
4985	Letter to the Editor: 1H, 13C, and 15N assignment of the flavodoxin-like domain of the Escherichia coli sulfite reductase	X	X
4989	Solution Structure of B.subtilis Acyl Carrier Protein	X	X
4990	Solution structure of betacellulin, a new member of EGF-family ligands.	X	X
4991	Identification of a novel archaebacterial thioredoxin: Determination of function through structure.	X	X
4992	Assignment of 1H, 13C and 15N NMR signals from the toluene 4-monooxygenase Rieske ferredoxin	X	X
4995	Solution NMR Structure and Folding Dynamics of the N-terminus of a rat Non-muscle Alpha-tropomyosin in an Engineered Chimeric Protein	X	X
4996	NMR-Based Structure of the Conserved Protein MTH865 from the Archea Methanobacterium thermoautotrophicum	X	X
4997	1H, 13C Chemical Shift Assignment of PT-insulin in H2O and 35% TFE	X	X
4999	Assignment of the 1H, 15N and 13C resonances of the nucleocapsid-binding domain of the Sendai virus Phosphoprotein	X	X
5000	1H, 15N and 13C Resonance Assignments for the N-Terminal Domain of the MAPK Phosphatase PAC-1	X	X
5004	1H, 13C, 13CO, and 15N Chemical Shift Assignments for human IL-13	X	X
5007	SOLUTION STRUCTURE OF THE VS RIBOZYME SUBSTRATE STEM-LOOP	X			X
5008	Assignment of 1H,13C and 15N backbone resonances of p13suc1 proteins -- wild type	X	X
5009	Assignment of 1H,13C and 15N backbone resonances of p13suc1 proteins -- PA90	X	X
5010	1H, 15N, and 13C chemical shift assignments for DNA polymerase X	X	X
5012	Gelatin-binding Region of Human Matrix Metalloproteinase-2: Solution Structure, Dynamics, and Function of the COL-23 Two-domain Construct	X	X
5013	1H, 15N and 13C Assignments of the Catalytic Domain of E6-associated Protein (E6AP)	X	X
5014	Sequence Specific Resonance Assignment of the Central Domain of Cardiac Myosin Binding Protein C (MyBP-C)	X	X
5019	1H, 13C and 15N Chemical Shift Assignments of the N-terminal PAS Domain of mNPAS2	X	X
5027	NMR Structure of Human Fibronectin EDA	X	X
5028	Solution Structure of MCOTI-II, a Macrocyclic Trypsin Inhibitor	X	X
5031	Sequence-specific 1H, 13C and 15N resonance assignments of the N-terminal, 135-residue domain of KaiA, a clock protein from Synechococcus elongatus	X	X
5038	Assignments for human ubiquitin-conjugating enzyme 2b (HsUbc2b)	X	X
5040	Backbone 1H, 15N, and 13C Resonance Assignments of Inhibitor-1--a Protein Inhibitor of Protein Phosphatase-1	X	X
5041	Solution structure and backbone dynamics of human DNA ligase IIIalpha BRCT domain	X	X
5042	1H, 13C, and 15N Chemical Shift Assignments for Human Lymphotactin	X	X
5044	1H, 13C, and 15N Chemical shift assignments for the third Immunoglobulin domain from the neural cell adhesion molecule, N-CAM	X	X
5047	NMR structure of the LCCL Domain and its Implications for DFNA9 Deafness Disorder	X	X
5048	1H and 15N assignments of rat apo cellular retinol-binding protein type I (CRBP-I)	X	X
5050	Solution structure of Bungarus fasciatus IX, a Kunitz-type chymotrypsin inhibitor	X	X
5051	Backbone 1H, 13C, and 15N and Side-Chain 1H Chemical Shift Assignments for MTH1692	X	X
5052	1H Assigned Chemical Shifts for Neurotoxin II	X	X
5053	Solution Structure of the Orphan PABC Domain from Saccharomyces cerevisiae Poly(A)-binding Protein	X	X
5054	The Structure of Ap4A Hydrolase Complexed with ATP-MgFx Reveals the Basis of Substrate Binding	X	X
5056	ATT an Arabidopsis thaliana Inhibitor of Trypsin and Chymotrypsin: Sequence-Specific Multinuclear Magnetic Resonance Assignments and Secondary Structure	X	X
5057	1H Chemical Shift Assignments for Alzheimer peptide Ab(1-40)	X	X
5058	Letter to the Editor: Sequence specific 1H, 13C and 15N resonance assignments of human GABA receptor associated protein	X	X
5059	Chemical shift assignments for EC005 from E. coli	X	X
5060	1H, 15N, 13C NMR Assignments of TM006 Protein from Thermotoga maritima	X	X
5061	1H, 13C, and 15N Chemical Shift Assignments for DNA-binding domain of ADR6	X	X
5064	Backbone 1H, 13C, and 15N resonance assignments for a 14 kD protein, GABAA receptor associated protein (GABARAP)	X	X
5065	Quail Cysteine and Glycine-rich Protein, NMR, 15 Minimized Model Structures	X	X
5067	Solution Structure of the Lipoyl Domain of the Chimeric Dihydrolipoyl Dehydrogenase P64K from Neisseria meningitidis	X	X
5070	Structure and dynamics of the anticodon-arm binding domain of Bacillus stearothermophilus tyrosyl-tRNA synthetase	X	X
5071	Complex of the C-Domain of Troponin C with Residues 1-40 of Troponin I	X	X
5072	CD3 Epsilon and gamma Ectodomain Fragment Complex in Single-Chain Construct	X	X
5075	Solution Structure of Human Apolipoprotein(a) Kringle IV type 6	X	X
5077	1H, 15N, 13C NMR Assignments of M156R Protein from myxoma virus, NESG target OP2	X	X
5078	Structure and Backbone Dynamics of a Lipoyl Domain from Human Mitochondrial Branched-Chain alpha-Ketoacid Dehydrogenase	X	X
5079	Backbone dynamics of the functional domain of Paracoccus denitrificans Cytochrome c552 in the Reduced state	X	X
5080	Backbone dynamics of the functional domain of Paracoccus denitrificans Cytochrome c552 in the Oxidized state	X	X
5081	1H, 15N and 13C resonance assignments for the Gallium protoporphyrin IX-HasAsm hemophore complex	X	X
5082	Solution Structure of a K(+)-Channel Blocker from the Scorpion Tityus cambridgei	X	X
5083	1H and 15N chemical shift assignments for human epidermal-type fatty acid-binding protein (E-FABP)	X	X
5084	1H and 15N Chemical Shift Assignments for the Complex of C-terminal Domain of Human Poly(A)-Binding Protein and 22-residue Fragment of Paip1	X	X
5085	1H, 13C, and 15N Chemical Shift Assignments for the Complex of the C-terminal Domain of Human Poly(A)-binding Protein and C-terminal Fragment of Paip2	X	X
5086	Reduced recombinant Hydrogenobacter thermophilus cytochrome c-552 expressed in E. coli periplasm	X	X
5087	Characterization of Hydrogenobacter thermophilus Cytochromes c(552) Expressed in the Cytoplasm and Periplasm of Escherichia coli	X	X
5088	Characterization of Hydrogenobacter thermophilus Cytochromes c(552) Expressed in the Cytoplasm and Periplasm of Escherichia coli	X	X
5089	Characterization of Hydrogenobacter thermophilus Cytochromes c(552) Expressed in the Cytoplasm and Periplasm of Escherichia coli	X	X
5092	1H chemical shift assignments for the cytoplasmic N-terminus of KCNMB2	X	X
5093	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for Ribosome-binding Factor A (RbfA)	X	X
5096	Solution Structure of a CCHH mutant of the ninth CCHC Zinc Finger of U-shaped	X	X
5097	1H Chemical Shift Assignments for Bucandin	X	X
5099	Backbone and side chain 1H, 13C, and 15N Chemical Shift Assignments for N-TIMP-1 in N-TIMP-1/MMP-3(E202Q) Complex	X	X
5100	1H, 15N and 13C Assignments of FLIN2, an Intramolecular LMO2:ldb1 Complex	X	X
5101	Structure and Properties of a Dimeric N-terminal Fragment of Human Ubiquitin	X	X
5102	A helical region in the C-terminus of small-conductance Ca2+-activated K+ channels controls assembly with apo-calmodulin	X	X
5103	1H, 13C and 15N resonance assignments of the calcium binding protein S100P	X	X
5104	An NMR Approach to Structural Proteomics	X	X
5105	An NMR Approach to Structural Proteomics	X	X
5106	An NMR Approach to Structural Proteomics	X	X
5107	Assignments of the 1H, 13C, and 15N resonances of the substrate-binding SSD domain from Lon protease	X	X
5114	Refined Structure and Metal Binding site of the Kalata B1 Peptide	X	X
5115	Solution structure of Pyrobaculum aerophilum DsrC, an archaeal homologue of the gamma subunit of dissimilatory sulfite reductase	X	X
5116	Solution Structure of Pyrobaculum Aerophilum DsrC/gamma subunit of dissimilatory sulfite reductase (reduced)	X	X
5117	Structural and Dynamic Differences of Rhodostomin, an RGD-containing Disintegrin, and its D51E mutant	X	X
5119	NMR Investigations of Subunit c of the ATP Synthase from Propionigenium modestum in Chloroform/methanol/water (4:4:1)	X	X
5120	1H Chemical Shift Assigments for the mEGF/TGFalpha44-50 chimeric growth factor	X	X
5121	In vivo Protein Cyclization Promoted by a Circularly Permuted Synechocystis sp. PCC6803 DnaB Mini-intein	X	X
5122	In vivo Protein Cyclization Promoted by a Circularly Permuted Synechocystis sp. PCC6803 DnaB Mini-intein	X	X
5127	Letter to the Editor: Chemical shift assignment and chemical shift indexing of murine apo-Mts1	X	X
5128	GABARAP, GABAA receptor associated protein	X	X
5129	1H, 13C, and 15N Chemical Shift Assignments for MTH1880	X	X
5130	Assignment of 1H, 13C and 15N resonances of Human Lysozyme at 35 C	X	X
5131	Structure, Dynamics and Binding Characteristics of the Second PDZ Domain of PTP-BL	X	X
5132	1H and 15N assignments of ATTm+4, a truncated version of ATT, an trypsin/chymotrypsin inhibitor from Arabidopsis thaliana	X	X
5141	Sequence-specific resonance assignments of the N-terminal, 105-residue KaiC-interacting domain of SasA, a protein necessary for a robust circadian rhythm in Synechococcus elongatus	X	X
5142	Assignment of 1H, 13C and 15N resonances of Human Lysozyme at 4 C	X	X
5143	NMR Structure of the Second Intracellular Loop of the alpha2A adrenergic receptor: evidence for a Novel Cytoplasmic Helix	X	X
5144	NMR Structure of the Second Intracellular Loop of the alpha2A adrenergic receptor: evidence for a Novel Cytoplasmic Helix	X	X
5145	NMR Structure of the human Doppel Protein	X	X
5147	NMR structure of the Cyanobacterial Metallothionein SmtA	X	X
5148	NMR Structure of the [2Fe-2S] Ferredoxin Domain from Soluble Methane Monooxygenase Reductase and Interaction with its Hydroxylase	X	X
5149	NMR Structure of the Second Intracellular Loop of the alpha2A adrenergic receptor: evidence for a Novel Cytoplasmic Helix	X	X
5150	NMR Structure of the Second Intracellular Loop of the alpha2A adrenergic receptor: evidence for a Novel Cytoplasmic Helix (T3-I2-T4)	X	X
5153	Backbone dynamics of the N-TIMP-1 bound to MMP-3 catalytic domain	X	X
5154	Backbone dynamics of free N-TIMP-1 in solution	X	X
5156	Partial assignment of the calcium-bound calretinin I-II domain (residues 1-100): 1H, 13C and 15N backbone assignments (and partial sidechain assignment) for structured elements	X	X
5159	Sequence-specific resonance assignment of the second Ran-binding domain of human RanBP2	X	X
5161	Characterization of the ATP-binding Domain of the Sarco(endo)plasmic Reticulum Ca (2+) -ATPase: Probing Nucleotide Binding By Multidimensional NMR	X	X
5162	1H, 13C, and 15N resonance assignments and secondary structure of the PWI domain from SRm160 using Reduced Dimensionality NMR	X	X
5165	Solution Structure of Methanobacterium Thermoautotrophicum Protein 1598	X	X
5166	Solution structure of hemolysin expression modulating protein Hha	X	X
5172	1H and 15N Chemical Shift Assignments of oxidized cytochrome c553 from B. pasteurii	X	X
5173	NMR structure of human Epiregulin	X	X
5177	Backbone and side-chain 1H, 13C, and 15N chemical shift assignments for chick cofilin	X	X
5178	Solution Structure of the Fibronectin type III Domain from Bacillus circulans WL-12 Chitinase A1	X	X
5179	Solution structure of N-terminal SH3 domain of Vav and the recognition site for Grb2 C-terminal SH3 domain	X	X
5182	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Extracellular Ligand-Binding Domain of Ionotropic Glutamate Receptor 2	X	X
5183	BetaCore, a designed water soluble four-stranded antiparallel b-sheet protein	X	X
5184	1H Chemical Shift Assignments for toxin BeKm from the Scorpion Buthus eupeus	X	X
5185	1H, 13C, and 15N resonance assignment of the vascular endothelial growth factor receptor-binding domain in complex with a receptor-blocking peptide	X	X
5186	1H, 13C, and 15N backbone assignment of the vascular endothelial growth factor receptor-binding domain	X	X
5187	Assignments of the 1H, 13C, and 15N resonances of TraR	X	X
5188	Solution structure of paralytic peptide of the silkworm, Bombyx mori	X	X
5189	1H, 15N and 13C resonance assignments of rabbit apo-S100A11	X	X
5190	Backbone NMR assignments of Ribosome Recycling Factors from Escherichia coli	X	X
5191	Backbone NMR assignments of Ribosome Recycling Factors from Thermotoga maritima	X	X
5196	Modified Peptide A (D18-A1) of the Rabbit Skeletal Dihydropyridine Receptor	X	X
5197	1H and 13CA chemical shift assignments of the polypeptide mPrP(143-158)	X	X
5198	1H, 13C, and 15N Chemical Shift Assignments for v107 in complex with vascular endothelial growth factor	X	X
5199	Assignment of the 1H and 15N resonances of the elicitor protein NIP1	X	X
5202	Assignment of the 1H, 13C and 15N resonances of the catalytic domain of the rat 2',3'-cyclic nucleotide 3'-phosphodiesterase	X	X
5203	1H, 13C, 15N chemical shift assignments for cysteine-rich domain of KSR	X	X
5204	1H, 13C and 15N chemical shift assignments for CRT(189-261)	X	X
5205	1H chemical shift assignemnts and coupling constants for CRT(221-256)	X	X
5206	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for Human S100B in Calcium-bound Form	X	X
5208	1H, 13C and 15N resonance assignments for the perdeuterated 22 kD palm-thumb domain of DNA polymerase B	X	X
5209	1H, 13C and 15N resonance assignments for the perdeuterated 22 kD palm-thumb domain of DNA polymerase B in complex with the XRCC1 N-terminal domain	X	X
5214	Y2 selective analogue-I of neuropeptide Y	X	X
5215	Y2 selective analogue-II of neuropeptide Y	X	X
5216	Y2 selective analogue-III of neuropeptide Y	X	X
5219	Base excision repair: NMR backbone assignments of Escherichia coli formamidopyrimidine-DNA glycosylase	X	X
5220	Solution Structure and dynamics of melanoma inhibitory activity protein	X	X
5221	Backbone 1H, 13C, and 15N resonance assignments for the C-Terminal Region of Ku86 (Ku86CTR)	X	X
5223	SH3 domain of human Lck tyrosine kinase	X	X
5225	Solution Structure of the Peptidyl-Prolyl-cis/trans-Isomerase Parvulin 10 of Escherichia coli	X	X
5226	Letter to the Editor: 1H, 15N and 13C resonance assignments and secondary structure determination of the Ssh10b from Hyperthermphilic Archaeon Sulfolobus shibatae	X	X
5227	Dissection of the Pathway of Molecular Recognition by Calmodulin	X	X
5228	Letter to the Editor: Assignment of a 15 kDa protein complex formed between the p160 coactivator ACTR and the CREB binding protein	X	X
5233	NMR assignment of human ASC2	X	X
5234	Backbone resonance assignment of the 2H,13C,15N labelled 32KDa Central Domain of Escherichia coli TyrR	X	X
5235	Resonance assignment and secondary structure determination of a C-terminal fragment of the Lupus Autoantigen (La) protein containing a putative RNA recognition motif (RRM)	X	X
5236	1H and 15N Chemical Shift Assignments for the tandem inactivation domain of Kv1.4 (RCK4(1-75))	X	X
5238	1H and 15N chemical shift assignments for the heparin-binding domain of vascular endothelial growth factor	X	X
5239	Sequential NMR assignment of the ferri-cytochrome c3 from Desulfovibrio vulgaris Hildenborough	X	X
5242	Solution Structure of the Prohormone Convertase 1 (PC1) Pro-Domain From Mus Musculus	X	X
5244	Backbone Assignment of Endonuclease V from Bacteriophage T4 with deuterium labeling	X	X
5246	Chiral Mutagenesis of Insulin's Hidden Receptor-Binding Surface: Structure of an Allo-isoleucine A2 Analogue	X	X
5247	Letter to the Editor: Sequence-specific chemical shift assignment of calcium-loaded murine S100A4	X	X
5248	NMR Solution Structure of the Isolated Apo Pin1 WW Domain: Comparison to the X-Ray Crystal Structures of Pin 1	X	X
5249	Backbone 1H, 13C and 15N chemical shifts for [Zn(II)/Zn(II)]Dx	X	X
5250	1H, 13C and 15N resonance assignment of the RNA-binding domain dimer form Bacillus subtilis transcriptional antiterminator GlcT	X	X
5251	Complete backbone and partial side chain 1H, 15N and 13C assignments for human lymphotactin at 45 C	X	X
5255	Ancestral beta/gamma-crystallin precursor structure in a yeast killer toxin	X	X
5257	Thymosin beta-9	X	X
5260	Pseudocontact chemical shifts for [Fe(II)/Fe(II)]Dx	X	X
5261	Nuclease A Inhibitor (NuiA) Assignments	X	X
5262	Backbone 1H and 15N Chemical Shift Assignements for the first fibronectin type II module of MMP-2 (col-1)	X	X
5263	Backbone 1H, 13C, 15N chemical Shift assignments fo the CBM28	X	X
5264	Solution Structure of Human beta-Defensin 3	X	X
5265	The solution structure of antibacterial peptide (Moricin) isolated from the silworm, Bombyx mori	X	X
5267	1H, 13C, 15N NMR sequencespecific resonance assignment of a Clostridium thermocellum type II cohesin module	X	X
5268	Structure of the Antimicrobial Peptide Tachystatin A	X	X
5270	Backbone 1H, 15N and 13C resonance assignments of YqgF, an Escherichia coli protein of unknown structure and function	X	X
5271	Pseudocontact chemical shifts for [Fe(II)/Zn(II)]Dx	X	X
5272	1H, 13C and 15N chemical shift assignments of Schistocerca gregaria chymotrypsin inhibitor	X	X
5273	1H chemical shift assignments for SGCI[L30R, K31M]	X	X
5274	1H Chemical shift assignments of Schistocerca gregaria trypsin inhibitor	X	X
5275	The rhesus rotavirus sialic acid binding domain without ligand	X	X
5278	PEMV-1 P1-P2 Frameshifting Pseudoknot Regularized Average Structure	X			X
5283	Proton Chemical Shift Assignments for Vpr(34-51) Peptide	X	X
5286	Backbone 1H, 13C, and 15N Chemical shift assigments for [13C,15N]CaM:CaMKIp complex	X	X
5287	Backbone 1H and 15N Chemical shift assigments for [2H,15N]CaM:CaMKI(320) complex	X	X
5288	Assignment of Backbone 1H, 13C, and 15N Resonances of Human Grb7-SH2 Domain in Complex with a Phosphorylated Peptide Ligand	X	X
5289	Investigation of Penetratin Peptides. Part 1: The Environment Dependent Conformational Properties of Penetratin and two of its Derivatives	X	X
5290	Investigation of Penetratin Peptides. Part 1: The Environment Dependent Conformational Properties of Penetratin and two of its Derivatives	X	X
5291	Investigation of Penetratin Peptides. Part 1: The Environment Dependent Conformational Properties of Penetratin and two of its Derivatives	X	X
5292	1H Chemical Shift Assignments for TC5b	X	X
5293	NMR Identification and Characterization of the Flexible Regions in the 160 KD Molten Globule-like Aggregate of Barstar at Low pH	X	X
5294	Structure of the beta subunit of translation initiation factor 2 from the archaeon Methanococcus jannaschii: A representative of the eIF2beta/eIF5 family of proteins	X	X
5295	1H Resonance Assignments at 310K and pH 4.93 for E.coli recombinant Brazzein, an Intensely Sweet Protein	X	X
5296	1H Resonance Assignments at 310K and pH 4.90 for E.coli recombinant Brazzein variant brazzein-ins(R18a-I18b), an Non-Sweet variant of Brazzein	X	X
5298	1H, 13C, and 15N Chemical Shift Assignments for the PPIase domain from E. coli trigger factor	X	X
5299	The Mad2 Spindle Checkpoint Protein Undergoes Similar Major Conformational Changes upon Binding to Either Mad1 or Cdc20	X	X
5300	Backbone 1H, 13C, and 15N Resonance Assignments for the 20.8 KDa C.elegans gene product ORF C32E8.3. Northeast Structural Genomics Consortium Target WR33.	X	X
5302	High-Resolution Structure and Localization of Amylin Nucleation Site in Detergent Micelles	X	X
5305	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the peptidyl-prolyl cis-trans isomerase Pin1	X	X
5306	1H, 13C, and 15N Chemical Shift Assignments for the HIF-1alpha CTAD/p300 CH1 Complex	X	X
5307	Basic Pancreatic Trypsin Inhibitor	X	X
5308	Solution Structure and Dynamics of the Human-Escherichia coli Thioredoxin Chimera: Insights into Thermodynamic Stability	X	X
5309	1H, 15N and 13C assignments of FLIN4, an intramolecular LMO4:ldb1 complex	X	X
5312	1H, 13C and 15N chemical shift assignments of aIF2beta from Methanobacterium themoautotrophicum	X	X
5313	Sequence-specific resonance assignment of the rat Gap Junction 43 kDa carboxyl terminal domain	X	X
5314	Assignment of 1H, 13C, and 15N Resonances of the SH2 Domain of Human Grb14 and Chemical Shift Changes upon Binding a phosphorylated decapeptide	X	X
5315	1H, 13C and 15N chemical shift assignment for ribosome-associated factor Y	X	X
5319	1H and 15N assignments of rat holo cellular retinol-binding protein type I (CRBP-I)	X	X
5320	1H and 15N Chemical Shift Assignments for Human B-FABP	X	X
5322	Solution Structure of g-Bungarotoxin, an RGD-Containing Neurotoxin	X	X
5325	1H Chemical Shift Assignments for nsLTP2 from Rice	X	X
5327	Structural basis for Hif-1alpha/CBP recognition in the cellular hypoxic response	X	X
5328	Solution NMR structure of the BRCT domain from Thermus thermophilus DNA ligase	X	X
5329	Backbone and Side Chain 1H, 13C, and 15N chemical shift assignments for conserved eukaryotic protein ZK652.3 from C. elegans	X	X
5330	Backbone relaxation data of rat apo cellular retinol-binding protein type I (CRBP-I)	X	X
5331	Backbone relaxation data of rat holo cellular retinol-binding protein type I (CRBP-I)	X	X
5332	1H, 13C, and 15N Chemical Shift Assignments for E85Q recoverin	X	X
5333	Redox-Coupled Conformational Alternations in Cytochrome c3 from D. vulgaris Miyazaki F on the Basis of its Reduced Solution Structure	X	X
5334	Backbone 1H, 13C, and 15N resonance assignments and secondary structure of the D54A mutant of HTLV-I capsid protein	X	X
5335	Backbone and side chain 1H, 13C, and 15N chemical shift assignments for E.coli protein YacG	X	X
5337	Complete assignments of 1H, 13C and 15N Chemical Shifts for Oxidized Human Adrenodoxin (4-114)	X	X
5338	Integrin EGF-like module 3 from the beta-2 subunit	X	X
5339	NMR minimized average structure of d(CGTACG)2	X		X
5340	Solution Structure for BID, and Intracellular Amplifier of Apoptotic Signaling	X	X
5343	1H, 13C, 15N Assignment of Neocarzinostatin Apo-Protein	X	X
5344	1H, 15N Assignment of Neocarzinostatin Apo-Protein Bound to a Synthetic Chromophore	X	X
5345	Assignment of lac repressor headpiece complexed of its natural operator	X	X	X
5346	Solution Structure of a Novel Disintegrin, Salmosin from Agkistrondon halys Venom	X	X
5347	Solution Structure of the RNase H Domain of the HIV-1 Reverse Transcriptase in Presence of Magnesium	X	X
5348	Solution structure of ascidian trypsin inhibitor determined by nuclear magnetic resonance spectroscopy	X	X
5349	PBX Homeodomain-DNA complex	X	X	X
5350	1H, 15N, and 13C resonance assignments of low molecular weight human cytoplasmic protein tyrosine phosphatase-A (HCPTP-A)	X	X
5352	1H, 13C and 15N resonance assignment of Bacillus agaradhaerens xylanase	X	X
5353	1H, 15N and 13C resonance assignments of yeast Saccharomyces cerevisiae calmodulin in the Ca2+-free state	X	X
5354	Structure and Interactions of PAS kinase N-terminal PAS domain: Model for intramolecular kinase regulation	X	X
5355	Backbone resonance assignments of the 25kD N-terminal ATPase domain from the Hsp90 chaperone	X	X
5356	Backbone and sidechain chemical shift assignments for GS-a3W protein	X	X
5357	1H, 13C, and 15N Chemical Shift Assignments for tm1112	X	X
5363	1H, 13C, and 15N Chemical shifts for hERR2 Protein, 1H chemical shifts for DNA	X	X	X
5364	Structure of the C-terminal FG-binding domain of human Tap	X	X
5366	SOLUTION STRUCTURE OF THE VAM7P PX DOMAIN	X	X
5368	Backbone 1H, 13C, and 15N Chemical Shift Assignments for hARF1	X	X
5372	Solution Structure Of Reduced Horse Heart Cytochrome c in 30% Acetonitrile Solution	X	X
5374	Assignment of 1H and 15N resonances and secondary structure of the recombinant RicC3 of 2S albumin storage protein from ricinus communis	X	X
5376	C-terminal peptide of alpha-subunit of transducin	X	X
5377	Assignments of 1H, 13C and 15N resonances of human Ca2+-S100B in complex with the TRTK-12 peptide	X	X
5378	NMR Structure of a Variant Human Prion Protein with Two Disulfide Bridges	X	X
5379	Bovine Pancreatic Polypeptide Bound to DPC Micelles	X	X
5382	1H, 13C, and 15N backbone resonance assignment of the C-terminal domain of EPSP synthase	X	X
5383	The CXCR3 binding chemokine IP-10/CXCL10: Structure and receptor interactions	X	X
5384	Binding of the first ferric ion to glycine-extended gastrin is essential for biological activity	X	X
5386	1H, 13C, 15N Chemical Shift Assignments of cNTnC and cTnI(147-163) in the cNTnC-cTnI(147-163)-Bepridil Ternary complex	X	X
5387	Complete 1H, 13C, and 15N chemical shifts for human recombinant ubiquitin in reverse micelles	X	X
5388	1H,13C and 15N resonance assignments of gads c-terminal SH3 domain in complex with a peptide of SLP76	X	X
5389	1H, 13C and 15N assignments for the cold shock response protein Yfia	X	X
5390	1H,13C and 15N Chemical Shifts Assignments for the Oligomerization Domain of H-NS	X	X
5394	Sculpting of the Eukaryotic Branch Site Recognition Motif by a Conserved Pseudouridine	X			X
5395	Chemical Shift Assignments for the Unmodified Branch Site Helix	X			X
5396	NMR-based solution structure of the complex of Lactobacillus casei dihydrofolate reductase with trimethoprim and NADPH	X	X
5398	Backbone and side chain 1H, 13C, and 15N chemical shift assignments for 3-methyladenine DNA glycosylase I (TAG) from Escherichia coli	X	X
5399	Conservation of chemical shift and secondary structure of the PNT/SAM domains from the Ets family of transcription factors	X	X
5400	Selection of D-amino-acid peptides that bind to Alzheimer's disease amyloid peptide abeta 1-42 by mirror image phage display	X	X
5401	Conservation of chemical shift and secondary structure of the PNT/SAM domains from the Ets family of transcription factors	X	X
5402	1H, 15N and 13C resonance assignments of the SH2 domain of Bruton's tyrosine kinase	X	X
5403	Backbone resonance assignments of the 91 kDa oligomeric TRAP protein from Bacillus staerothermophilus in complex with L-tryptophan	X	X
5404	Backbone and Side Chain assignments of Peptide Deformylase complexed with Actinonin	X	X
5405	STRUCTURE OF SYNTHETIC 26-MER PEPTIDE CONTAINING 145-169 SHEEP PRION PROTEIN SEGMENT AND C-TERMINAL CYSTEINE IN TFE SOLUTION	X	X
5408	1H, 13C, and 15N Chemical Shift Assignments for DFF-C domain of DFF45/ICAD	X	X
5409	Backbone Chemical Shift Assignments for 2H, 13C, 15N-labeled Human PTB1 Protein	X	X
5410	Solution structure of novel non-RGD containing short disintegrin by high resolution NMR	X	X
5411	pKa determinations for OMTKY3	X	X
5412	pKa determinations for P2'-Lys OMTKY3	X	X
5413	pKa determinations for P2'-His OMTKY3	X	X
5414	pKa determinations for P2'-Glu OMTKY3	X	X
5415	pKa determinations for P2'-Asp OMTKY3	X	X
5416	pKa determinations for P3'-Ala OMTKY3	X	X
5417	pKa determinations for P3'-Asp OMTKY3	X	X
5418	pKa determinations for P3'-Glu OMTKY3	X	X
5419	pKa determinations for P3'-His OMTKY3	X	X
5420	pKa determinations for P3'-Lys OMTKY3	X	X
5421	pKa determinations for P1'-Asp OMTKY3	X	X
5422	pKa determinations for P1'-His OMTKY3	X	X
5423	pKa determinations for P1'-Lys OMTKY3	X	X
5424	pKa determinations for P1-Asp OMTKY3	X	X
5425	pKa determinations for P1-Glu OMTKY3	X	X
5426	pKa determinations for P1-Gly OMTKY3	X	X
5427	pKa determinations for P1-Ala OMTKY3	X	X
5428	pKa determinations for P1-His OMTKY3	X	X
5429	pKa determinations for P1-Lys OMTKY3	X	X
5430	pKa determinations for P2-Asp OMTKY3	X	X
5431	pKa determinations for P2-Glu OMTKY3	X	X
5432	pKa determinations for P2-Val OMTKY3	X	X
5433	pKa determinations for P2-His OMTKY3	X	X
5434	pKa determinations for P2-Lys OMTKY3	X	X
5435	pKa determinations for P4-Asp OMTKY3	X	X
5436	pKa determinations for P4-Glu OMTKY3	X	X
5437	pKa determinations for P4-His OMTKY3	X	X
5438	pKa determinations for P4-Lys OMTKY3	X	X
5439	pKa determinations for P4-Asp OMTKY3 (not salt added)	X	X
5440	pKa determinations for P5-Asp OMTKY3	X	X
5441	pKa determinations for P5-Glu OMTKY3	X	X
5442	pKa determinations for P5-His OMTKY3	X	X
5443	pKa determinations for P6-Asp OMTKY3	X	X
5444	pKa determinations for P6-Glu OMTKY3	X	X
5445	pKa determinations for P6-His OMTKY3	X	X
5446	pKa determinations for P2-Val,P3'-Ala OMTKY3	X	X
5447	pKa determinations for P8-Phe,P6-Asp OMTKY3	X	X
5448	pKa determinations for OMTKY3 (no salt added)	X	X
5449	pKa determinations for P5-His OMTKY3 (no salt added)	X	X
5450	pKa determinations for P4-Glu OMTKY3 (no salt added)	X	X
5451	pKa determinations for AAPD	X	X
5452	pKa determinations for AAPE	X	X
5453	pKa determinations for AAPK	X	X
5454	NMR solution structure and dynamics of motilin in isotropic phospholipid bicellar solution	X	X
5455	1H, 13C and 15N resonance assignments of the human phosphatase PRL-3	X	X
5456	1H, 13C, and 15N resonances assignment for the von Willebrand factor A3 domain	X	X
5457	Complete 1H Chemical Shift Assignment of a 24-residue Sin Interacting Domain of hMad1	X	X
5458	Backbone 1H, 13C, and 15N assignments of the ribosome recycling factor from Thermus thermophillus	X	X
5459	High precision NMR structure of RING-H2 finger domain of EL5, a rice gene in response to N-acetylchitooligosaccahride elicitor	X	X
5461	Chemical shift assignments Itk SH2 domain, conformation corresponding to cis and trans proline 287	X	X
5467	1H,15N and 13C resonance assignments of the SH3-like domain of the human ADAP protein	X	X
5468	Backbone 1H, 13C, 15N and Cb chemical shift assignments for 6-phosphogluconolactonase from Trypanosoma brucei	X	X
5469	Inhibitory Specificity Change of Ovomucoid Third Domain of Silver Pheasant upon Introduction of an Engineered Cys14-Cys39 Bond	X	X
5470	Inhibitory Specificity Change of Ovomucoid Third Domain of Silver Pheasant upon Introduction of an Engineered Cys14-Cys39 Bond	X	X
5472	Solution Structures of the Two Stable Conformers of Turkey Ovomucoid that Coexist at Low pH	X	X
5473	Solution Structures of the Two Stable Conformers of Turkey Ovomucoid that Coexist at Low pH	X	X
5475	Homology predicted structure and comparison with the secondary structure from NMR data for plastocyanin from the cyanobacterium synechocystis sp. PCC 6803	X	X
5476	Structures of phage-display peptides that bind to the malarial surface protein, apical membrane antigen 1, and block erythrocyte invasion	X	X
5477	Structures of phage-display peptides that bind to the malarial surface protein, apical membrane antigen 1, and block erythrocyte invasion	X	X
5478	Structures of phage-display peptides that bind to the malarial surface protein, apical membrane antigen 1, and block erythrocyte invasion	X	X
5479	Structures of phage-display peptides that bind to the malarial surface protein, apical membrane antigen 1, and block erythrocyte invasion	X	X
5480	1H,15N and 13C assigned Chemical Shifts for a complex of calmodulin with a peptide of the olfactory CNGC channel	X	X
5481	Backbone and side chain 1H, 13C, and 15N chemical shift assignments for S. cerevisae Hub1	X	X
5482	Assignment of 1H, 13C and 15N resonances of the N-terminal microtubule-binding domain of human doublecortin	X	X
5483	NMR structure of AmpD, an N-acetylmuramyl-L-alanine amidase.	X	X
5484	Backbone NMR assignments of the metal-free UreE from Bacillus pasteurii	X	X
5486	Backbone and 1H assignments for Tachyplesin I, wild type	X	X
5487	Backbone and 1H assignments for Tachyplesin I, tyrosine mutant	X	X
5488	Backbone and 1H assignments for Tachyplesin I, phenylalanine mutant	X	X
5489	Backbone and 1H assignments for Tachyplesin I, alanine mutant	X	X
5490	Sequence-specific 1H, 13C, 15N Resonance Assigments of the Major Cherry Allergen Pru av 1 Mutant E45W	X	X
5491	Structural basis for new pattern of the conserved amino acid residues related to chitin-binding in the antifungal peptide from the coconut rhinoceros beetle, Oryctes rhinoceros	X	X
5493	Letter to the Editor: Backbone 1H, 15N and 13C resonance assignments of the Staphylococcus aureus acyl carrier protein synthase (AcpS)	X	X
5494	NMR Structure of PW2 Bound to SDS Micelles: A Tryptophan-rich Anticocidial Peptide Selected from Phage Display Libraries	X	X
5495	1H chemical shift assignments for Psalmotoxin 1	X	X
5496	NMR structure of ubiquitin-like domain in Parkin: Gene product of familial Parkinson's disease	X	X
5497	1H, 15N, 13C resonance assignments of the carboxy-terminal domain of the transmembrane electron transfer protein DsbD	X	X
5499	The PDZ7 of Glutamate Receptor Interacting Protein Binds to its Target via a Novel Hydrophobic Surface Area	X	X
5504	1H, 13C and 15N chemical shift assignments of the SH2 domain of the Csk homologous kinase	X	X
5505	Backbone Dynamics of Reduced Plastocyanin from the Cyanobacterium Anabaena variabilis: Regions Involved in Electron Transfer have Enhanched Mobility	X	X
5506	Resonance assignments of the central complement control protein module pair of human decay accelerating factor	X	X
5507	Native State Hydrogen Exchange Study of Suppressor and Pathogenic Variants of Transthyretin	X	X
5508	Native State Hydrogen Exchange Study of Suppressor and Pathogenic Variants of Transthyretin	X	X
5509	Native State Hydrogen Exchange Study of Suppressor and Pathogenic Variants of Transthyretin	X	X
5510	Native State Hydrogen Exchange Study of Suppressor and Pathogenic Variants of Transthyretin	X	X
5511	Backbone 1H, 13C, and 15N resonance assignments for the 21 kDa GTPase Rac1 complexed to GDP and Mg2+	X	X
5515	1H, 13C and 15N resonance assignment of the Dishevelled DIX domain	X	X
5517	NMR studies of the DNA-binding domain of B-Myb	X	X	X
5518	Role of backbone dynamics and structure in controlling the hydrolysis constants of serine proteinase inhibitors	X	X
5519	Role of backbone dynamics and structure in controlling the hydrolysis constants of serine proteinase inhibitors	X	X
5520	Role of backbone dynamics and structure in controlling the hydrolysis constants of serine proteinase inhibitors	X	X
5521	Role of backbone dynamics and structure in controlling the hydrolysis constants of serine proteinase inhibitors	X	X
5522	Letter to Editor: 1H, 15N and 13C resonance assignments of the repeated domain of human beta ig-h3	X	X
5523	Conformational Features of Human Melanin-Concentrating Hormone: a NMR and Computational Analysis	X	X
5532	Structure of the Tsg101 UEV Domain in Complex with a HIV-1 PTAP "Late Domain" Peptide	X	X
5534	Global structure and dynamics of human apolipoprotein CII in complex with micelles: evidence for increased mobility of the helix involved in the activation of lipoprotein lipase	X	X
5535	NMR structure of R3H domain	X	X
5536	1H, 13C, and 15N Chemical Shift Assignments for G88W110 fragment of Staphylococcal Nuclease	X	X
5538	1H, 13C, and 15N Chemical Shift Assignments for a PWWP domain from Sch. pombe	X	X
5539	Solution Structure and Stability of the Full-Length Excisionase (Xis) from Bacteriophage HK022	X	X
5540	1H, 13C and 15N assignment of the hydroquinone form of flavodoxin from Desulfovibrio vulgaris (Hildenborough)	X	X
5541	1H and 15N Chemical Shift Assignments of Lm-FABP	X	X
5544	1H, 13C, and 15N resonance assignments for S100B(beta beta)-Ca2+-TRTK-12 peptide complex	X	X
5547	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Streptopain	X	X
5548	Bovine Pancreatic Polypeptide (bPP) undergoes significant changes in conformation and dynamics upon binding to DPC micelles	X	X
5551	Homonuclear chemical shift assignment for LEKTI domain 6 (HF7665)	X	X
5554	Structure of the N-WASP EVH1 Domain-WIP complex	X	X
5558	Sp100b SAND domain chemical shift assignments	X	X
5560	NMR assignment of the conserved hypothetical protein TM1290 of Thermotoga maritima	X	X
5562	NMR conformational study of proposed quadruplex hexanucleotide d(CCGCGG)2 in solution	X		X
5563	Assignment of backbone 1H, 13C and 15N resonances of ParG, a protein required for active partition of bacterial plasmids	X	X
5564	1H, 13C and 15N resonance assignment of kinase-interacting FHA domain of Arabidopsis kinase associasted protein phosphatase	X	X
5565	Backbone 1H, 13C, and 15N Chemical Shift Assignments for porcine MSP	X	X
5568	A new member of the split bab fold: Solution structure of the protein encoded by the YML108W open reading frame from Saccharomyces cerevisiae	X	X
5570	1H, 13C, and 15N NMR assignments of the hypothetical Nudix protein DR0079 from the extremely radiation-resistant bacterium Deinococcus radiodurans	X	X
5571	1H, 13C and 15N assignment of the oxidized form of flavodoxin from Desulfovibrio vulgaris (Hildenborough)	X	X
5572	Beta-helix structure and ice-binding properties of a hyperactive antifreeze protein from an insect	X	X
5573	Spruce budworm Antifreeze Protein: Changes in Structure and Dynamics at Low Temperature	X	X
5580	NMR solution structure of type-B lantibiotics mersacidin bound to lipid II in DPC micelles	X	X
5581	NMR solution structure of type-B lantibiotics mersacidin in MeOH/H2O mixture	X	X
5582	NMR solution structure of type-B lantibiotics mersacidin in DPC micelles	X	X
5583	NMR structure of P41icf, a potent inhibitor of human cathepsin L	X	X
5585	Isolation, structure and activity of GID, a novel alpha4/7-conotoxin with an extended N-terminal sequence	X	X
5586	Molecular Recognition in Purine-Rich Internal Loops: Thermodynamic, Structural, and Dynamic Consequences of Purine for Adenine Substitutions in 5'(rGGCAAGCCU)2	X			X
5587	Molecular Recognition in Purine-Rich Internal Loops: Thermodynamic, Structural, and Dynamic Consequences of Purine for Adenine Substitutions in 5'(rGGCAAGCCU)2	X			X
5588	Molecular Recognition in Purine-Rich Internal Loops: Thermodynamic, Structural, and Dynamic Consequences of Purine for Adenine Substitutions in 5'(rGGCAAGCCU)2	X			X
5589	Backbone and side chain 1H, 13C, and 15N chemical shift assignments for V. cholerae VC0424	X	X
5590	1H, 13C and 15N resonance assignments of rice telomere binding domain from Oryza sativa	X	X
5591	Sequence specific assignment of part of the myosin binding site of myosin binding protein C	X	X
5594	Structural insights into the U-box, a domain associated with multi-ubiquitination	X	X
5595	Letter to the Editor: 1H, 13C, 15N backbone resonance assignments of apo-NosL, a novel 18.5 kDa copper(I) binding protein from the nitrous oxide reductase gene cluster of Achromobacter cycloclastes	X	X
5596	Solution Structure of the hypothetical protein yggU from E. coli. Northeast Structural Genomics Consortium Target ER14.	X	X
5597	Structure and dynamics of reduced Bacillus pasteurii cytochrome c: oxidation state dependent properties and implications for electron transfer processes	X	X
5598	1H, 13C and 15N backbone resonance assignments of domain 1 of receptor associated protein	X	X
5599	The Tertiary Structure and Backbone Dynamics of Human Prolactin: Evidence for Reversible Oligomerization in Solution	X	X
5600	Complete 1H,13C,15N assignments of zinc Clostridium pasteurianum rubredoxin	X	X
5601	Complete 1H,13C,15N assignments of zinc Pyrococcus furiosus rubredoxin	X	X
5602	Complete resonance assignments for the nudix hydrolase DR2356 of Deinococcus radiodurans	X	X
5603	Chemical shift assignment for human proguanylin	X	X
5604	Solution structure of the N-terminal domain of ZntA in the apo- and Zn(II) forms	X	X
5605	Sequence-specific 1H, 13C and 15N resonance assignments of SAM22, an allergenic stress-induced protein from soy bean	X	X
5607	NMR Structure of the Extended Second Transmembrane Domain of the Human Neuronal Glycine Receptor alpha1 Subunit in SDS Micelles	X	X
5609	NMR structure of [Ala1,15]kalata B1	X	X
5610	The Structure of the Carboxyl Terminus of Striated alpha-Tropomyosin in Solution Reveals an Unusual Parallel Arrangement of Interacting alpha-Helices	X	X
5612	Structure of the Plant Defensin PhD1 from Petunia Hybrida	X	X
5613	A minimal beta-hairpin peptide scaffold for beta-turn display	X	X
5614	Sheared A(anti)-A(anti) Pairs in a Destabilizing 2x2 Internal Loop: The NMR Structure of 5'(rGGCAAGCCU)2	X			X
5615	1H/13C/15N assignment of the C-terminal domain of the E. amylovora response regulator RcsB	X	X
5618	Backbone 1H, 13C, 15N and Side Chain 13C Chemical Shift Assignments for DFPase from Loligo vulgaris	X	X
5619	Resonance assignments for the methionine sulfoxide reductase B from Bacillus subtilis, Northeast Structural Genomics Consortium target SR10	X	X
5620	Assignment for ribosomal protein S28E	X	X
5621	Assignment for yoag_ecoli	X	X
5623	Assignments of 1H, 15N and 13C resonances of the proline-rich matrix protein of Moloney Murine Leukemia Virus (MA Mo-MuLV)	X	X
5624	A Conserved Structural Motif at the N-terminal of Bacterial Translation Initiation Factor IF2	X	X
5626	1H 13C and 15N backbone resonance assignments of the N-terminal domain of Drosophila GCM protein	X	X
5627	1H, 15N, 13C Resonance Assignments of the LpxC Deacetylase from Aquifex aeolicus in Complex with the Substrate-Analog Inhibitor TU-514	X	X
5628	1H, 15N and 13C resonance assignments of the highly conserved 19kDa C-terminal domain from human Elongation Factor 1Bgamma	X	X
5629	1H, 13C, and 15N resonance assignments and topology of MTH187, a conserved protein from Methanobacterium thermoautotrophicum	X	X
5630	1H 13C and 15N Assigned Chemical Shifts for ER75, an NESG target	X	X
5633	The solution structure of molt-inhibiting hormone from the kuruma prawn	X	X
5634	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS1	X		X
5635	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS2	X		X
5636	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS3	X		X
5637	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS4	X		X
5638	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS5	X		X
5639	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS6	X		X
5640	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS7	X		X
5641	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS8	X		X
5642	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS9	X		X
5643	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS10	X		X
5644	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS11	X		X
5645	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS12	X		X
5646	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS13	X		X
5647	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS14	X		X
5648	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS15	X		X
5649	Random Coil Proton and Carbon Chemical Shifts of Deoxyribonucleic Acids SS16	X		X
5650	NMR structure of the ribosomal protein L23 from Thermus Thermophilus	X	X
5651	Txk SH3 domain backbone assignments	X	X
5652	1H Chemical Shift Assignments for CnErg1	X	X
5653	The solution structure of molt-inhibiting hormone from the kuruma prawn Marsupenaeus japonicus	X	X
5656	Resonance Assignments for the Z Domain of Staphylococcal Protein A using a 2H, 13C, 15N enriched, selective methyl protonated sample	X	X
5657	NMR structure for VT212	X	X
5658	Sequence specific backbone assignment of 13C, 2H, 15N labeled ISG15	X	X
5660	Partial proton resonance assignements for the different conformers of ferricytochrome c produced in 30% acetonitrile and 70% water solution	X	X
5661	Rapid backbone 1H, 13C, and 15N assignment of the V1 domain of human PKC iota using the new program IBIS	X	X
5662	Distinctive solution conformation of phosphatase inhibitor CPI-17 substituted with aspartate at the phosphorylation site threonine	X	X
5663	Distinctive solution conformation of phosphatase inhibitor CPI-17 substituted with aspartate at the phosphorylation site threonine	X	X
5664	Full 1H and 15N Chemical Shift Assignments for Oxytetracycline Acyl Carrier Protein	X	X
5665	ClpX Zinc Binding Domain	X	X
5666	1H, 15N and 13C backbone assignment of the Green Fluorescent Protein (GFP)	X	X
5667	Solution structure of the first zinc-finger domain from ZNF265	X	X
5668	Backbone and side chain 1H, 13C, and 15N chemical shift assignments for Zinc-containing 3-methyladenine DNA glycosylase I (TAG) from Escherichia coli	X	X
5669	Structure and Ubiquitin Interactions of the Conserved NZF Domain of Npl4	X	X
5670	Structural Characterization of Hellethionins from helleborus purpurascens	X	X
5676	1H chemical shifts of Pi4, a four disulfide bridged scorpion toxin active on potassium channels	X	X
5677	1H, 13C, and 15N assignment of the Focal Adhesion Targeting Domain of Focal Adhesion Kinase	X	X
5678	1H, 15N, and 13C assigned Chemical shift for HNF-6a	X	X
5679	1H, 13C and 15N chemical assignment of xylan-binding domain from Streptomyces olivaceoviridis E-86 beta-xylanase	X	X
5680	Letter to the Editor: Sequence-specific assignment and secondary structure determination of the 195-residue complex formed by the Mycobacterium tuberculosis proteins CFP-10 and ESAT-6. Towards an understanding of their role in tuberculosis pathogenesis	X	X
5682	Solution Structure of 30S Ribosomal Protein S27E from Archaeoglobus Fulgidus: RS27_ARCFU: a novel fold	X	X
5683	QR6 structure	X	X
5685	1H, 15N, and 13C Assignments and CSI Analysis of a 18kDa Complex Formed by the Carboxyl-Terminal Domains of RAP74 and FCP1	X	X
5687	Stably folded de novo proteins from a designed combinatorial library	X	X
5688	Backbone 1H, 13C, and 15N Chemical Shifts Assignment for the all-trans conformer of the cathelin-like domain of the protegrin-3 precursor	X	X
5689	1H, 13C, and 15N backbone assignments of the pheromone binding protein from the silk moth Antheraea polyphemus (ApolPBP)	X	X
5690	1H, 13C, and 15N Chemical Shift Assignments for Cobra Neurotoxin II	X	X
5691	Solution Structure of the 30S ribosomal protein S28E from Pyrococcus horikoshii. Northeast Structural Genomics Consortium target JR19	X	X
5692	Structural and functional insights into PINCH LIM4 domain-mediated integrin signaling	X	X
5693	Backbone chemical shift assignments of Grb2 complexed with ligand peptides for SH3 and SH2 domains	X	X
5694	10-residue folded peptide designed by segment statistics	X	X
5695	Solution Structure of the Product of the S. Cerevisiae YHR087W Gene, Northeast Structural Genomics Consortium target YTYst425	X	X
5696	1H, 15N and 13C resonance assignments of the PDZ domain of ZASP	X	X
5697	1H and 15N resonance assignments of the PDZ domain of ZASP in complex with the EF hand domains of alpha-actinin-2	X	X
5698	Backbone and Side-chain 1H, and 15N Chemical Shift Assignments for TcPABC	X	X
5700	Backbone 1H, 13C and 15N resonance assignments for the 25.8 kDa DNA binding domain of the human p63 protein	X	X
5701	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the catalytic GEF domain of Salmonella SopE2	X	X
5702	1H, 13C, and 15N Chemical Shift Assignments for Omega-atracotoxin-Hv1a at pH 6.0	X	X
5706	Antibiotic binding domain of a TipA-class multidrug resistance transcriptional regulator	X	X
5707	Sequence-specific 1H, 13C and 15N resonance assignments of the birch pollen allergen Bet v 4	X	X
5708	Solution structure of the N-terminal membrane anchor of E. coli enzyme IIA(Glucose)	X	X
5709	1H, 15N and 13C resonance assignments of the TPR domain of hSGT	X	X
5710	Structure and interactions of Mth11: A homologue of human RNase P protein Rpp29	X	X
5711	Solution Structure of HP0371, Biotin Carboxyl Carrier protein from Helocobacter pylori	X	X
5712	Backbone resonance assignment for human eIF4E in complex with m7GDP and a 17-amino acid peptide derived from human eIF4G	X	X
5713	Influence of pH on NMR structure and stability of the human prion protein globular domain	X	X
5714	1H Chemical shift assignments of the major conformation of a 11-mer DNA duplex containing an AG Mismatch	X		X
5715	Paramagnetic relaxation enhancements of the amide protons in HHP-tagged thioredoxin	X	X
5716	CHEMICAL SHIFTS OF THE CK14 DNA DUPLEX: A PORTION OF THE KNOWN NF-kB SEQUENCE CK1	X		X
5717	NMR STRUCTURE OF THE CK14 DNA DUPLEX: A PORTION OF THE KNOWN NF-kB SEQUENCE CK1	X		X
5718	Chemical Shifts for the XBY2 DNA Duplex	X		X
5719	Resonance assignment and secondary structure of an N-terminal fragment of the human La protein	X	X
5722	Chemical Shift Assignmens of Ca2+/C-terminal Domain of Caltractin (1H, 13C, and 15N) in Complex with the Cdc31p-Binding Domain from Kar1p (1H)	X	X
5723	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Brazzein	X	X
5724	Backbone 1H, 13C, and 15N Chemical Shift Assignments for R43A Brazzein	X	X
5725	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Ala2ins Brazzein	X	X
5726	Backbone 1H, 13C, and 15N Chemical Shift Assignments for D50A Brazzein	X	X
5727	Backbone 1H, 13C, and 15N Chemical Shift Assignments for H31A Brazzein	X	X
5728	Backbone 1H, 13C, and 15N Chemical Shift Assignments for R33A Brazzein	X	X
5729	Solution Structure, Dynamics and Thermodynamics of the Native State Ensemble of the Sem-5 C-terminal SH3 Domain	X	X
5730	1H Chemical Shift Assignments for a DNA Duplex with N6-Deoxyadenosine Adduct of (9S,10R)-9,10-Epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene	X		X
5731	1H Chemical Shift Assignments for SCR3 peptide (18-34)	X	X
5732	1H Chemical Shift Assignments for SCR3 peptide (18-54)	X	X
5733	1H Chemical Shift Assignments for SCR3 peptide (34-54)	X	X
5734	1H Chemical Shift Assignments for SCR3 peptide (27-33)	X	X
5735	The Solution Structure of Rat Ab-(1-28) and its Interaction with Zinc: Insights into the Scarity of Amyloid Deposition in Aged Rat Brain	X	X
5736	Sequence specific resonance assignments of ICln, an ion channel cloned from epithelial cells	X	X
5740	Backbone 1H, 13C and 15N Chemical shift assignments for the ternary DHFR:FOLATE:NADP+ complex	X	X
5741	Backbone 1NH, 13C and 15N Chemical shift assignments for the ternary DHFR:FOLATE:DHNADPH complex	X	X
5742	Solution structure of soluble domain of Sco1 from Bacillus Subtilis	X	X
5743	Backbone 1H, 13C and 15N Chemical Shift Assignments for the extracellular domain of b-dystroglycan (654-750)	X	X
5744	Backbone Assignments of folded alpha-synuclein	X	X
5745	NMR Structure of bovine cytochrome b5	X	X
5747	Solution structure of a four-helix bundle model, apo-DF1	X	X
5748	Assignment of 1H, 13C, and 15N Resonances of the ARID Domain of P270	X	X
5749	Isolation, gene expression and solution structure of a novel moricin analogue, an antibacterial peptide from a lepidopteran insect, Spodoptera litura	X	X
5750	1H, 13C, and 15N Chemical Shift Assignments for the extracellular domain of BR3	X	X
5752	1H, 13C and 15N backbone resonance assignment of the Integrin alpha2 I-domain	X	X
5754	1H, 13C and 15N backbone resonance assignment of the VASP EVH1 domain	X	X
5755	Assignment of Human Phosphatase Regenerating Liver 2 (PRL-2)	X	X
5756	Resonance Assignments for the 21 kDa engineered fluorescein-binding lipocalin FluA	X	X
5758	1H, 13C and 15N chemical shift assignments for YqgF	X	X
5759	A model for effector activity in a highly specific biological electron transfer complex: The cytochrome P450cam-putidaredoxin couple	X	X
5760	1H, 13C, and 15N backbone assignment of the first two Ig domains Z1Z2 of the giant muscle protein titin	X	X
5761	1H, 13C and 15N Chemical Shift Assignments for Gamma-Adaptin Ear Domain	X	X
5762	The alternatively spliced PDZ2 domain of PTP-BL, PDZ2as	X	X
5763	1H, 15N and 13C resonance assignments of the hypothetical protein SAV1595 from Staphylococcus aureus	X	X
5764	1H, 13C and 15N Chemical Shift Assignments for the Nuclear Factor ALY RBD Domain	X	X
5771	Solution Structure of the disulphide-linked dimer of human intestinal trefoil factor (TFF3): the intermolecular orientation and interactions are markedly different from those of other dimeric trefoil proteins	X	X
5772	Backbone 1H, 13C and 15N chemical shifts of CBM13 from Streptomyces lividans	X	X
5773	Solution structure of HIV-1 Stem Loop SL1	X			X
5774	Recognition of GU-rich polyadenylation regulatory elements by human CstF-64 protein	X	X
5776	sPrODN1:RNA [5'-R(AAAGGAGGA)-3'/5'-D(CXXXXXX)-3']	X		X	X
5777	PODN:RNA [5'-R(AAAGGAGGA)-3'/5'-D(XXXXXXX)-3']	X		X	X
5778	1H, 15N and 13C chemical shift assignment of the Pleckstrin Homology domain of the Protein kinase B (PKB/Akt)	X	X
5781	The Solution Structure of a DNA.RNA Duplex Containing 5-Propynyl U and C Comparison with 5-Me Modifications	X		X	X
5785	Global Orientation of Bound MMP-3 and N-TIMP-1 in Solution via Residual Dipolar Couplings	X	X
5786	Solution Structure of Neural Cadherin Prodomain	X	X
5787	1H, 13C and 15N resonance assignments and secondary structure of the cytotoxic protein RNase 3 from oocytes of bullfrog Rana catesbeiana	X	X
5788	Structural basis for negative regulation of hypoxia-inducible factor-1alpha by CITED2	X	X
5789	1H,15N, and 13C chemical shift assignments of the Escherichia coli nitrogen regulatory phosphocarrier IIANtr	X	X
5790	Solution structure of the Hypothetical protein AQ_1857 from Aquifex aeolicus: Northeast Structural Genomics Consortium Target QR6	X	X
5792	Assignment of the 1H, 15N and 13C resonances of E. coli frataxin orthologue, CyaY	X	X
5793	Backbone 1H, 15N, 13C and side chain 13Cb assignment of a 42 kDa RecR homodimer	X	X
5794	1H, 13C, 15N Chemical Shift Assignments for the SH3-SH2 domain pair of the tyrosin kinase Lck	X	X
5797	Solution structure of the hypothetical protein TA1414 from Thermoplasma acidophilum	X	X
5798	Solution structure of Protein yrbA from Escherichia Coli: Northeast Structural Genomics Consortium target ER115	X	X
5799	Protein Signal Assignments using Specific Labeling and Cell-free Synthesis	X	X
5800	Sequence-specific 1H, 13C, 15N resonance assignments of the carboxyterminal domain of the transcription factor NusA from E.coli	X	X
5801	Structural analysis of an EGF/TGF-alpha chimera with unique ErbB binding specificity	X	X
5802	1H, 13C and 15N Backbone Resonance assignments for the water soluble domain of ferric rat liver outer mitochondrial membrane cytochrome b5	X	X
5803	Three-disulfide variant of hen lysozyme: C64A/C80A	X	X
5804	Three-disulfide variant of hen lysozyme: C76A/C94A	X	X
5805	NMR Structure of an Archaeal Homologue of RNase P Protein Rpp29	X	X
5806	Solution structure of the recombinant Penaeidin-3, a shrimp antimicrobial peptide	X	X
5807	Letter to the Editor: Assignments of 1H and 15N resonances of the bacteriophage lambda capsid stabilizing protein gpD	X	X
5809	1H Chemical Shift Assignments for the cyanomet complex of the isolated alpha-chain from human hemoglobin A	X	X
5810	1H, 15N and 13C resonance assignment of staphostatin A, a specific Staphylococcus aureus cysteine proteinase inhibitor	X	X
5811	1H Chemical Shift Assignments for quasi-repetitive arginine/glycine/ tyrosine-rich domains within glycine-rich RNA binding proteins	X	X
5812	1H Chemical Shift Assignments for quasi-repetitive arginine/glycine/ tyrosine-rich domains within glycine-rich RNA binding proteins	X	X
5814	The C-terminal domain of Viral IAP associated factor (cVIAF) is a structural homolog of phosducin: Resonance assignments and secondary structure of the C-terminal domain of VIAF	X	X
5816	Backbone 1H, 13C, and 15N Chemical Shift Assignment of The Dimer Yeast Peroxiredoxin YLR109w	X	X
5817	NMR Structure of a Prototype LNR Module from Human Notch1	X	X
5818	The solution structure of YbcJ from E. coli reveals a recently discovered alfaL motif involved in RNA-binding	X	X
5819	Complete 1H, 15N and 13C assignment of the soluble domain of the ba3 oxidase subunit II of Thermus thermophilus in the reduced state	X	X
5824	Sequence-specific 1H, 13C and 15N resonance assignments of the C-terminal domain of KaiA, a circadian clock protein (oxidized form)	X	X
5825	Sequence-specific 1H, 13C and 15N resonance assignments of the C-terminal domain of KaiA, a circadian clock protein (reduced form)	X	X
5826	Nickel-binding property of Bacillus pasteurii UreE and the role of the C-terminal tail	X	X
5827	Backbone and sidechain heteronuclear resonance assignments and hyperfine nuclear magnetic resonance shifts in horse cytochrome c	X	X
5828	Backbone and sidechain heteronuclear resonance assignments and hyperfine nuclear magnetic resonance shifts in horse cytochrome c	X	X
5829	Backbone and sidechain heteronuclear resonance assignments and hyperfine nuclear magnetic resonance shifts in horse cytochrome c	X	X
5830	Backbone and sidechain heteronuclear resonance assignments and hyperfine nuclear magnetic resonance shifts in horse cytochrome c	X	X
5833	1H, 13C, and 15N Chemical Shift Assignments for Mob1	X	X
5834	Solution structure of the HIV-1 frameshift inducing stem-loop RNA	X			X
5835	The Solution Structure and Dynamics of Recombinant Onconases	X	X
5837	Structure of a peptide derived from the voltage gated Na+ channel and its selective interaction with local anesthetic as determined by NMR spectroscopy	X	X
5839	Characterization of the overall and local dynamics of a protein with intermediate rotational anisotropy: Differentiating between conformational exchange and anisotropic diffusion in the B3 domain of protein G	X	X
5841	15N T1 and T2 relaxation rates, 1H{15N} NOE, and Hydrogen/Deuterium exchange data of kinase-interacting FHA domain of Arabidopsis kinase associasted protein phosphatase	X	X
5842	Backbone and side chain 1H, 13C, and 15N chemical shift assignments for Haemophilus influenza protein IR24	X	X
5843	Solution Structure of At3g17210	X	X
5845	Backbone and side chain 1H, 13C, and 15N chemical shift assignments for S. aureus protein MW2441 / SACOL2532. Northeast Structural Genomics Target ZR31.	X	X
5846	1H, 13C, and 15N Chemical Shift Assignments for Hypothetical protein NMA1147: the Northeast Structural Genomics Consortium Target MR19	X	X
5847	Backbone and sidechain 1H, 13C, and 15N chemical shifts for Sda	X	X
5848	Solution structure of S8-SP11	X	X
5850	Kinetic and Structural Studies of the Low Moleuclar Weight Protein Tyrosine Phosphatase from Tritrichomonas foetus	X	X
5852	NMR Structure of the Active Conformation of the Varkud Satellite Ribozyme Cleavage Site	X			X
5857	NMR assignment of human Sip(7-50)	X	X
5860	Structure of Subtilosin A, an Antimicrobial Peptide from Bacillus subtilis with Unusual Post-translational Modifications Linking Cysteine Sulfurs to alpha-Carbons of Phenylalanine and Threonine	X	X
5861	Backbone resonance assignments of GTPase domain of E.coli MnmE	X	X
5862	Assignments of death domain of TRADD	X	X
5863	Backbone HN, N, Ca, C and Cb chemical shift assignments and Secondary Structure of FkpA, a 245-residue peptidyl- prolyl cis/trans isomerase with chaperone activity	X	X
5864	Neurokinin B	X	X
5868	Solution structure of XPC binding domain of hHR23B	X	X
5869	Solution Conformation of alphaA-Conotoxin EIVA	X	X
5871	Sequence-specific 1H, 13C and 15N resonance assignments of Ara h 6, an allergenic 2S albumin from peanut	X	X
5873	Backbone and side chains 1H, 13C, and 15N Chemical Shift Assignments for BlaI-NTD	X	X
5874	Complete backbone resonance assignments of p47: the 41kDa adaptor protein of the AAA ATPase p97	X	X
5876	Complete backbone resonance assignments of p47: the 41kDa adaptor protein of the AAA ATPase p97	X	X
5878	1H, 13C and 15N NMR assignment of the region 1463-1617 of mouse p53 Binding Protein 1 (53BP1)	X	X
5879	Structure of a Type IVb pilin from Salmonella typhi and its assembly into pilus	X	X
5881	Structural basis for tetrodotoxin-resistant sodium channel binding by mu-conotoxin SmIIIA	X	X
5883	How C-Terminal Carboxyamidation Alters the Biological Activity of Peptides from the Venom of the Eumenine Solitary WasP	X	X
5885	CHEMICAL SHIFTS OF A FUSED DOCKING DOMAIN FROM THE ERYTHROMYCIN POLYKETIDE SYNTHASE (DEBS), A MODEL FOR THE INTERACTION BETWEEN DEBS 2 AND DEBS 3	X	X
5886	Backbone 1H, 13C and 15N Chemical Shift Assignments for TF1 bata subunit	X	X
5887	1H, 15N and 13C assignments for nuclear transport factor 2 (NTF2)	X	X
5888	Backbone 1H, 15N, CA and CB assignments for the W7A mutant of rat nuclear transport factor 2 (NTF2)	X	X
5889	1H assignments for yeast nucleoporin Nsp1 residues 528-557	X	X
5890	The NMR-derived Solution Structure of a New Cationic Antimicrobial Peptide from the Skin Secretion of the Anuran Hyla punctata	X	X
5891	1H, 15N and 13C NMR Assignments and Secondary Structure of a Hyperthermophile DNA-binding Protein Predicted to contain an Extended Coiled Coil Domain	X	X
5892	1H, 13C and 15N NMR Assignments of the Hyperthermophile Sulfolobus Protein Sso10b2 and its Predicted Secondary Structure	X	X
5893	Unusual Ca2+-calmodulin binding interactions of the microtubule-associated protein F-STOP	X	X
5894	1H, 13C, and 15N resonance assignments for the N-terminal domain of Drosophila Stem-Loop Binding Protein	X	X
5896	Unusual Ca2+-calmodulin binding interactions of the microtubule-associated protein F-STOP	X	X
5897	Solution Structure of the BHRF1 Protein From Epstein-Barr Virus, a Homolog of Human Bcl-2	X	X
5899	NMR Solution Structure of BeF3-Activated Spo0F, 20 conformers	X	X
5902	1H, 13C, and 15N Resonance Assignments of the Hath-Domain of Hepatoma-derived Growth Factor	X	X
5904	NMR study of inhibitor-1a - a protein inhibitor of protein phosphatase-1	X	X
5905	Backbone 15N and 1HN Chemical Shift Assignments for Sac7d	X	X
5906	1H, 15N, and 13C resonance Assignments of DARPP-32 (dopamine and cAMP-regulated phosphoprotein, Mr. 32,000) -A Protein Inhibitor of Protein Phosphatase-1	X	X
5907	Assignment of 1H, 13C and 15N Resonances of the Human Ku80 C-terminal Domain	X	X
5908	Backbone 1HN and 15N Chemical Shift Assignments for Sac7d V30I	X	X
5909	Backbone 1HN and 15N Chemical Shift Assignments for Sso7d	X	X
5910	Backbone 1HN and 15N Chemical Shift Assignments for Sso7d I30V	X	X
5912	The 3D solution structure of the C-terminal region of Ku86	X	X
5913	NMR SOLUTION STRUCTURE OF CN12, A NOVEL ALPHA-SCORPION TOXIN FROM CENTRUROIDES NOXIUS, SHOWING THE IMPORTANCE OF SURFACE CHARGE DISTRIBUTION FOR NA+-CHANNEL AFINITY.	X	X
5914	NMR structure of Methionine-Enkephalin in fast tumbling Bicelles/DMPG	X	X
5916	How C-Terminal Carboxyamidation Alters the Biological Activity of Peptides from the Venom of the Eumenine Solitary WasP	X	X
5917	Backbone 1HN, 13C, 15N Chemical Shift Assignments for human eIF2alpha	X	X
5918	Multiple time-scale dynamics of homologous thermophilic and mesophilic ribonuclease HI enzymes	X	X
5919	The solution structure of the loop E region of the 5S rRNA from spinach chloroplasts	X			X
5920	1H, 13C and 15N backbone and side-chain chemical shift assignments of PrrA effector domain from R. sphaeroides	X	X
5921	NMR assignment of TM1442, a putative anti-sigma-factor antagonist from Thrmotoga maritima	X	X
5922	Solution Structure of the HERG K+ channel S5-P extracellular linker	X	X
5923	Backbone 1H, 13C, and 15N Chemical Shift Assignments for T22G mutant of N-terminal SH3 domain of the Drosophila protein drk	X	X
5924	NMR Solution Structure of the Focal Adhesion Targeting Domain (FAT) of Focal Adhesion Kinase (FAK) in Complex with a Paxillin LD Peptide: Evidence for a Two Site Binding Model	X	X
5925	Solution structure of the N-terminal SH3 domain of Drk (drkN SH3 domain)	X	X
5926	Residual Dipolar Couplings of rubredoxin	X	X
5929	NMR assignment of the hypothetical rhodanase domain At4g01050 from Arabidopsis thaliana	X	X
5930	Backbone 1H, 15N, 13C Resonance Assignment of a-ADT	X	X
5931	Dynamics of the RNase H Domain of HIV-1 Reverse Transcriptase in the Presence of Magnesium and AMP	X	X
5934	13C and 15N Chemical Shift Assignments for f-MLF-OH	X	X
5935	Sequence-specific 1H, 13C and 15N resonance assignments of rat liver fructose-2,6-bisphosphatase domain	X	X
5936	Backbone 1H, 15N, 13C Resonance Assignment of b-ADT	X	X
5937	1H, 13C and 15N Chemical Sift Assignments for PDZ2b domain of PTP-Bas (hPTP1E)	X	X
5939	Backbone and sidechain assignment of murine Spred2 EVH1 domain	X	X
5940	1H, 15N and 13C backbone assignment of the carboxyl terminal domain of the cytokine binding module of the interleukin-6 receptor (IL-6R)	X	X
5944	A Zinc Clasp Structure Tethers Lck to T Cell Coreceptors CD4 and CD8	X	X
5945	A Zinc Clasp Structure Tethers Lck to T Cell Coreceptors CD4 and CD8	X	X
5946	Complete Resonance assignments of a donor-strand complemented AfaD: the afimbrial invasin from Diffusely Adherent E. coli	X	X
5947	Complete resonance assignments of a 'donor strand complemented' AfaE-III: the afimbrial adhesin from Diffusely Adherent E. coli	X	X
5948	Structure Analysis of Integrin alpha IIb beta 3 - Specific Disintegrin with the AKGDWN Motif	X	X
5949	Structure Analysis of Integrin alpha IIb beta 3 - Specific Disintegrin with the AKGDWN Motif	X	X
5950	1H, 15N and 13C resonance assignment for the Escherichia coli cell division activator CedA	X	X
5953	Sequential Resonance Assignments of the Extracellular Domain of the Human TGFB type II Receptor in Complex with Monomeric TGFB3	X	X
5954	Sequential Resonance Assignments of the Extracellular Domain of the Human TGFB type II Receptor in Complex woth Monomeric TGFB3	X	X
5955	Backbone and sidechain assignment of human VASP EVH2 domain	X	X
5958	1H, 13C and 15N resonance assignments of human microtubule-associated protein light chain-3	X	X
5959	Structure of human Ki67 FHA domain and its binding to a phosphoprotein fragment from hNIFK reveal unique recognition sites and new views to the structural basis of FHA domain functions	X	X
5966	Solution structures of the C-terminal headpiece subdomains of human villin and advillin, evaluation of headpiece F-actin binding requirements	X	X
5969	Solution Structure of holo-Neocarzinostatin	X	X
5970	Solution Structure of Ribosomal Protein L18 from Bacillus stearothermophilus	X	X
5971	Letter to the Editor: Backbone and side chain resonance assignments of domain III of tick-borne Langat flavivirus Envelope protein	X	X
5972	Proton Chemical Shifts for E coli ProP 468-497 peptide	X	X
5973	Solution Structure of Dengue Virus Capsid Protein Reveals a New Fold	X	X
5974	Assignment of the 1H, 13C and 15N resonances of the catalytic domain of guanine nucleotide exchange factor BopE from Burkholderia pseudomallei	X	X
5975	1H and 15N chemical shift assignments for the N-domain of trout cardiac troponin C at 30 and 7 C	X	X
5976	1H-, 13C- and 15N-NMR assignment of the conserved hypothetical protein TM0487 from Thermotoga maritima	X	X
5977	NMR for Structural Proteomics of Thermotoga maritima: Screening and Sructure Determination	X	X
5978	Structure and function of the membrane domain of hepatitis C virus nonstructural protein 5A	X	X
5981	1H, 15N and 13C resonance assignments of human dihydrofolate reductase in its complex with trimethoprim and NADPH	X	X
5982	Complete 1H, 13C and 15N assignments of a monomeric, biologically active apolipoprotein E carboxyl-terminal domain	X	X
5983	1H, 13C and 15N resonance assignments of human 5-10-methenyltetrahydrofolate synthetase	X	X
5984	1H and 15N chemical shift assignments for FtsN 243-319	X	X
5985	Solution Conformation of alpha-Conotoxin GIC, a Novel Potent Antagonist of alpha3beta2 Nicotinic Acetylcholine Receptors	X	X
5986	Solution structure of paralytic peptide of the wild Silkmoth, Antheraea yamamai	X	X
5987	Interaction of the TAZ1 domain of CREB-binding protein with the activation domain of CITED2: Regulation by competition between intrinsically unstructured ligands for non-identical binding sites	X	X
5988	1H Chemical Shift Assignments of alpha-bungarotoxin/nicotinic acetilcholine receptor mimotope complex	X	X
5989	Cytotoxin I from the venom of the Central Asian cobra Naja Oxiana, in aqueous solution	X	X
5991	Backbone and Sidechain 1H, 13C, and 15N Chemical Shift Assignments and Backbone 15N Relaxation Parameters for Murine Ets-1 deltaN301	X	X
5993	1H shifts for the DNA duplex containing 5-hydroxy Uracil lesion	X		X
5994	Solution structure of Human Orexin-A:Regulator of Appetite and Wakefulness	X	X
5995	Temperature Dependent Spectral Density Analysis Applied to Monitoring Backbone Dynamics of Major Urinary Protein-I Complexed with the Pheromone 2-sec-Butyl-4,5-dihyrothiazole	X	X
5996	Temperature Dependent Spectral Density Analysis Applied to Monitoring Backbone Dynamics of Major Urinary Protein-I Complexed with the Pheromone 2-sec-Butyl-4,5-dihyrothiazole	X	X
5997	Improving the Accuracy of NMR Structures of Large Proteins Using Pseudocontact Shifts as Long-range Restraints	X	X
5998	1H, 15N and 13C resonance assignments of the ApaG/CorD protein of the phytopathogen Xanthomonas axonopodis pv. citri	X	X
6000	1H, 13C and 15N Resonance Assignments of the Drosophila Argonaute1 PAZ Domain	X	X
6002	Structure of the C-terminal domain of p63	X	X
6004	1H, 13C, 15N assignments of human Cofilin	X	X
6005	Structural Basis for Recognition of the mRNA Class II AU-Rich Element by the Tandem Zinc Finger Domain of TIS11d	X	X		X
6007	1H, 13C and 15N resonance assignment of the Plasminogen Kringle 4 Binding Calcium Free Form of the C-type Lectin-like Domain of Tetranectin	X	X
6008	1H, 13C and 15N resonance assignment of the Calcium Bound Form of the C-type Lectin-like Domain of Tetranectin	X	X
6010	High-Resolution NMR Structure of the Conserved Hypothetical Protein TM0979 from Thermotoga maritima	X	X
6011	Solution structure of a homodimeric hypothetical protein, At5g22580, a structural genomics target from Arabidopsis Thaliana	X	X
6012	Human Sgt1 binds to HSP90 through the CS domain and not the TPR domain	X	X
6013	1H, 13C and 15N resonance assignments of the third spectrin repeat of alpha-actinin-4	X	X
6015	Sequence specific assignment of C1 domain of human cardiac myosin binding protein C	X	X
6016	Backbone resonance assignments of the 45.3 kDa catalytic domain of human BACE1	X	X
6017	Study on structure-activity relationship of S100C/A11 protein	X	X
6018	Study on structure-activity relationship of S100C/A11 protein	X	X
6019	Solution structure of Archaeon DNA-binding protein ssh10b P62A mutant	X	X
6020	Structure-activity relationships for the beta-hairpin cationic antimicrobial peptide polyphemusin I	X	X
6021	Backbone 1H, 15N and 13C assignments for the subunit a of the E.coli ATP Synthase	X	X
6022	Second Metal Binding Domain of the Menkes ATPase	X	X
6023	1H, 15N, and 13C Resonance Assignments of Calmodulin Complexed with the Calmodulin-Binding Domain of Protein Phosphatase 2B	X	X
6024	1H, 13C and 15N backbone resonance assignment for TEM-1, a 28.9 kDa beta-lactamase from E. coli	X	X
6025	1H, 13C, 15N resonance assignments of the cytokine LECT2	X	X
6026	Chemical Shift Assignments for Oxidized Human Ferredoxin	X	X
6027	NMR Solution Structure of PIIIA toxin, NMR, 20 structures	X	X
6028	Northeast Structural Genomics Consortium Target TT802 Ontario Center for Structural Proteomics Target Mth0803 assignment of ribosomal protein S17E	X	X
6029	1H, 13C and 15N resonance assignment of the nucleotide binding domain of KdpB from Escherichia coli	X	X
6030	1H, 13C and 15N resonance assignment of the nucleotide binding domain of KdpB from Escherichia coli	X	X
6033	NMR characterisation shows that a b-type variant of Hydrogenobacter thermophilus cytochrome c552 retains its native fold	X	X
6034	1H, 15N, 13C resonance assignments and 15N-1H residual dipolar couplings in 27 kDa alpha-adaptin ear-domain	X	X
6035	1H, 13C and 15N assignments for human DNA ligase III 1-117	X	X
6038	NMR Structure of CXC Chemokine CXCL11/ITAC	X	X
6042	NMR structure of the 30mer stemloop-D of coxsackieviral RNA	X			X
6044	Resonance assignment and secondary structure of the La motif	X	X
6045	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Hypothetical protein PF0455	X	X
6046	1H, 13C and 15N resonance assignments for domain III of the West Nile Virus envelope protein	X	X
6047	1H, 15N, and 13C resonance assignment of the 23 kDa organomercurial lyase MerB in the free form	X	X
6048	NEW STRUCTURAL FAMILY OF AN ANTIMICROBIAL PEPTIDE DERIVED FROM BOVINE HEMOGLOBIN	X	X
6049	Solution Structure of Human alpha-Parvalbumin (Minimized Average Structure)	X	X
6050	Solution structure of Sso7d mutant (K12L), NMR, 4 structures	X	X
6051	1H, 13C and 15N resonance assignments for methionine sulfoxide reductase B from Neisseria gonorroeae	X	X
6052	Backbone and side chain 1H, 13C, and 15N chemical shift assignments for Haemophilus human protein HR969	X	X
6053	1H, 13C and 15N resonance assignments of the N-terminal 16kDa domain of Escherichia coli Ada Protein	X	X
6054	1H, 13C and 15N resonance assignments of the methylated N-terminal 16kDa domain of Escherichia coli Ada Protein	X	X
6055	1H, 13C, and 15N resonance assignment of the 23 kDa organomercurial lyase in its free and mercury-bound forms	X	X
6056	Yeast oligosaccharyltransferase subunit Ost4p	X	X
6057	Sequence-specific resonance assignments of the tandem SH3 domains in autoinhibitory form of p47phox	X	X
6058	1H, 13C and 15N Assignments for the Hypothetical Archaeglobus fulgidis protein AF2095. Northeast Structural Genomics Consortium target GR4	X	X
6059	Ras-induced losing of interaction between C1 and RBD domains of Nore1	X	X
6060	1H, 13C, and 15N Chemical Shift Assignments for a complex of PDZ2 from PTP-BL with the C-terminus of APC (adenomatous polyposis coli)	X	X
6061	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the N-terminal 69 Amino Acid Residues of the ColE9 T1-61-DNase Fusion Protein	X	X
6066	Structure-Activity Relationships in a Sodium Channels Inhibitor Hainantoxin-Iv	X	X
6067	Structure-Activity Relationships in a Sodium Channels Inhibitor Hainantoxin-Iv	X	X
6069	Chemical Shift Assignments for Precarnobacteriocin B2	X	X
6070	Solution Structure of Endothelin-1 with its C-terminal Folding	X	X
6072	Solution structure of human p53 binding domain of PIAS-1	X	X
6073	A functional SOD-like protein in Bacillus subtilis	X	X
6074	Backbone 1H, 13C and 15N resonance assignments for the 29kD Pseudomonas aeruginosa dimethylarginine dimethylaminohydrolase involved in nitric oxide synthase regulation	X	X
6076	Loop B RNAs from the Stem-Loop IV domain of the Enterovirus Internal Ribosome Entry Site with a Six-nucleotide Bulge AUCCCU	X			X
6077	Loop B RNAs from the Stem-Loop IV domain of the Enterovirus Internal Ribosome Entry Site with a Six-nucleotide Bulge AUUCCU	X			X
6078	IA3, an Aspartic Proteinase Inhibitor for Saccharomyces cerevisiae, Is Intrinsically Unstructured in Solution	X	X
6079	1H, 13C and 15N resonance assignment of the reduced form of thioredoxin h1 from Poplar, a plant CPPC active site variant	X	X
6081	1H, 13C and 15N chemical shift assignment of fly troponin C	X	X
6082	Structure in solution of SFA8, a Albumin 2S from Sunflower seeds	X	X
6084	NMR structure of a variant 434 repressor DNA-binding domain devoid of hydroxyl groups	X	X
6085	Solution Structure of hybrid white striped bass hepcidin	X	X
6086	1H, 13C and 15N assignments of the tandem WW domains of human MAGI-1/BAP-1	X	X
6087	Conformation and Ion-Channeling activity of the hepatitis C virus p7 polypeptide	X	X
6090	1H, 13C and 15N resonance assignement of the reduced form of methionine sulfoxide reductase A from Escherichia coli	X	X
6091	1H, 13C, and 15N Chemical Shift Assignments for a complex of PDZ2 from PTP-BL with the C-terminus of p75 (NTR)	X	X
6092	1H, 13C, and 15N Chemical Shift Assignments for a complex of PDZ2 from PTP-BL with the C-terminus of RIL (reversion induced LIM)	X	X
6094	NMR structure of the 101 nucleotide core encapsidation signal of the moloney murine leukemia virus	X			X
6095	Solution structure of the KIX domain of CBP bound to the transactivation domain of c-Myb	X	X
6096	The solution structure of the pH-induced monomer of dynein light chain LC8 from Drosophila	X	X
6097	Proton chemical shift assignments for human spliceosomal protein U1C zinc finger domain	X	X
6102	Solution structure of conserved protein YbeD from E. coli	X	X
6108	Solution structure of GlgS protein from E. coli	X	X
6110	solution structure of a chimeric LEKTI-domain	X	X
6111	1H, 13C and 15N resonance assignments of the antifreeze protein cfAFP-501 from spruce budworm at different temperatures	X	X
6114	1H, 13C and 15N resonance assignment of the C-terminal BRCT domain from human BRCA1	X	X
6115	Structural and Functional Analysis of a picornaviral Internal cis-acting replication element	X			X
6116	Backbone 1H, 13C and 15N resonance assignment of the N-terminal domain of human eRF1	X	X
6117	1H,13C,15N assignments for ChaB	X	X
6118	1H, 13C and 15N assignments of poplar phloem glutaredoxin	X	X
6120	Backbone 1H, 13C, and 15N Chemical Shift Assignments for NESG target CcR19	X	X
6122	1H/13C/15N assignment of the S1 domain of RNase E of E. coli	X	X
6123	1H chemical shift assignments for truncated hevein of 32 aa bound to N,N',N''-triacetylchitotriose	X	X
6125	1H, 13C, 15N chemical shift assignments of an enolase-phosphatase E1 from Klebsiella oxytoca	X	X
6127	Solution structure of the E. coli bacteriophage P1 encoded HOT protein: a homologue of the theta subunit of E. coli DNA polymerase III	X	X
6128	Structure of At3g01050.1, a ubiquitin-fold protein from Arabidopsis thaliana	X	X
6131	Solution structure of oxidized bovine microsomal cytochrome B5 Mutant V45H	X	X
6132	Letter to the Editor: 1H, 13C and 15N NMR assignment of the homodimeric poplar phloem peroxiredoxin	X	X
6133	1H, 13C, and 15N Chemical Shift Assignments for YojN-HPt	X	X
6134	THE NMR STRUCTURE OF A STABLE AND COMPACT ALL-beta-SHEET VARIANT OF INTESTINAL FATTY ACID-BINDING PROTEIN	X	X
6135	Solution structure of conotoxin MrVIB	X	X
6136	Backbone Resonance Assignment of the L-Arabinose Binding Protein in Complex with D-Galactose	X	X
6137	NMR solution structure of proBnIb of 2S albumin stortage proton from Brassica napus	X	X
6138	Hypothetical protein At2g24940.1 from Arabidopsis thaliana has a cytochrome b5 like fold	X	X
6139	Solution Structure of Ole e 6, an allergen from olive tree pollen	X	X
6140	1H, 13C and 15N backbone assignment of a 32 kDa hypothetical protein from Arabidopsis thaliana, At3g16450.1	X	X
6143	1H and 15N assignments for human apolipoprotein C-II in DPC micelles	X	X
6144	The pyrophosphate cage: the structure of the nisin/lipid II complex provides a blueprint for novel antibiotics	X	X
6145	The pyrophosphate cage: the structure of the nisin/lipid II complex provides a blueprint for novel antibiotics	X	X
6146	The pyrophosphate cage: the structure of the nisin/lipid II complex provides a blueprint for novel antibiotics	X	X
6147	1H, 15N, and 13C chemical shift assignments of the Vibrio Harveyi histidine phosphotransferase protein LuxU	X	X
6150	1H, 15N and 13C resonance assignments of the Apo Sm14-M20(C62V) protein from Schistosoma mansoni	X	X
6152	Solution structure of TIP-B1	X	X
6154	1H Assigned Chemical Shifts for FMBP-1 tandem repeat 3	X	X
6155	1H Assigned Chemical Shifts for FMBP-1 tandem repeat 4	X	X
6156	1H Assigned Chemical Shifts for FMBP-1 tandem repeat 1 in 30% (v/v) TFE and water solution	X	X
6157	1H Assigned Chemical Shifts for FMBP-1 tandem repeat 2	X	X
6158	NMR solution structure of human Saposin C in the presence of detergent micelles	X	X
6167	Structural studies on the Ca-binding domain of human nucleobindin (CALNUC)	X	X
6173	PfR48 final project	X	X
6174	Backbone and sidechain 1H, 13C and 15N chemical shift assignments of the ThKaiA180C-CIIABD complex	X	X
6176	Solution structure of a ubiquitin-like domain of tubulin-folding cofactor B	X	X
6179	Solution Structure of the structured part of the 15th domain of LEKTI	X	X
6180	Solution structure of the 15th domain of LEKTI	X	X
6182	Backbone assignments and 15N spin-relaxation rates of Holo-FluA(R95K)	X	X
6183	Backbone 1H, 13C, and 15N Chemical Shift Assignments for cAMP-dependent protein kinase	X	X
6184	Model for the Catalytic Domain of the Proofreading Epsilon Subunit of E.coli DNA Polymerase III Based on NMR Structural Data	X	X
6186	Structure of DNA sequence d-TGATCA by two-dimensional nuclear magnetic resonance spec and restrained molecular dynamics	X		X
6187	BACKBONE SOLUTION STRUCTURE OF MIXED ALPHA/BETA PROTEIN PF1061	X	X
6191	Structure of the C-Terminal Domain of the SecA ATPase	X	X
6192	1H, 13C, and 15N Chemical Shift Assignments for Omega-atracotoxin-Hv1a at pH 3.6	X	X
6193	1H, 13C, 15N PSD-95 PDZ3 NMR Assignments, pH 7, 20C	X	X
6194	1H, 13C, and 15N Chemical Shift Assignments for Omega-atracotoxin-Hv1a at pH 6.0	X	X
6197	1H, 15N and 13C assigned chemical shifts for the Myosin type I SH3 domain (Myo3) from saccharomyces cerevisiae	X	X
6198	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TM1816	X	X
6199	Backbone and side chain 1H, 13C, and 15N chemical shift assignments for 5,10-methenyltetrahydrofolate synthetase	X	X
6202	Assignment of the 1H, 15N and 13C resonances of the Class II E2 Conjugating Enzyme, Ubc1	X	X
6203	1H chemical shift assignments for ThrB12-DKP-insulin	X	X
6204	1H chemical shift assignments for AlaB12-DKP-insulin	X	X
6205	1H chemical shift assignments for AbaB12-DKP-insulin	X	X
6209	Solution Structure of a Calmodulin-Like Calcium-Binding Domain from Arabidopsis thaliana	X	X
6211	Chemical Shift Assignments for Carnobacteriocin B2 immunity protein	X	X
6216	Solution structure of the third zinc finger domain of FOG-1	X	X
6217	Antibiotic Activity and Structural Analysis of a Scorpion-derived Antimicrobial peptide IsCT and Its Analogs	X	X
6218	Antibiotic Activity and Structural Analysis of a Scorpion-derived Antimicrobial peptide IsCT and Its Analogs	X	X
6221	Backbone 1H, 13C, and 15N Chemical Shift Assignments of the Resuscitation Promoting Factor (Rpf) domain of M. tuberculosis	X	X
6222	Solution Structure of Kurtoxin	X	X
6223	Sequential resonance assignment of yeast cytosine deaminase in complex with a transition state analogue	X	X
6224	Assignment of the 1H, 15N and 13C resonances of SufA from E. coli	X	X
6225	1H, 15N, and 13C Resonance Assignment of the Amino-terminal Domain of Tfb1 subunit of yeast TFIIH	X	X
6226	1H, 13C, and 15N Chemical Shift Assignments for the C-terminal domain of EW29	X	X
6228	The Solution Structure of the FATC Domain of the Protein Kinase TOR Suggest a Redox Regulatory Mechanism	X	X
6229	Backbone 1H, 13C, and 15N Chemical Shift assignments for the Nucleotide-binding domain of Thermus Thermophilus DnaK	X	X
6230	1H Chemical Shift Assignments for the cyanomet complex of the isolated, tetrameric beta-chain from human adult hemoglobin	X	X
6231	1H, 13C and 15N resonance assignments and secondary structure of human pancreatitis-associated protein (hPAP)	X	X
6232	TM1442-PO4	X	X
6235	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the SNARE complex	X	X
6236	Backbone 1H, 13C, and 15N Chemical Shift Assignments for CAPPD*, an Independently Folded Extracellular Domain of Human Amyloid-beta Precursor Protein	X	X
6237	Solution Structure of alpha-Conotoxin OmIA	X	X
6239	Chemical shifts assignments for stem-loop VI of the VS ribozyme.	X			X
6240	Solution structure of At5g66040, a putative protein from Arabidopsis Thaliana	X	X
6241	Assignment of the 1H, 13C, and 15N resonances of the josephin domain of ataxin-3	X	X
6243	NMR Relaxation data for Protein Azurin from Pseudomonas aeruginosa	X	X
6244	Novel all alpha-helical fold for gene target gi3844938 from Mycoplasma genitalium	X	X
6248	NMR Structure of a Complex Between MDM2 and a Small Molecule Inhibitor	X	X
6250	Backbone Chemical Shift Assignments for G88W121 fragment of Staphylococcal Nuclease	X	X
6253	1H, 13C and 15N resonance assignment of human gamma S-crystallin, a 21-kDa eye-lens protein	X	X
6255	Chemical Shift Assignments of Ribosomal Protein L16 from Thermus thermophilus HB8	X	X
6256	Chemical Shift Assignments of TM1509	X	X
6257	Alzheimer's Abeta40 Studied by NMR at Low pH Reveals That DSS Binds and Promotes beta-ball Oligomerization	X	X
6258	Backbone 1H, 13C, 15N and Cb chemical shift assignments for TolAIII in complex with g3pN1	X	X
6260	NMR solution Structure of a Highly Stable de novo Heterodimeric Coiled-Coil	X	X
6261	NMR STRUCTURE OF THE SH3 DOMAIN OF HUMAN LYN TYROSINE KINASE	X	X
6262	NMR structure of WW domains (WW3-4) from Suppressor of Deltex	X	X
6268	CBP TAZ1 Domain	X	X
6269	1H, 13C, and 15N Chemical Shift Assignments for chPrP(128-242)	X	X
6270	1H, 13C, and 15N Chemical Shift Assignments for chPrP(25-242)	X	X
6272	NMR ASSIGNMENT OF MTH0776 FROM METHANOBACTERIUM THERMOAUTOTROPHICUM STRAIN H	X	X
6275	1H, 13C and 15N resonance assignments for the six-zinc finger domain of the MTF-1 metalloregulatory protein in the free state	X	X
6276	1H, 13C and 15N resonance assignments for the six-zinc finger domain of the MTF-1 metalloregulatory protein in the DNA bound state	X	X	X
6278	Backbone 1H, 13C, and 15N Chemical Shift Assignments for yeast Sed5p	X	X
6279	1H, 13C and 15N resonance assignments and secondary structure of the murine angiogenin 4	X	X
6280	Resonance assignment of the double-stranded RNA-binding domains of adenosine deaminase acting on RNA	X	X
6281	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Complexin/SNARE complex	X	X
6282	NMR assignment of the turtle prion protein fragments tPrP(121-225)	X	X
6285	15N, 13C, 1H NMR assignment of a 14kDa construct of the focal adhesion protein Talin	X	X
6287	Diversity in structure and function of the Ets family pointed domains	X	X
6288	SOLUTION NMR STRUCTURE OF NTX-1, A LONG NEUROTOXIN FROM THE VENOM OF THE ASIAN COBRA, 20 STRUCTURES	X	X
6289	NMR Structure of the Free Zinc Binding C-terminal Domain of SecA	X	X
6290	Solution Structure of Cu6Metallothionein from the fungus Neurospora crassa	X	X
6291	Assignment of hypothetical membrane protein ta0354_69_121	X	X
6292	1H, 15N and 13C sidechain and backbone assignments of the alkaline proteinase inhibitor APRin from Pseudomonas aeruginosa	X	X
6293	1H Assigned Chemical Shifts for FMBP-1 tandem repeat 2 in 30% (v/v) TFE solution	X	X
6294	1H Assigned Chemical Shifts for FMBP-1 tandem repeat 4 in 30% (v/v) TFE solution	X	X
6295	NMR Structure of the Flavin Domain from Soluble Methane Monooxygenase Reductase from Methylococcus capsulatus (Bath)	X	X
6296	1H Assigned Chemical Shifts for FMBP-1 tandem repeat 3 in 30% (v/v) TFE solution	X	X
6304	Amide chemical shifts of mature human SUMO-1	X	X
6308	Structure of the domain a of the glycoprotein chaperone ERp57	X	X
6309	1H, 13C, and 15N Chemical Shift Assignments for domain III of the omsk hemorrhagic fever envelope protein	X	X
6311	Sequence-specific backbone 1H, 13C and 15N assignments of the 25 kDa SPRY domain-containing SOCS box protein 2 (SSB-2)	X	X
6313	1H,13C,and 15N NMR assignments of the Bombyx mori Pheromone-binding Protein fragment BmPBP(1-128) at pH 6.5.	X	X
6314	NMR assignment for cold-shock protein ribosome-binding factor A (RbfA) from Thermotoga maritima	X	X
6317	1H, 15N and 13C resonance assigment of the transcription factor CylR2 from Enterococcus faecalis	X	X
6318	Solution structure of thioredoxin h1 from Arabidopsis thaliana	X	X
6320	1H, 13C, 15N chemical shift assignments for extended 3' internal stem-loop RNA from S. cerevisiae U6 snRNA	X			X
6321	Chemical Shift assignment of the Ground-State of Delta25-PYP	X	X
6324	Solution structure of the hypothetical protein Tm0979 from Thermotoga maritima	X	X
6325	Assessment of the robustness of a serendipitous zinc-binding fold: mutagenesis and protein grafting	X	X
6326	Assessment of the robustness of a serendipitous zinc-binding fold: mutagenesis and protein grafting	X	X
6327	Assessment of the robustness of a serendipitous zinc-binding fold: mutagenesis and protein grafting	X	X
6328	Assessment of the robustness of a serendipitous zinc-binding fold: mutagenesis and protein grafting	X	X
6329	Assessment of the robustness of a serendipitous zinc-binding fold: mutagenesis and protein grafting	X	X
6331	NMR assignment of the SH2 domain from the human feline sarcoma oncogene FES	X	X
6332	1H, 13C and 15N resonance assignments of MLC (myosin light chain)from Saccharomyces cerevisiae	X	X
6334	1H, 13C, 15N backbone and sidechain resonance assignment of Mip(77-213) the PPIase domain of the Legionella pneumophila Mip protein	X	X
6335	Near complete chemical shift assignments for the zinc-bound redox switch domain of the E. coli Hsp33	X	X
6336	Assignment of human AP4A hydrolase in complex with ATP	X	X
6337	Solution Structure of Ubiquitin like protein from Mus musculus	X	X
6338	NMR solution structure of At1g77540	X	X
6342	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human survivin	X	X
6344	1H, 13C, and 15N Chemical Shift Assignments for human protein HSPCO34	X	X
6345	Solution Structure of YKR049C	X	X
6346	1H, 15N and 13C Resonance Assignments and Secondary Structure Determination Reveal that the Minimal Rac1 GTPase Binding Domain of Plexin-B1 Has a Ubiquitin Fold	X	X
6351	13C, 15N solid-state NMR chemical shift assignments for Kaliotoxin	X	X
6353	1H, 15N and 13C resonance assignments of the BRCT Region of the large subunit of human Replication Factor C	X	X	X
6354	1H, 13C and 15N resonance assignments and 15N-1H residual dipolar couplings for NECAP1 protein	X	X
6356	Yeast frataxin solution structure	X	X
6357	Backbone Resonance Assignments of Wild-Type TEM-1 Beta-lactamase from E. coli	X	X
6358	1H, 13C, and 15N Chemical Shift Assignments for a bacterial BolA-like protein XC975	X	X
6359	Assigned chemical shift for YGGX	X	X
6360	IDENTIFICATION OF MINIMAL PEPTIDE SEQUENCE IN THE AMIDATED FRAGMENT 33-61 OF BOVINE a-HEMOGLBIN	X	X
6362	Solution structure of Iron-Sulfur cluster assembly protein IscU from Bacillus subtilis, with Zinc bound at the active site. Northeast Structural Genomics Consortium Target SR17	X	X
6364	1H, 13C 15N chemical shift assignment of Pyrococcus furiosus Protein PF0470: The Northeast Structural Genomics Consortium Target PfR14	X	X
6365	1H, 13C 15N chemical shift assignment of B. cereus protein BC4709, Northeast Structural Genomics Target Protein BcR68	X	X
6366	1H, 13C, and 15N Chemical Shift Assignments of Bacillus subtilis Protein yqbG: The Northeast Structural Genomics Consortium Target SR215	X	X
6367	1H, 13C, and 15N Chemical Shift Assignments of E.Coli Protein yhgG: The Northeast Structural Genomics Consortium Target ET95	X	X
6368	1H, 13C, and 15N Chemical Shift Assignments of Methanosarcina mazei Protein RPS24E: The Northeast Structural Genomics Consortium Target MaR11	X	X
6369	1H, 13C 15N chemical shift assignment Bacillus halodurans Protein BH1534: The Northeast Structural Genomics Consortium Target BhR29	X	X
6371	1H, 13C, and 15N resonance assignments of Sin3a associated polypeptide 18 (SAP-18)	X	X
6373	1H, 13C and 15N backbone resonance assignments of LexA catalytic domain with the L89P/Q92W/D150H/E152A/K156A mutations	X	X
6374	NMR STRUCTURE OF THE FIRST PHD FINGER OF AUTOIMMUNE REGULATOR PROTEIN (AIRE1): INSIGHTS INTO APECED	X	X
6375	Full 1H, 13C, and 15N Chemical Shift Assignments for Escherichia coli TonB 151-239	X	X
6376	Complete resonance assignment of the C-terminal domain from TgMIC1	X	X
6377	Backbone 1H, 13C, and 15N Chemical Shift Assignments for feline prion protein	X	X
6378	canine prion protein	X	X
6380	1H, 13C, and 15N Chemical Shift Assignments for pig prion protein	X	X
6381	NMR solution structures of mammalian prion proteins	X	X
6382	1H, 13C, and 15N Chemical Shift Assignments for Xenopus prion protein.	X	X
6383	NMR solution structure of the recombinant elk and mouse/elk variant prion proteins	X	X
6384	Solution Structure of TACI_D2	X	X
6385	Backbone 1H, 13C, and 15N Chemical Shift Assignments for pleckstrin human DEP domain	X	X
6386	Structural and Functional Study of Anemonia Elastase Inhibitor, a "Non-classical" Kazal-type Inhibitor from Anemonia sulcata	X	X
6387	Structural and Functional Study of Anemonia Elastase Inhibitor, a "Non-classical" Kazal-type Inhibitor from Anemonia sulcata	X	X
6388	NMR structure of the synthetic penaeidin 4	X	X
6390	NMR assignment of the R-module from the Azotobacter vinelandii mannuronan C5-epimerase AlgE4	X	X
6392	Refined solution structure of the human TSG-6 Link module	X	X
6393	Refined solution structure of the human TSG-6 Link module	X	X			X
6395	1H, 13C, and 15N Chemical Shift Assignments for the Cis and Trans Isomer of the Beta Domain of Bacillus stearothermophilus DivIB	X	X
6396	Chemical shift Assignment for mouse Roadblock/LC7 domain BC029172	X	X
6399	1H, 13C and 15N resonance assignments for the 24 kDa TPR domain in p67phox	X	X
6400	1H, 13C, and 15N Chemical Shift Assignments for the Wild-Type Matrix Protein of Mason-Pfizer Monkey Virus (M-PMV)	X	X
6402	Solution structure of the carbon storage regulator CsrA from E. coli	X	X
6403	Ovine Prion Protein Variant R168	X	X
6404	HN, N, CA, CB Chemical Shift Assignments for the CID domain of Pcf11	X	X
6405	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the first cadherin domain of Cadherin-related neuronal receptor(CNR)/ Protocadherin alpha	X	X
6406	Backbone and side chain chemical shift assignments of a TRAV14-3 mouse T cell receptor domain	X	X
6407	1H, 15N resonance assignment of the C-terminal domain of Human Papillomavirus Oncoprotein E6	X	X
6408	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Two C-terminal C2H2 Zinc Fingers (F5-6) of MTF-1	X	X
6409	Backbone 1H, 13C, and 15N and 13CB Chemical Shift Assignments for Four N-terminal C2H2 Zinc Fingers (F1-4) of MTF-1	X	X
6410	1H, 15N, and 13C resonance assignments of reduced form of poplar glutaredoxin CxxC1 from Populus tremula tremuloides	X	X
6411	FRAGMENT 33-61 OF BOVINE alpha-HEMOGLBIN: THE EFFECT OF C-TERMINAL AMIDATION AND IDENTIFICATION OF THE MINIMAL PORTION WITH ANTIFUNGAL ACTIVITY	X	X
6412	FRAGMENT 33-61 OF BOVINE alpha-HEMOGLBIN: THE EFFECT OF C-TERMINAL AMIDATION AND IDENTIFICATION OF THE MINIMAL PORTION WITH ANTIFUNGAL ACTIVITY	X	X
6413	FRAGMENT 33-61 OF BOVINE alpha-HEMOGLBIN: THE EFFECT OF C-TERMINAL AMIDATION AND IDENTIFICATION OF THE MINIMAL PORTION WITH ANTIFUNGAL ACTIVITY	X	X
6414	FRAGMENT 33-61 OF BOVINE alpha-HEMOGLBIN: THE EFFECT OF C-TERMINAL AMIDATION AND IDENTIFICATION OF THE MINIMAL PORTION WITH ANTIFUNGAL ACTIVITY	X	X
6415	Three-disulfide variant of hen lysozyme: C30A/C115A	X	X
6416	Backbone 1H, 13C, and 15N assignments of a 56 kDa E. coli nickel binding protein NikA	X	X
6418	Backbone 1H, 13C and 15N resonance assignments for the Mg2+-bound form of the Ca2+-binding photoprotein aequorin	X	X
6419	Structure of the C-terminal Domain from Trypanosoma brucei Variant Surface Glycoprotein MITat1.2	X	X
6427	Solution structure of a recombinant type I sculpin antifreeze protein	X	X
6431	1H, 13C and 15N assignments for the II-III loop region of the skeletal dyhydropyridine receptor	X	X
6433	Sequence specific 1HN, 13C and 15N resonance assignments of a novel calcium binding protein from Entamoeba histolytica	X	X
6434	Backbone and Sidechain Assignments of the Lambda Bacteriophage Tail Assembly Protein gpU	X	X
6437	Structural origin of endotoxin neutralization and antimicrobial activity of a lactoferrin-based peptide	X	X
6438	Sequence-specific resonance assignments of the C-terminal, 137-residue pseudo-receiver domain of circadian input kinase (CikA) that resets the circadian clock in Synechococcus elongatus	X	X
6442	1H, 13C, and 15N sequence-specific resonance assignment and secondary structure of Plasmodium falciparum thioredoxin	X	X
6444	1H, 13C, and 15N Chemical Shift Assignments for MMP12	X	X
6445	Backbone 1H, 13C, and 15N and 13CB Chemical Shift Assignments for Six C2H2 Zinc Fingers (F1-6) of MTF-1 in the DNA Bound State (22 bp)	X	X	X
6446	Structural and Functional Characterization of Transmembrane Segment IV of the NHE1 Isoform of the Na+/H+ Exchanger	X	X
6447	Solution structure of a two-repeat fragment of major vault protein	X	X
6448	Solution structure of the hypothetical protein ytfP from Escherichia coli. Northeast Structural Genomics target ER111.	X	X
6451	1H, 15N and 13C resonance assigment of the chaperone CesT from enteropathogenic Escherichia coli	X	X
6452	1H, 13C and 15N resonance assignments of the PDZ domain of CLP-36	X	X
6453	The solution structure of YggX from Escherichia coli	X	X
6456	NMR STRUCTURE OF THE SH3 DOMAIN OF HUMAN LYN TYROSINE KINASE	X	X
6459	Chemical Shift Assignment for Itch E3 WW3 domain	X	X
6462	The structure of a lactoferricinB derivative bound to micelles (LfcinB4-14)	X	X
6463	The structure of a lactoferricinB derivative bound to micelles	X	X
6468	1H, 13C and 15N backbone resonance assignment of p38 mitogen-activated protein kinase	X	X
6470	Rotational Diffusion Anisotropy of Human Ubiquitin from 15N NMR Relaxation	X	X
6474	The 15N relaxation data and backbone dynamics results of CLV1 pT868 bound KI-FHA from KAPP	X	X
6478	The N-domain of the transcription factor AbrB	X	X
6479	The Structure of the Excisionase (Xis) Protein from Conjugative Transposon Tn916 Provides Insights into the Regulation of Heterobivalent Tyrosine Recombinases	X	X
6485	A novel RNA pentaloop fold involved in targeting ADAR2	X			X
6487	Determination of Relative N-HN, N-C', CA-C', and CA-HA Effective Bond Length in a Protein by NMR in a Dilute Liquid Crystalline Phase	X	X
6488	Reparametrization of the Karplus Relation for 3J(HA-N) and 3J(HN-C') in Peptides from Uniformly 13C/15N-Enriched Human Ubiquitin	X	X
6491	Correlations among 1JNC and H3JNC Coupling Constants in the Hydrogen-Bonding Network of Human Ubiquitin	X	X
6493	Assignment of the 1H, 13C, and 15N resonances of URNdesign, a computationally redisgned RRM protein	X	X
6494	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Chorismate Mutase	X	X
6495	Backbone 1H, 13C, and 15N Chemical Shift Assignments and relaxation data for Chorismate Mutase from Bacillus subtilis in complex with inhibitor	X	X
6496	Backbone 1H and 15N Chemical Shift Assignments for Chorismate Mutase from Bacillus subtilis in complex with prephenate	X	X
6497	Magnetic Field Dependence of Nitrogen-Proton J Splittings in 15N-Enriched Human Ubiquitin Resulting from Relaxation Interference and Residual Dipolar Coupling	X	X
6500	Backbone 1H, 13C, and 15N Chemical Shift Assignments for SIP (74-178)	X	X
6501	Backbone 1H, 15N, 13Ca and sidechain 13Cb chemical shift assignments of SARS-CoV Nsp9	X	X
6502	DNA binding domain in XPF/ERCC-1 complex	X	X
6503	1H, 13C, and 15N complete chemical shift assignments for the apo v-Src SH2 domain	X	X
6504	1H, 13C, and 15N Chemical shift Assignments for crambin in DPC micelles	X	X
6510	Structure and inter-domain interactions of domain II from the blood stage malarial protein, apical membrane antigen 1	X	X
6511	NMR structure of peptide SD	X	X
6512	1H, 15N, and 13C resonance assignments of Vaccinia Virus Envelope protein, A27L	X	X
6513	NMR Structure of the nonstructural Protein 7 (nsP7) from the SARS Corona Virus	X	X
6514	1H, 13C, and 15N Chemical Shift Assignments for Psuedomonas Aeruginosa protein PA4608	X	X
6515	Chemical Shift Assignments for At2g46140.1	X	X
6516	NMR assignment of the holo-acyl carrier protein (PfACP) from malaria parasite Plasmodium falciparum	X	X
6517	NMR structure of P. aeruginosa protein PA4738: Northeast Structural Genomics Consortium target PaP2	X	X
6519	Chemical shift assignments of Calsensin	X	X
6520	1H, 15N Chemical shift assignments for recombinant elicitor protein PcF from the oomycete pathogen P. cactorum	X	X
6524	ApoE N-terminal domain	X	X
6525	Backbone 1H Chemical Shift Assignments for Mungbean Defensin, VrD1	X	X
6526	Solution structure of the KH-QUA2 region of the Xenopus STAR/GSG Quaking protein.	X	X
6527	1H, 13C and 15N Chemical Shift Assignments for km23 dimer	X	X
6528	1H, 15N and 13C Assignments for the R2 Domain of Choline Binding Protein A (CbpA)	X	X
6530	CC45, An Artificial WW Domain Designed Using Statistical Coupling Analysis	X	X
6533	1H, 13C, and 15N Chemical Shift Assignments for the DNA binding domain of STPA from E. coli	X	X
6536	1H,15N,13C backbone and sidechain assignment for human ADAP hSH3-1 domain in reduced form	X	X
6537	Small Molecule Ligand Induces Nucleotide Flipping in (CAG)n Trinucleotide Repeats	X		X
6538	1H, 13C, and 15N Chemical Shift Assignments for 2B4	X	X
6539	1H,15N,13C backbone and sidechain assignment for human ADAP hSH3-1 domain in oxidized form	X	X
6541	1H, 13C and 15N chemical shift assignments for stereo array isotope labeled (SAIL) calmodulin	X	X
6542	Main Chain 1H, 13C, and 15N chemical shift assignments for arginine kinase	X	X
6546	1H, 13C, and 15N Chemical Shift Assignments for Human Protein CGI-126(HSPC155): the Northeast Structural Genomics Consortium Target HR41	X	X
6547	structure-function relationships of the polyhistidine-rich peptide LAH4 in micellar environments; pH dependent mode of antibiotic action & DNA transfection	X	X
6551	Solution structure of the C-terminal domain of ERCC1 complexed with the C-terminal domain of XPF	X	X
6555	Solution structure of YBL071w-A from Saccharomyces cerevisiae	X	X
6556	Solution structure of 1-26 fragment of human programmed cell death 5 protein	X	X
6557	Solution Conformation of adr subtype HBV Pre-S2 Epitope	X	X
6561	NMR structure of plantaricin a in dpc micelles, 20 structures	X	X
6563	Backbone 1H, 13C, and 15N Chemical Shift Assignments for oxidized ArsC	X	X
6566	Measles virus N protein (amino acids 477-505)	X	X
6567	Measles virus N protein (amino acids 477-505) bound to the Measles virus P protein (amino acids 457-507).	X	X
6568	Measles virus P protein (amino acids 457-407)	X	X
6569	Measles virus P protein (amino acids 457-507) bound to the Measles virus N protein (amino acids 477-505)	X	X
6571	Chemical Shift Assignments for the theta subunit of DNA polymerase III from E. coli	X	X
6573	NMR Structure of VPS4A MIT Domain	X	X
6575	Backbone and side-chain chemical shift assignments for Human Nck2 SH2 domain	X	X
6576	Backbone and sidechain 1H assignments of Crotamine	X	X
6578	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Bcl-xl/Bad BH3 peptide complex	X	X
6579	A structural Model for the Membrane-Bound Form of the Juxtamembrane Domain of the Epidermal Growth Factor Receptor	X	X
6580	assignment of mouse socs3 by NMR	X	X
6582	Sequential resonance assignment of the human BMP type II receptor extracellular domain	X	X
6583	1H, 13C, and 15N NMR Sequence-specific Resonance Assignments for Rat Ca2+-S100A1	X	X
6585	Resonance assignment of the At1g24000.1 protein from Arabidopsis Thaliana	X	X
6587	1H, 13C and 15N backbone resonance assignments of apolipoprotein A-I in lipid-mimetic solution	X	X
6588	1H, 13C and 15N backbone resonance assignments of apolipoprotein A-I(1-186) in ipid-mimetic solution	X	X
6589	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Chromo Domain of cpSRP43	X	X
6591	On the Importance of Carbohydrate-Aromatic Interactions for the Molecular Recognition of Chitooligosaccharides by Hevein Domains. NMR Studies of the Structure and Binding Affinity of AcAMP2-Like Peptides with non Natural Napthyl and Fluoroaromatic Residues	X	X
6592	Chromo 2 domain of cpSRP43	X	X
6593	Chromo 3 domain of cpSRP43	X	X
6594	Elucidation of the high-resolution solution structure of a trypanosomatid FYVE domain	X	X
6596	NMR solution structure of a leaf-specific-expressed cyclotide vhl-1	X	X
6597	Human ARNT C-terminal PAS domain	X	X
6598	Mouse Doppel 1-30 peptide	X	X
6603	NMR assignments of a thioredoxin-like protein ykuV from Bacillus subtilis	X	X
6604	1H, 13C, and 15N complete chemical shift assignments for v-Src SH2 domain complexed with PQpYEEIPI ligand.	X	X
6605	E. Coli Ada in a complex with DNA	X	X	X
6606	backbone and side chain assignment for RPA70A from S.cerevisiae	X	X
6607	1H, 13C and 15N resonance assignments of AT-Rich Interaction Domain (ARID) of Jumonji	X	X
6608	Proton assignments for PV5	X	X
6609	Solution structure of the ubiquitin-like domain of human DC-UBP from dendritic cells	X	X
6610	apg8a.title	X	X
6611	1H, 13C, and 15N chemical shift assignments for the receiver domain (residues 1-121) of NtrC4 from Aquifex aeolicus	X	X
6615	Backbone 1H, 13C, and 15N Chemical Shift Assignments for SSD domain of Bacillus subtilis Lon protease	X	X
6616	1H chemical shift assignments for peptide P5	X	X
6617	Backbone 1H,15N assignment of the C-terminal haemopexin-like domain of matrix metalloproteinase MMP-13 (collagenase-3)	X	X
6618	1H chemical shift assignments for peptide P6	X	X
6619	1H chemical shift assignments for peptide P7	X	X
6620	1H, 13C, and 15N Chemical Shift Assignments for murine p22HBP	X	X
6621	1H, 15N, and 13C Resonance Assignments of Human Interleukin-2	X	X
6622	Backbone 1H, 13C, and 15N Chemical Shift Assignments for HEWL-SMe	X	X
6623	Chemical Shift Assignments for Proinsulin C-Peptide	X	X
6624	Backbone 1H, 13C, and 15N Resonance Assignments for the 13kD Ras Association Domain 1 (RA1) from Phospholipase C (epsilon)	X	X
6625	1H, 13C and 15N assignments of a New Phosphohistidine Phosphatase Protein PHPT1 from Homo sapiens	X	X
6626	'Complete 1H, 13C, and 15N Chemical Shift Assignments for plant Tom20 mitochondrial import receptor cytosolic domain (isoform 3) from Arabidopsis thaliana'	X	X
6628	Specificity and Mechanism of the Histone Methyltransferase Pr-Set7	X	X
6629	Solution Structure of the type 1 pilus assembly platform FimD(25-139)	X	X
6631	Solution structure of a human ubiquitin-like domain in SF3A1	X	X
6635	Backbone 1H, 13C, and 15N Resonance Assignments for the 13kD Ras Association Domain 2 (RA2) from Phospholipase C (epsilon)	X	X
6637	On the Importance of Carbohydrate-Aromatic Interactions for the Molecular Recognition of Chitooligosaccharides by Hevein Domains. NMR Studies of the Structure and Binding Affinity of AcAMP2-Like Peptides with non Natural Napthyl and Fluoroaromatic Residues	X	X
6638	1H, 15N, and 13C assignments of N-terminal domain of Epstein-Barr Virus Latent Membrane Protein 2A	X	X
6639	On the Importance of Carbohydrate-Aromatic Interactions for the Molecular Recognition of Chitooligosaccharides by Hevein Domains. NMR Studies of the Structure and Binding Affinity of AcAMP2-Like Peptides with non Natural Napthyl and Fluoroaromatic Residues	X	X
6643	Solution structure of human prolactin	X	X
6644	1H, 13C, and 15N NMR assignments for AlgH, a putative transcriptional regulator from Pseudomonas aeruginosa	X	X
6645	1H, 13C and 15N backbone and side chain resonance assignments of Haloferax volcanii DHFR1	X	X
6646	1H, 15N and 13C backbone assignment of the firefly luciferase C-terminal 14.3 kDa domain	X	X
6647	On the Importance of Carbohydrate-Aromatic Interactions for the Molecular Recognition of Chitooligosaccharides by Hevein Domains. NMR Studies of the Structure and Binding Affinity of AcAMP2-Like Peptides with non Natural Napthyl and Fluoroaromatic Residue	X	X
6648	Solution Structure of a Zap1 Zinc-Responsive Domain Provides Insights into Metalloregulatory Transcriptional Repression in Saccharomyces cerevisiae	X	X
6649	Solution structure of the peptidoglycan binding domain of B. subtilis cell wall lytic enzyme CwlC: Characterization of the sporulation-related repeats by NMR	X	X
6650	1H Chemical Shift Assignments for fragments of Sticholysin protein	X	X
6651	1H Chemical Shift Assignments for fragments of Sticholysin protein	X	X
6652	RNA helical packing in solution: NMR structure of a 30 kDa GAAA tetraloop receptor complex	X			X
6653	Solution Structure of a Zap1 Zinc-Responsive Domain Provides Insights into Metalloregulatory Transcriptional Repression in Saccharomyces cerevisiae	X	X
6655	Solution Structure of the N-terminal Zinc Fingers of the Xenopus laevis double stranded RNA binding protein ZFa	X	X
6656	On the Importance of Carbohydrate-Aromatic Interactions for the Molecular Recognition of Chitooligosaccharides by Hevein Domains. NMR Studies of the Structure and Binding Affinity of AcAMP2-Like Peptides with non Natural Napthyl and Fluoroaromatic Residues	X	X
6657	On the Importance of Carbohydrate-Aromatic Interactions for the Molecular Recognition of Chitooligosaccharides by Hevein Domains. NMR Studies of the Structure and Binding Affinity of AcAMP2-Like Peptides with non Natural Napthyl and Fluoroaromatic Residues	X	X
6658	NMR Solution Structure of a ldb1-LID:Lhx3-LIM complex	X	X
6659	15N hyperfine shifts assignment for wild-type rubredoxin from Clostridium pasteurianum in the oxidized state	X	X
6660	15N hyperfine shifts assignment for rubredoxin (V8A) from Clostridium pasteurianum in the oxidized state	X	X
6661	15N hyperfine shifts assignment for rubredoxin (V8A) from Clostridium pasteurianum in the reduced state	X	X
6662	15N hyperfine shifts assignment for wild-type rubredoxin from Clostridium pasteurianum in the reduced state	X	X
6663	15N hyperfine shifts assignment for rubredoxin (V8G)from Clostridium pasteurianum in the oxidized state	X	X
6664	15N hyperfine shifts assignment for rubredoxin (V8G)from Clostridium pasteurianum in the reduced state	X	X
6665	15N hyperfine shifts assignment for rubredoxin (V8G/V44G) from Clostridium pasteurianum in the oxidized state	X	X
6666	15N hyperfine shifts assignment for rubredoxin (V8G/V44G) from Clostridium pasteurianum in the reduced state	X	X
6667	15N hyperfine shifts assignment for rubredoxin (V8I) from Clostridium pasteurianum in the oxidized state	X	X
6668	15N hyperfine shifts assignment for rubredoxin (V8I) from Clostridium pasteurianum in the oxidized state	X	X
6669	15N hyperfine shifts assignment for rubredoxin (V8L) from Clostridium pasteurianum in the oxidized state	X	X
6670	15N hyperfine shifts assignment for rubredoxin (V8L) from Clostridium pasteurianum in the reduced state	X	X
6671	15N hyperfine shifts assignment for rubredoxin (V44A) from Clostridium pasteurianum in the oxidized state	X	X
6672	15N hyperfine shifts assignment for rubredoxin (V44A) from Clostridium pasteurianum in the reduced state	X	X
6673	15N hyperfine shifts assignment for rubredoxin (V44G)from Clostridium pasteurianum in the oxidized state	X	X
6674	15N hyperfine shifts assignment for rubredoxin (V44G)from Clostridium pasteurianum in the reduced state	X	X
6675	15N hyperfine shifts assignment for rubredoxin (V44I)from Clostridium pasteurianum in the oxidized state	X	X
6676	15N hyperfine shifts assignment for rubredoxin (V44I)from Clostridium pasteurianum in the reduced state	X	X
6677	15N hyperfine shifts assignment for rubredoxin (V44L) from Clostridium pasteurianum in the oxidized state	X	X
6678	15N hyperfine shifts assignment for rubredoxin (V44L) from Clostridium pasteurianum in the reduced state	X	X
6679	G311	X	X
6680	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for A219.	X	X
6682	Solution Structure of a Human C2H2-type Zinc Finger Protein	X	X
6685	NMR Structure of AlkB	X	X
6687	Solution structure of the N-terminal domain (M1-S98) of human centrin 2	X	X
6688	NMR chemical shift entry for protein Rv1980c (MPT64) from M. tuberculosis	X	X
6689	1H and 15N Chemical Shift Assignments for N-terminal domain of human centrin 1	X	X
6690	Partial 1H, 13C, and 15N Chemical Shift Assignments for PSI AB box region in complex with U1-70k protein proline-rich peptide	X	X
6691	Partial 1H, 13C, and 15N Chemical Shift Assignments for PSI AB box region in complex with U1-70k protein proline-rich peptide	X	X
6693	Structure Determination of the Northeast Structural Genomics Consortium Target BoR11	X	X
6695	Backbone 1H, 13C and 15N Chemical Shift Assignments for Ferredoxin-NADP+ Reductase	X	X
6696	G83N TPR domain of Ppp5	X	X
6698	The structured core of a largely unstructured protein, malarial merozoite surface protein 2 (MSP2), is amyloidogenic	X	X
6700	Resonance Assignments of 30 kDa complexes of TFIID subunit TAF1 with TATA-binding protein	X	X
6702	Resonance assignments of 30 kDa complexes of TFIID subunit TAF1 with TATA-binding protein	X	X
6707	NMR assignments for apo- and Ca2+ saturated paramecium calmodulin	X	X
6714	Solution structure of CSP1	X	X
6715	Solution NMR Structure of the Membrane Protein Stannin	X	X
6717	Solution NMR structure of the UPF0213 protein BH0048 from Bacillus halodurans. Northeast Structural Genomics target BhR2.	X	X
6720	Solution Conformation of alpha-conotoxin PIA	X	X
6722	Backbone NMR Assignment of low-molecular-weight Protein Tryosin Phosphatase (MPtpA) from Mycobacterium tuberculosis	X	X
6723	NMR structure of the heme chaperone CcmE reveals a novel functional motif	X	X
6724	Nuclear Magnetic Resonance Structure-Based Epitope Mapping and Modulation of Dust Mite Group 13 Allergen as a Hypoallergen	X	X
6725	1H, 13C and 15N resonance assignments for domain III of the Dengue Virus envelope protein	X	X
6726	Solution structure of self-sacrificing resistance protein CalC from Micromonospora echinospora	X	X
6727	1H, 13C and 15N resonance assignments of telomeric repeat-binding domain of Arabidopsis thaliana	X	X
6729	1H Chemical Shift Assignments for Diapause-Specific Peptide from the Leaf Beetle	X	X
6731	Backbone 1H, 13C, and 15N Chemical Shift Assignments for BOFC	X	X
6736	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Pseudomonas Aeruginosa Protein Pa2021. The Northeast Structural Genomics Consortium Target Pat85.	X	X
6738	Solution structure of Sep15 from Drosophila melanogaster	X	X
6739	Solution structure of SelM from Mus musculus	X	X
6741	NMR Structure of Mini-B, an N-terminal - C-terminal construct from Surfactant Protein B (SP-B), in Sodium Dodecyl Sulfate (SDS) and Hexafluoroisopropanol (HFIP)	X	X
6742	De-ubiquitinating function of ataxin-3: insights from the solution structure of the Josephin domain	X	X
6745	Backbone 1H, 13C, and 15N chemical shift assignments of human HnRNP F	X	X
6746	Assignment of phnA-like protein rp4479	X	X
6747	Assignment of 50S ribosomal protein L40e	X	X
6748	NMR assignments of the Ki67FHA/hNIFK(226-269)3P complex	X	X
6749	Solution structure of the NRSF/REST-mSin3B PAH1 complex	X	X
6750	Structural basis for cooperative transcription factor binding to the CBP coactivator	X	X
6751	Solution Structure of Asl1650, an Acyl Carrier Protein from Anabaena sp. PCC 7120 with a Variant Phosphopantetheinylation-Site Sequence	X	X
6752	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for the PH-PDZ tandem of alpha syntrophin	X	X
6753	Backbone 1H,13C, and 15N chemical shift assignments for the PH1 domain of alpha-syntrophin	X	X
6754	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for the PDZ domain of alpha syntrophin	X	X
6755	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TA0743	X	X
6756	Solution structure of domain 6 from the ai5(gamma) group II intron	X			X
6757	1H and 13C Chemical Shift assignments for BVDV NS5A membrane anchor sequence [1-28]	X	X
6758	NMR assignment of the E.coli cytolethal distending toxin CdtB-II subunit	X	X
6759	NEAT NMR Resonance Assignments	X	X
6760	NMR assignment of the mTOR domain responsible for rapamycin binding	X	X
6761	SOLUTION STRUCTURE AND BACKBONE DYNAMICS OF AN N-TERMINAL UBIQUITIN-LIKE DOMAIN IN THE GLUT4-TETHERING PROTEIN, TUG	X	X
6762	The response regulator TorI belongs to a new family of atypical excisionase	X	X
6763	1H, 15N and 13C resonance assignments of the middle domain of human release factor eRF1	X	X
6766	Complete assignment of a hypothetical protein pa0128 form Pseudomonas aeruginosa. Northeast Structural Genomics Consortium Target PaT1.	X	X
6769	Complete assignments of a hypothetical protein NE2066, from Nitrosomonas_europaea. Northeast Structural Genomics Consortium Target NeT1.	X	X
6776	Assignment of 1H, 15N and 13C resonances of the bacterial protein YFHJ	X	X
6777	Beta PIX-SH3 complexed with an atypical peptide from alpha-PAK	X	X
6778	NMR and molecular dynamics studies of the interaction of melatonin with calodulin	X	X
6779	Solution Structure of the type 1 pilus assembly platform FimD(25-125)	X	X
6780	NMR Assignment of HI1506, a novel two-domain protein from Haemophilus influenzae	X	X
6781	Resonance Assignments for the ADA2-like Swirm domain	X	X
6782	1H, 13C, and 15N Chemical Shift Assignments for E. coli protein YbiA	X	X
6783	Backbone/Sidechain assignments for RKIP.	X	X
6784	KID domain	X	X
6787	Backbone 1H, 13C, and 15N Chemical Shift Assignments for rabphilin C2A domain	X	X
6788	Ser133-phosphorylated KID domain	X	X
6790	Solution Structure of Stearoyl-ACP from Spinach	X	X
6793	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Bacillus Subtilis Protein Ysne: The Northeast Structural Genomics Consortium Target SR220	X	X
6797	NMR assignment of the outer membrane lipoprotein (OmlA) from Xanthomonas axonopodis pv citri	X	X
6798	chemical shift values of the methyl groups of Met residues in the Ca2+-CaM-CaMKI-peptide complex	X	X
6799	Resonance Assignments for Methanococcus Maripaludis Protein Mmp0443: The Northeast Structural Genomics Consortium Target Mrr16	X	X
6800	NMR solution structure and backbone dynamics of tick-borne E-protein domain III Langat flavivirus	X	X
6801	1H, 13C, and 15N Chemical Shift Assignments for Human Small Ubiquitin-like Modifier Protein Isoform 2 (SUMO-2)	X	X
6803	1H, 13C, and 15N Chemical Shift Assignments for the periplasmic signaling domain of FecA from Escherichia coli	X	X
6807	1H, 13C, and 15N chemical shift assignments for stereo-array isotope labelled (SAIL) maltodextrin-binding protein (MBP)	X	X
6808	1H, 13C, and 15N Chemical Shift Assignments for the N-terminal Peptide of Equinatoxin II	X	X
6809	Backbone 1H,13C, and 15N chemical shift assignments for rabbitpox encoded viral chemokine inhibitor (vCCI)	X	X
6810	Letter to the Editor: Assignment of 1H, 13C and 15N resonances of the last 250 residues in Escherichia coli RcsC, including the phosphoreceiver domain.	X	X
6811	Solution structure of apoCadA	X	X
6820	Solution Structure Of The Calcium-loaded N-Terminal Sensor Domain Of Centrin	X	X
6823	Backbone and Sidechain chemical shift assignments of the Human Rhinovirus 3C Protease covalently complexed with a peptidyl inhibitor	X	X
6824	1H, 13C, and 15N Chemical Shift Assignments for ORF 7a coded X4 protein of SARS Coronavirus	X	X
6827	Structure function relationships of the polyhistidine rich peptide LAH4 in micellar environment;pH dependent mode of antibiotic action and DNA transfection	X	X
6828	Backbone 1H, 13C, and 15N Chemical Shift Assignments for MazF(E24A)	X	X
6829	Chemical shift assignments for Chitin-binding Domain of Hyperthermophilic Chitinase from Pyrococcus furiosus	X	X
6830	1H, 13C Chemical shifts and pKa values in Ca2+-CaM and the CaM-cNOS peptide comlex.	X	X
6831	1H, 13C Chemical shifts and pKa values in Ca2+-CaM and the CaM-cNOS peptide comlex.	X	X
6832	Comparative NMR study on the impact of point mutations on protein stability of Pseudomonas mendocina lipase	X	X
6833	Backbone 1H, 13C, and 15N Chemical Shift Assignments for holo-MazF(E24A) with MazEp(54-77)	X	X
6834	Solution Structure of the hSet2/HYPB SRI domain	X	X
6835	Structures of antimicrobial peptide Fowlicidin 1	X	X
6837	NMR Assignments of L27 Heterodimer From C. Elegans Lin-7 and H. Sapiens Lin-2 Scaffold Proteins	X	X
6838	1H, 13C and 15N backbone resonance assignment for PSE-4, a 29.5 kDa class A beta-lactamase from Pseudomonas aeruginosa	X	X
6839	1H Chemical shift assignments for PV5 in DPC micelles	X	X
6843	Solution structure of the NOD1 Caspase Activating and Recruitment Domain	X	X
6844	Solution Structure of Drosophila melanogaster SNF RBD2	X	X
6845	NMR Structural analysis of archaeal Nop10	X	X
6846	NMR structural analysis of Nop10p from Saccharomyces cerevisiae	X	X
6847	NMR assignments of a thioredoxin-like protein in the oxidized state	X	X
6850	First FF domain of the PRP40 yeast protein	X	X
6851	Solution Structure of the human homodimeric DNA repair protein XPF.	X	X
6855	Sequence specific assignment of SH3 domain B from human CIN85 protein	X	X
6859	1H chemical shift assignments for peptide P2	X	X
6860	Chemical shift assignments of the human ortholog of tRNA endonuclease subunt SEN15	X	X
6863	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Mengovirus Leader polypeptide	X	X
6864	1H, 13C and 15N resonance assignments of a repeat domain of the egg case silk from Nephila antipodiana	X	X
6866	chemical shift assignments of the human sorting nexin 22	X	X
6869	Solution Structure of C-Terminal 14 kDa Domain of the tau subunit from Escherichia coli DNA Polymerase III	X	X
6872	Solution structure of kalata B8	X	X
6873	1H, 15N and 13C chemical shift assignments of pleckstrin's C-terminal PH domain	X	X
6874	Structural diversity in CBP/p160 complexes	X	X
6876	1H, 15N and 13C chemical shifts of T. cruzi Chagasin	X	X
6877	NMR assignments of the Human Papillomavirus type 16 E2C DNA-bound form	X	X	X
6879	Backbone 1H, 13C, and 15N Chemical Shift Assignment for aKv1.1N	X	X
6882	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the extracellular sushi domain of the Interleukin-15 receptor	X	X
6884	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Bacillus subtilis Acylphosphatase	X	X
6885	Assignment of 1H and 15N chemical shifts for the Ig1 module of FGFR1	X	X
6886	Structure-function relationships of the polyhistidine-rich peptide LAH4 in micellar environments; pH dependent mode of antibiotic action and DNA transfection	X	X
6888	1H, 15N Assignment of Neocarzinostatin Apo-Protein complexed with Flavone	X	X
6892	Structure and influence on stability and activity of the N-terminal propetide part of lung surfactant protein C	X	X
6894	New insights into binding of the possible cancer target RalGDS	X	X
6895	NMR Structure of the RNA Binding Domain of Human Fox-1 in Complex with UGCAUGU	X	X		X
6896	Solution structure of [Sec2,3,8,12]-ImI	X	X
6897	Solution structure of [Sec2,8]-ImI	X	X
6899	Native PAH2 domain of Mm. mSin3B	X	X
6900	15N, 13C and 1H resonance assignments for the C-terminal MA-3 domain of the tumour suppressor protein Pdcd4	X	X
6901	1H, 13C, and 15N Chemical Shift Assignments for DUSP domain of HUSP15	X	X
6902	Complete 1H and 15N assignment of the FK506-binding domain of human FKBP38	X	X
6903	1H, 13C and 15N resonance assignment of M-crystallin: a novel Ca2+ binding protein of the bg-crystallin superfamily from Methanosarcina acetivorans	X	X
6904	1H, 13C and 15N resonance assignment of M-crystallin: a novel Ca2+ binding protein of the bg-crystallin superfamily from Methanosarcina acetivorans	X	X
6905	Solution Structure of a Zap1 Zinc-Responsive Domain Provides Insights into Metalloregulatory Transcriptional Repression in Saccharomyces cerevisiae	X	X
6906	1H, 13C, and 15N Chemical Shift Assignments for the Bicoid Homedomain	X	X	X
6907	Chemical Shift Assignments for V66W110 fragment of Staphylococcal Nuclease	X	X
6908	1H, 13C, and 15N Chemical Shift Assignments for SNase110 fragment of Staphylococcal Nuclease in 2M TMAO	X	X
6911	13C, 15N and 1H assignment of the PDZ1 domain of hMAGI-1 using QUASI	X	X
6912	1H, 13C, and 15N Resonance Assignments for the reduced form of Thioredoxin 1 from Sacharomyces cerevisae	X	X
6913	'1H, 13C and 15N Resonance Assignments for the Reduced Form of Thioredoxin 2 from Saccharomyces cerevisiae'	X	X
6914	Solution structure of the Wilson ATPase N-domain in the presence of ATP	X	X
6918	Backbone 1H, 13C, and 15N Chemical Shift Assignments for CRC-N (algal centrin N-term)	X	X
6919	Letter to the Editor: 1H, 13C and 15N resonance assignments of the region 655-775 of the human MAN1	X	X
6920	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Mid1 BBox 1	X	X
6921	Backbone and side chain chemical shift assignments for hydrophilic domain of human cytochrome b5	X	X
6922	Solution structure of the Vts1 SAM domain in the presence of RNA	X	X		X
6923	Backbone 1H, 13C, and 15N resonance assignments of the N-terminal domain of FKBP38 (FKBP38NTD)	X	X
6924	1H chemical shifts for discrepin, a scorpion toxin that blocks IA currents of the voltage dependent K+ channels	X	X
6925	Backbone and Beta 1H, 13C, and 15N Chemical Shift Assignments for the Bacterial Toxin Kid	X	X
6926	Chemical Shift Assignments of Thylakoid Soluble Phosphoprotein of 9 kDa	X	X
6927	Spinophilin PDZ domain	X	X
6928	1H, 13C, and 15N NMR Assignment of the Rep Protein Nuclease Domain from the Porcine Circovirus PCV2	X	X
6929	1H, 13C, and 15N Chemical Shift Assignments for Nitrosomonas Europaea Protein Ne2328: Northeast Structural Genomics Consortium target NeT3	X	X
6930	NMR assignments of SNF RBD1	X	X
6932	Chemical shift assignments of phosphoryl carrier domain of pyruvate phosphate dikinase	X	X
6933	Complete Chemical Shift Assignment for the Neurabin PDZ Domain	X	X
6934	1H, 15N, and 13C Assigned Chemical shift for Wzb	X	X
6935	Comparative NMR study on the impact of point mutations on protein stability of Pseudomonas mendocina lipase	X	X
6936	Resonance assignments for the pKM101 homologue of VirB7 (TraN) in complex with the pKM101 homologue of VirB9 (TraO)	X	X
6939	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Ubiquitin Specific Protease 7	X	X
6941	'1H, 13C, and 15N Chemical Shift Assignments for Ac-Dab-Dab-(Ala)7-Orn-Orn-NH2 where Dab-diaminobutyric acid; Orn - ornithine'	X	X
6942	1H, 13C, and 15N Chemical Shift Assignments for Myristoylated neuronal calcium sensor-1	X	X
6943	Resonance Assignment of Bombyx mori Chemosensory Protein 1	X	X
6945	solution structure of PSD-1	X	X
6949	domain 2 of receptor-associated protein	X	X
6950	domain 3 of RAP	X	X
6951	Solution structure of conotoxin pl14a	X	X
6952	Violacin A	X	X
6953	NMR solution of rabbit Prion Protein (91-228)	X	X
6954	NMR structure of influenza HA fusion peptide mutant W14A in DPC in pH5	X	X
6962	Resonance Assignments of 10:0-ACP	X	X
6963	1H Chemical Shift Assignments for the Second Kunitz domain of human WFIKKN1, Pro61 in cis- or trans- conformation	X	X
6964	NMR Structure of the Rpa2829 protein from Rhodopseudomonas palustris: Northeast Structural Genomics Consortium Target RpR43	X	X
6965	1H and 15N assignment of the soluble domain of the ba3 oxidase subunit II of Thermus thermophilus in the oxidized state	X	X
6966	1H and 15N assignment of cytochrome c552 from Thermus thermophilus in the reduced state	X	X
6967	1H and 15N assignment of cytochrome c552 from Thermus thermophilus in the oxidized state	X	X
6968	1H, 13C and 15N assignment of C', CA, CB, N, HN, HA and HB of intrinsically disordered alpha-synuclein	X	X
6970	1H, 15N, 13C assignments for the activated form of the small Rho-GTPase Rac1	X	X
6971	NMR assignment of the b' domain of thermophilic fungal protein disulfide isomerase	X	X
6972	NMR assignment of the a' domain of thermophilic fungal protein disulfide isomerase	X	X
6973	human p23(1-119)	X	X
6974	human p23(1-160)	X	X
6975	1H chemical shift assignments for Bcl2MidG4	X		X
6980	Chemical Shift Assignment of human allograft inflammatory factor I	X	X
6981	Solution Structure of Monomeric BsaL, the Type III Secretion Needle Protein of Burkholderia pseudomallei	X	X
6982	Solution Structure of TA0895, an MoaD homologue from Thermoplasma acidophilum	X	X
6983	'Backbone 1H, 13C, 15N, and 13CB Chemical Shift Assignments for Azide-Inhibited P. aeruginosa Heme Oxygenase'	X	X
6984	1H, 13C, and 15N Chemical Shift Assignments of the cAMP-Binding Domain A of the PKA Regulatory Subunit	X	X
6985	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the human Hexim1 TBD	X	X
6986	NMR ASSIGNMENT OF THE PHOSPHOTYROSINE BINDING(PTB) DOMAIN OF TENSIN	X	X
6987	Backbone 1H, 13C, 15N, and 13CB Chemical Shift Assignments for Cyanide-Inhibited P. aeruginosa Heme Oxygenase	X	X
6988	1H, 13C, and 15N Chemical Shift Assignments for HGB1-UBA	X	X
6989	1H, 13C, and 15N Chemical Shift Assignments for Ribosomal Protein S24E	X	X
6990	1H, 15N and 13C resonance assignments of the cerato-platanin, a phytotoxic protein from Ceratocystis fimbriata	X	X
6992	Three-dimensional structure of the bacterial cell wall peptidoglycan	X				X
7000	Solution structure of the conserved hypothetical protein Rv2302 from the bacterium Mycobacterium tuberculosis	X	X
7002	1H, 13C, and 15N Chemical Shift Assignments for the Ede1 UBA-ubiquitin complex	X	X
7003	NMR backbone assignment of the human HSP90 N-terminal domain	X	X
7004	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Rhodopseudomonas palustrus protein Rpa0253. Northeast structural genomics target RpR3.	X	X
7005	The PP-fold Solution Structure of Human Polypeptide YY and Human Polypeptide YY 3-36 as Determined by NMR	X	X
7006	Structure of human PYY	X	X
7010	Solution Structure and Immune Response to an Epidermal Growth Factor Domain from Plasmodium Falciparum Merozoite Surface Protein 1	X	X
7011	Solution structure of 97-109 segment of staphylococcal nuclease	X	X
7012	Solution structure of 55-72 segment of staphylococcal nuclease	X	X
7013	1H, 15N, 13C resonance assignments for Bcl-xL protein 38 kDa dimer	X	X
7014	NMR assigment of the SARS-CoV protein nsp1	X	X
7015	NMR assignments for apo- and Ca2+ saturated paramecium calmodulin	X	X
7018	chemical shift values of the methyl groups of Met residues in the Ca2+-CaM-CaMKI-peptide complex	X	X
7019	NMR assignment of the protein nsp3a from SARS-CoV	X	X
7020	Chemical Shift Assignments for a Subunit of RNA Polymerase II	X	X
7021	Backbone dynamics and domain motions of the Mip protein from legionella pneumophilia in solution	X	X
7022	Letter to the Editor: 1H, 13C and 15N backbone resonance assignments of DUF589 domain from human HSPC144 protein	X	X
7023	Assignment of 1H,13C and 15N resonances for the REF2-I mRNA export factor	X	X
7024	Resonance assignments of the 34kD rabbitpox vCCI:human MIP-1b complex	X	X
7025	1H, 13C, and 15N Resonance Assignments of the VAP-A: OSBP Complex	X	X
7032	NMR Solution Structure, Dynamics and Binding Properties of the Kringle IV Type 8 module of apolipoprotein(a)	X	X
7033	GSPT1/eRF3a(PAM2-2)-PABC complex	X	X
7034	1H, 13C, and 15N chemical shift assignments for the zinc-finger region of human ZHX1	X	X
7035	Backbone 1H, 13C, and 15N Chemical Shift Assignments for 2nd SH3 domain of human NCK2 adaptor protein	X	X
7036	Backbone 1H, 13C, and 15N Chemical Shift Assignments for 3rd SH3 domain of human NCK2 adaptor protein	X	X
7050	Solution structure of growth-blocking peptide of the cabbage armyworm, Mamestra brassicae	X	X
7051	Solution structure of growth-blocking peptide of the tobacco cutworm, Spodoptera litura	X	X
7053	1H, 13C and 15N resonance assigned of a first cysteine catalytic half-domain of mouse ubiquitin-activating enzyme E1.	X	X
7054	NMR chemical shift assignments and structure determination of Xanthomonas campestris XCC1710: Northeast Structural Genomics Consortium Target XcR35	X	X
7055	1H, 13C, and 15N Chemical Shift Assignments for PTH from Mycobacterium tuberculosis H37Rv	X	X
7056	1H, 13C, 15N assignments of an independently folded C-terminal domain of influenza polymerase subunit PB2	X	X
7057	Chemical Shift Assignment for hbSBD	X	X
7058	Backbone 1H, 13C, and 15N Chemical Shift Assignments for calponin homology domain of human MICAL_1	X	X
7059	1H, 13C, and 15N Resonance Assignments of the Pyrazinamidase from Mycobacterium Tuberculosis	X	X
7061	NMR structure of talin-PTB in complex with PIPKI	X	X
7063	Solution NMR structure of the putative cytoplasmic protein ygaC from Salmonella typhimurium. Northeast Structural Genomics target StR72.	X	X
7064	Cycloviolacin O14	X	X
7065	Solution conformation of gaegurin4	X	X
7070	RRMs 1 and 2 of Prp24 from S. cerevisiae	X	X
7071	Backbone and Beta 1H, 13C, and 15N Chemical Shift Assignments for the Bacterial Antitoxin Kis	X	X
7072	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the PDZ domain of GOPC	X	X
7073	Structure Determination of a New Protein (PF1455) from Backbone-Centered NMR Data and NMR-Assisted Structure Prediction	X	X
7074	1H, 13C and 15N chemical shift assignments of the protein Pf0610 from pyrococcus furiosus	X	X
7075	Assignment of conserved hypothetical protein pa2412	X	X
7079	Sequence specific assignment of a hypothetical protein RP2812 (NESG ID: RPT4) from Rhodopseudomonas palustris	X	X
7080	Complex of TM1a(1-14)Zip with TM9a(251-284): a model for the polymerization domain ("overlap region")of tropomyosin	X	X
7082	1H, 13C, and 15N assignments for the Psuedomonas putida protein PutA45	X	X
7083	Chemical shifts of SBD from Rhizopu oryzae glucoamylase	X	X
7085	Assignment of hypothetical protein yst6499	X	X
7086	Assignment of hypothetical protein tm1012	X	X
7087	1H, 13C and 15N Assignments of the Dengue-4 Envelope Protein Domain III	X	X
7088	dynamics within the fMet-tRNA binding domain of translation initiation factor IF2 from Bacillus stearothermophilus	X	X
7089	1H, 13C, and 15N Peak Assignments of Human Macrophage Metalloelastase, in its inhibitor-free state	X	X
7091	Backbone 1H, 13C, and 15N Chemical Shift Assignments for GroES	X	X
7097	DNA recognition by the Brinker nuclear repressor - an extreme case of the coupling between binding and folding	X	X	X
7099	NMR Solution Structure of VP9 from White Spot Syndrome Virus	X	X
7101	Mistranslation of a computationally designed protein yields an exceptionally stable homodimer: Implications for protein evolution and engineering.	X	X
7102	High-resolution structural and thermodynamic analysis of extreme stabilization of human procarboxypeptidase by computational protein design	X	X
7103	1H, 15N and 13C assignments of the H98S mutant of acireductone dioxygenase from Klebsiella ATCC 8724	X	X
7104	1H and 15N Chemical Shift Assignments for the NCAM F3 module 2.	X	X
7105	1H, 13C and 15N chemical shift assignments for SRY.B in complex with 16-mer DNA	X	X	X
7106	NMR Assignment of human RGS18 (regulator of G-protein signalling)	X	X
7108	1H, 13C and 15N chemical shift assignments for TrxA (reduced form) from Bacillus subtilis	X	X
7109	1H, 13C and 15N chemical shift assignments for TrxA (oxidized form) from Bacillus subtilis	X	X
7112	1H, 13C, and 15N NMR Assignment of the Master-Rep Protein Nuclease Domain (2-95) from the Faba Bean Necrotic Yellows Virus	X	X
7115	1H, 13C and 15N resonance assignments of the apo-form of human eIF4E	X	X
7117	Complete 1H, 15N, and 13C chemical shift assignments for hybrid atracotoxin	X	X
7118	Solution structure of neurabin SAM domain	X	X
7119	NMR Assignment of the Human Cancer-Related Protein 32324	X	X
7120	The SAM domain of DLC1 defines a novel structure that interacts with elongation factor 1A1 at cortical actin and membrane ruffles	X	X
7123	1H Chemical shifts assignment of BR2, a toxin extracted from the venom of thespider Brachypelma runahui	X	X
7124	Solution Structure of MID1 B-box2 domain: A defining domain in TRIM/RBCC proteins reveals possible versatility in zinc-coordination	X	X
7125	Chemical Shifts Assignments of Human Adult Hemoglobin in the Carbonmonoxy Form	X	X
7126	1H,13C and 15N resonance assignments of barnase-barstar complex NMR deuterium methyl relaxation data for free barnase and barnase-barstar complex	X	X
7127	Fibronectin 2F3 chemical shift assignments	X	X
7128	Fibronecting 1F3-2F3 backbone chemical shift assignments	X	X
7129	Solution Structure and Folding Characteristics of the C-Terminal SH3 Domain of c-Crk-II	X	X
7130	Backbone NMR assignment of the 29.6 kDa Rhodanese protein from Azotobacter vinelandii	X	X
7131	Solution structure of IGF2R domain 11	X	X
7132	1H, 13C and 15N Chemical Shift Assignments for the CheA P1 domain from Thermotoga maritima	X	X
7133	Backbone 1H and 15N Chemical Shift Assignments for the CheA P4 domain from Thermotoga maritima, in the context of a P3P4 construct	X	X
7134	DNA recognition by the Brinker nuclear repressor - an extreme case of the coupling between binding and folding	X	X
7135	Assignments of 2SSalpha in 8M urea, pH 2, 293 K	X	X
7136	Assignments of 2SSbeta in 8M urea, pH 2, 293 K	X	X
7139	1H,13C and 15N resonance assignments of barnase-barstar complex NMR deuterium methyl relaxation data for free barnase and barnase-barstar complex	X	X
7140	Csk SH2 domain, free form	X	X
7141	SH2 domain of Human Csk, complex with Cbp	X	X
7142	rabbit prion protein (91-228)	X	X
7151	Backbone 1H, 13C, and 15N Chemical Shift Assignments for DLC2-SAM	X	X
7153	NMR spectroscopy of T4 Lysozyme peptide fragments	X	X
7158	Molecular characterization of the Ran binding zinc finger domain	X	X
7159	1H chemical shift assignments of 2SS[6-127, 30-115] at pH 3.8 and 25 C	X	X
7160	1H chemical shift assignments of metLYZ at pH 3.8 and 25 C	X	X
7161	Backbone 1H, 13C and 15N Chemical Shift Assignments of Ezrin C ERMAD in a non-covalent complex with Ezrin N FERM	X	X
7162	1H and 15N assignments for the b' domain of ERp57	X	X
7166	1H chemical shift assignments for CgNa an anemone toxin from Condylactis Gigantea	X	X
7167	1H, 15N, 13C resonance assignments for regeneration-induced CNPase homolog (RICH) protein	X	X
7170	1H, 13C, and 15N Chemical Shift Assignments for Bacillus subtilis Hypothetical Protein yvyC: Northeast Structural Genomics Consortium target SR482	X	X
7171	Proton chemical shift assignment for tachystatin B1	X	X
7172	Backbone and side-chain 1H, 13C and 15N resonance assignments of C-terminal domain of an actin monomer binding protein twinfilin	X	X
7173	'Proton chemical shift assignment for tachystatin B2'	X	X
7174	Chemical Shift Assignments for Hdm2 RING finger domain	X	X
7175	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Bacillus Subilis YorP	X	X
7176	1H Chemical Shift Assignments of an Antimicrobial Peptide, Fowlicidin-3	X	X
7178	Solution NMR structure of Q8ZP25 from Salmonella typhimurium LT2.	X	X
7186	Backbone 1H Chemical Shift Assignments for Magi 5	X	X
7187	NMR asigment of Ct-ole e 9, C terminal domain from the olive allergen Ole e 9	X	X
7189	NMR assignments of the low molecular weight protein tyrosine phosphatase from Campylobacter Jejuni	X	X
7191	1H, 13C, and 15N Chemical Shift Assignments for Pseudomonas aeruginosa Hypothetical Protein RPA1041: Northeast Structural Genomics Consortium target Pat90	X	X
7192	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Bacillus Subilis YqaI Dimer	X	X
7193	Sequence specific resonance assignments of a hypothetical protein PA1123 (NESG ID: PaT4) from Pseudomonas aeruginosa	X	X
7194	Transcription Factor IIIA zinc fingers 4-6 bound to 5S rRNA 55mer	X	X		X
7196	1H and 15N chemical shifts of NH groups in DHFR complexes with brodimoprim analogues 3-5, methotrexate and trimethoprim	X	X
7199	1H and 15N chemical shifts of NH groups in DHFR complexes with brodimoprim analogues 3-5, methotrexate and trimethoprim.	X	X
7200	1H and 15N chemical shifts of NH groups in DHFR complexes with brodimoprim analogues 3-5, methotrexate and trimethoprim	X	X
7201	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Bacillus subtilis YqbF	X	X
7202	Backbone 1H, 13C, and 15N Chemical Shift Assignments for dSUMO	X	X
7203	Backbone and sidechain 1H, 15N, and 13C chemical shift assignments for HOP	X	X
7204	Resonance assignments of a CoA binding protein from Klebsiella pneumoniae	X	X
7206	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Human RNase 7	X	X
7207	NMR assignments of the truncated human zeta-COP	X	X
7208	1H, 13C, 15N Chemical shift assignment for Glycophorine A in bicelles and micelles	X	X
7209	Assignment of 1H, 13C, and 15N resonances for the PilP pilot protein from Neisseria meningitidis.	X	X
7210	plant homeodomain finger of the tumour suppressor ING4	X	X
7211	1H and 15N Chemical Shift Assignments of Erabutoxin b	X	X
7212	Backbone 1H Chemical Shift Assignments for J1	X	X
7213	Backbone 1H Chemical Shift Assignments for J1cc	X	X
7214	Backbone 1H Chemical Shift Assignments for J3	X	X
7215	Backbone 1H Chemical Shift Assignments for J7	X	X
7219	NMR Data for the Human Ubiquitin-Conjugating Enzyme Variant hUev1a	X	X
7220	ephrinB2 ectodomain	X	X
7221	Amide chemical shifts of free and hyaluronan-bound Link_TSG6 at a range of pH values	X	X
7222	Amide chemical shifts of free and hyaluronan-bound Link_TSG6 at a range of pH values	X	X
7223	Solution NMR structure of the C-terminal domain of the interferon alpha-inducible ISG15 protein from Homo sapiens. Northeast Structural Genomics target HR2873B	X	X
7224	Solution NMR structure of Phage-like element PBSX protein xkdW, Northeast Structural Genomics Consortium Target SR355 (CASP Target)	X	X
7225	Solution NMR structure of the UPF0291 protein ynzC from Bacillus subtilis. Northeast Structural Genomics target SR384. (CASP Target)	X	X
7226	Solution NMR Structure of Conserved protein MTH1368, Northeast Structural Genomics Consortium Target TT821A	X	X
7227	Solution nmr structure of hypothetical protein yppE: Northeast Structural Genomics Consortium Target SR213	X	X
7228	Solution NMR structure of UPF0107 protein AF_0055, Northeast Structural Genomics Consortium Target GR101 (CASP Target)	X	X
7231	Solution structure of the heme-binding protein p22HBP	X	X
7235	Backbone 1H, 15N, and 13C assignments for beta phosphoglucomutase in the open form	X	X
7236	NMR Investigation of Tyr105 Mutants in TEM-1 beta-lactamase Suggests Active-Site Dynamical Coupling	X	X
7237	NMR Investigation of Tyr105 Mutants in TEM-1 beta-lactamase Suggests Active-Site Dynamical Coupling	X	X
7238	NMR Investigation of Tyr105 Mutants in TEM-1 beta-lactamase Suggests Active-Site Dynamical Coupling	X	X
7239	NMR Investigation of Tyr105 Mutants in TEM-1 beta-lactamase Suggests Active-Site Dynamical Coupling	X	X
7240	Backbone Assignment of the 98kDa homotrimeric yeast PCNA	X	X
7244	1H, 15N, 13C', 13CA and 13CB Chemical Shift Assignments of intrinsically disordered gamma-synuclein	X	X
7245	Structural and Functional Characterization of TM VII of the NHE1 Isoform of the Na+/H+ Exchanger	X	X
7246	Backbone assignments of the RUNT domain of the mouse PEBP2alpha protein	X	X
7247	Solution structure of a single chain diiron protein model	X	X
7248	1H, 13C, 15N Chemical Shift Assignments for Mesd12-155	X	X
7249	Complete 1H, 13C, and 15N Chemical Shift Assignments for the 15.5K Protein	X	X
7251	1H chemical shift assignments for wild type p53 tetramerization domain	X	X
7252	1H chemical shift assignments for p53 tetramerization domain mutant T329F Q331K	X	X
7253	1H chemical shift assignments for p53 tetramerization domain mutant T329V Q331K	X	X
7254	1H chemical shift assignments for p53 tetramerization domain mutant Y327S T329G Q331G	X	X
7255	1H chemical shift assignments for p53 tetramerization domain mutant Y327S T329E Q331G	X	X
7256	NMR structure of protein Hydrogenase-1 operon protein hyaE from Escherichia coli: Northeast Structural Genomics Consortium Target ER415	X	X
7257	Solution structure of the RRM domain of SR rich factor 9G8	X	X
7259	The solution structure of the BRCT domain from human polymerase reveals homology with the TdT BRCT domain	X	X
7260	Solution NMR structure of the YjcQ protein from Bacillus subtilis. Northeast Structural Genomics target SR346. (CASP Target)	X	X
7261	Solution NMR structure of protein ykfF from Escherichia coli. Northeast Structural Genomics target ER397. (CASP Target)	X	X
7262	NMR assignments of the the N-terminal subdomain of IGFBP-6	X	X
7263	Complete 1H assignment of Meg-A12	X	X
7266	Chemical shift assignments for protein NE1680 from Nitrosomonas europaea: Northeast Structural Genomics Consortium target NeT5	X	X
7269	1H, 13C, 15N sequence-specific backbone and sidechain resonance assignments for dockerin-containing C-terminal region of the NagH hyaluronidase from Clostridium perfringens	X	X
7270	1H, 13C, 15N sequence-specific backbone and sidechain resonance assignments for a putative protein-protein interaction module from a family 84 glycoside hydrolase of Clostridium perfringens	X	X
7271	Backbone and sidechain 1H, 13C and 15N resonance assignments of AF2241 from Archaeoglobus fulgidus	X	X
7272	Backbone and Side Chains Assignments of RGS10	X	X
7273	Solution structure of Jingzhaotoxin-III, a novel toxin inhibiting both Nav and Kv channels	X	X
7274	Solution NMR structure of the YdfO protein from Escherichia coli. Northeast Structural Genomics target ER251	X	X
7276	Complete 1H, 13C and 15N resonance assignments of Blo t 5, a major mite allergen from Blomia tropicalis.	X	X
7277	Backbone amide chemical shifts for dG85 T. thermophilus RNase H	X	X
7278	Backbone amide chemical shifts for iG80b E. coli RNase H	X	X
7279	NMR resonance assignments of the human non-chromitin architectural transcription factor HMGA1	X	X
7280	1H, 13C, and 15N chemical shift assignments for non-aromatic parts of GB1 domain	X	X
7281	NMR STRUCTURE OF PROTEIN YJBR FROM ESCHERICHIA COLI;NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET ER226	X	X
7282	Design of a-helical peptide based on conformationally restricted libraries	X	X
7283	The design of the beta-harpin and a-helix tethered by a 4Gly linker using conformationally restricted libraries	X	X
7284	The design of the beta-harpin and a-helix tethered by a 4Gly linker using conformationally restricted libraries	X	X
7285	1H, 13C and 15N assignments for a double dockerin domain	X	X
7286	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for CG7054	X	X
7288	1H, 13C, 15N Chemical Shift Assignments and 15N Relaxation Data for Transmembrane Domain of BNIP3	X	X
7293	Backbone 1H, 13C, and 15N chemical shift assignments for recoverin bound to rhodopsin kinase	X	X
7294	1H and 13C chemical shift assignments for the bacillomycin Lc	X	X
7295	1H chemical shift assignments and 3JHNHa coupling constants for the synthetic analogue SCP of the bacillomycin Lc.	X	X
7297	Assignment of conserved hypothetical protein RPA1320 from Rhodopseudomonas Palustris; Northeast Structural Genomics Consortium Target RPT3 / Ontario Center for Structural Proteomics Target RP1313	X	X
7298	1H, 13C, 15N-NMR resonance assignments for Znf-UBP domain of Ubp-M	X	X
7300	Solution Structure of the COMMD1 N-terminal domain	X	X
7301	Assignment of 1H, 13C, and 15N resonances for SF2/ASF RNA recognition motif 2(RRM2)	X	X
7303	1H, 13C and 15N resonance assignments for proapoptotic protein Nix (1~156) from Danio rerio	X	X
7304	beta-microseminoprotein	X	X
7305	R21A Spc-SH3 free	X	X
7306	R21A Spc-SH3 bound	X	X
7310	Automated structure based backbone and sidechain assignment of mitochondrial Cyclophilin D	X	X
7316	Backbone 1HN, 15N, and 13C Chemical Shift Assignments for wt Im7* (* denotes his-tag) and its variants, Im7L53AI54A and Im7YY	X	X
7317	Backbone 1HN, 15N, and 13C Chemical Shift Assignments for wt Im7* (* denotes his-tag) and its variants, Im7L53AI54A and Im7YY	X	X
7318	Backbone 1HN, 15N, and 13C Chemical Shift Assignments for wt Im7* (* denotes his-tag) and its variants, Im7L53AI54A and Im7YY	X	X
7319	Polymerase Beta and Double gap double hairpin DNA	X	X	X
7320	PufX structure	X	X
7321	Complete 1H 13C 15N chemical shift assignments for LDLa module from RXFP1	X	X
7322	Chemical Shift Assignments for calcium-free rat beta-parvalbumin	X	X
7323	1H, 13C and 15N nmr chemical shift assignments for the colicin immunity protein IM2	X	X
7324	NMR solution structure of mouse SelW	X	X
7325	Backbone and Ile(d1), Leu and Val Sidechain Resonance Assignments of the NUDIX Domain of Yeast Dcp2	X	X
7326	Homonuclear NMR Assignment of the Pheromone En-1	X	X
7327	Homonuclear NMR Assignment of the Pheromone En-2	X	X
7339	Solution structure of Arabidopsis thaliana protein At1g70830, a member of the major latex protein family	X	X
7340	NMR assignments for a helical diacylglycerol kinase (DAGK), 40 kDa membrane protein from E. coli	X	X
7342	SOLUTION STRUCTURE OF THE ZN COMPLEX OF HIV-2 NCP(23-49) PEPTIDE, ENCOMPASSING PROTEIN CCHC-LINKER, DISTAL CCHC ZN-BINDING MOTIF AND C-TERMINAL TAIL	X	X
7351	NMR STRUCTURE OF HUMAN RTF1 PLUS3 DOMAIN.	X	X
7352	SOLUTION STRUCTURE OF THE ZN COMPLEX OF EIAV NCP11(22-58) PEPTIDE, INCLUDING TWO CCHC ZN-BINDING MOTIFS.	X	X
7356	HN,CA,CB Chemical shift assignments for apo-Rat intestinal fatty acid binding protein, Clofibric acid-Rat intestinal fatty acid binding protein complex, Fenofibric acid-Rat intestinal fatty acid binding protein complex and Tolfenamic acid-Rat intestinal fatty acid binding protein complex.	X	X
7357	HN,CA,CB Chemical shift assignments for apo-Rat intestinal fatty acid binding protein, Clofibric acid-Rat intestinal fatty acid binding protein complex, Fenofibric acid-Rat intestinal fatty acid binding protein complex and Tolfenamic acid-Rat intestinal fatty acid binding protein complex.	X	X
7358	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the golli myelin basic protein isoform BG21	X	X
7359	1H, 15N and 13C chemical shift assignments for reduced and oxidised forms of the DsbA oxidoreductase from Vibrio cholerae	X	X
7360	1H, 15N and 13C chemical shift assignments for reduced and oxidised forms of the DsbA oxidoreductase from Vibrio cholerae	X	X
7362	NMR Structure of Protein UPF0165 protein AF_2212 from Archaeoglobus Fulgidus; Northeast Structural Genomics Consortium Target GR83	X	X
7365	Solution structure of Fe65 WW domain	X	X
7366	Solution Structure of Putative periplasmic protein: Northest Structural Genomics Target StR106	X	X
7367	Solution structure of a Beta-Hairpin Peptidomimetic Inhibitor of the BIV Tat-Tar Interaction	X	X
7371	Solution NMR Structure: Northeast Structural Genomics Consortium Target SiR5	X	X
7376	Resonance assignments of the metal sensor CzrA in the apo-, Zn2- and DNA-bound (42 kDa) states	X	X
7377	Resonance assignments of the metal sensor CzrA in the apo-, Zn2- and DNA-bound (42 kDa) states	X	X	X
7381	Calcium binding protein in the free form	X	X
7382	NMR Structure of RRM-2 of Yeast NPL3 Protein	X	X
7383	NMR Structure of RRM-1 of Yeast NPL3 Protein	X	X
7387	PIPdim 18	X	X
7388	sPLA2 inhibitor pip 17	X	X
7389	sPLA2 inhibitor 9	X	X
7390	Solution model of crosslinked complex of cytochrome c and adrenodoxin	X	X
7391	Electrostatic contributions to the stability of the GCN4 leucine zipper structure.	X	X
7395	Solution Structure of RWD/GI domain of Saccharomyces cerevisiae GCN2	X	X
7406	NMR resonance assignment of the Ccc2ab protein	X	X
7407	Backbone 1H, 13C, and 15N Chemical Shift Assignments for MxiD in complex with MxiM	X	X
7408	Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach	X	X
7409	Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach	X	X
7410	Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach	X	X
7411	Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach	X	X
7412	Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach	X	X
7413	Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach	X	X
7414	Evidence of reciprocical reorientation of the catalytic and hemopexin-like domains of full-length MMP-12	X	X
7415	Evidence of reciprocical reorientation of the catalytic and hemopexin-like domains of full-length MMP-12	X	X
7422	Pseudo Contact shifts and RDCs of Galectin-3 with C-terminal LBT tagged at a proton frequency of 600MHz.	X	X
7428	Local and global structure of the monomeric subunit of the potassium channel KcsA probed by NMR	X	X
7429	Backbone 1H and 15N Chemical Shift Assignments for the Phosphotyrosine Binding Domain of Insulin Receptor Substrate 1 in the Apo and Phosphopeptide Bound Forms	X	X
7430	Solution structure of Reduced ERp18	X	X
7432	Structural characterization of IscU and its interaction with HscB	X	X
7434	Backbone assignment of 3F5 heavy chain antibody fragment in its free form and in complex with PABPN1	X	X
7435	HVS ORF57 8-120 backbone assignment, in complex with REF2-I 54-155.	X	X
9500	Structure of actin-interacting domain of troponin	X	X
10001	A high resolution structure of mastoparan-X strongly bound to lipid-bilayer membrane determined by solid-state NMR	X	X
10004	1H, 13C and 15N resonance assignments of the 2'-5' RNA ligase-like protein from Pyrococcus furiosus	X	X
10005	1H, 13C, and 15N Chemical Shift Assignments for ChitinaseC chitin binding domain	X	X
10006	SOLUTION STRUCTURE OF FIBRONECTIN TYPE III DOMAIN OF MOUSE HYPOTHETICAL PROTEIN	X	X
10008	Solution structure of C-terminal fibronectin type III domain of mouse 1700129L13Rik protein	X	X
10009	Solution structure of SH3 domain of mouse Kalirin-9a protein	X	X
10010	bovine beta-lactoglobulin A34C mutant	X	X
10011	SOLUTION STRUCTURE OF THE SWIRM DOMAIN OF HUMAN LSD1	X	X
10012	Structure of actin-interacting domain of troponin	X	X
10013	Solution Structure Of The Ring Finger Domain Of The Human Kiaa1045 Protein	X	X
10014	Assignments of a GAAG tetraloop in helix 6 of SRP RNA from Pyrococcus furiosus	X			X
10015	Assignments of a HIV-1 integrase Zn finger domain mutant	X	X
10016	Backbone 1H, 13C and 15N Chemical Shift Assignments for the Nucleotide-Free Form of Human ABCB6 C-Terminal Domain	X	X
10017	Backbone 1H, 13C and 15N Chemical Shift Assignments for the ADP-BOUND Form of Human ABCB6 C-Terminal Domain	X	X
10018	1H Chemical Shift Assignments for LINE RNA	X			X
10019	GSPT1/eRF3a(PAM2-1)-PABC complex	X	X
10021	Backbone and sidechain 13C and 15N Chemical Shift Assignments of H+-ATP synthase subunit c in the solid state	X	X
10022	3D Structure of amyloid protofibrils of beta2-microglobulin fragment probed by solid-state NMR	X	X
10023	Chemical shift assignment of human eIF2alpha	X	X
10025	Solution structure of kinase associated domain 1 of mouse MAP/microtubule affinity-regulating kinase 3	X	X
10026	Solution structure of kinase associated domain 1 of mouse MAP/microtubule affinity-regulating kinase 3	X	X
10027	chemical shift assignment of DnaA domain I-II	X	X
10028	Solution structure of the second WW domain from mouse salvador homolog 1 protein (mm45).	X	X
10029	Solution structure of the fifth PDZ domain of human membrane associated guanylate kinase inverted-2 (KIAA0705 protein)	X	X
10030	Solution structure of the forth CH domain from human plastin 3 T-isoform	X	X
10031	Solution structure of the 2nd mbt domain from human KIAA1617 protein	X	X
10032	Solution structure of the first mbt domain from human KIAA1798 protein	X	X
10033	Soluiotn structure of J-domain of mouse DnaJ like protein	X	X
10034	Solution structure of Fibronectin type III domain derived from human KIAA0970 protein	X	X
10035	Solution structure of Lectin C-type domain derived from a hypothetical protein from C. elegans	X	X
10036	Solution structure of mouse CGI-38 protein	X	X
10037	Solution structure of the third mbt domain from human KIAA1798 protein	X	X
10038	Solution structure of zf-C2H2 domains from human Zinc finger protein 295	X	X
10039	Solution Structure of the Pleckstrin Homology Domain of Mouse Ethanol Decreased 4 Protein	X	X
10040	Solution Structure of the RA Domain of Human Grb7 Protein	X	X
10041	Solution Structure of the Tudor Domain from Mouse Hypothetical Protein Homologous to Histone Acetyltransferase	X	X
10042	Solution Structure of the CS Domain of Human KIAA1068 Protein	X	X
10043	Solution Structure of the N-terminal Domain of Mouse Putative Signal Recoginition Particle 54 (SRP54)	X	X
10044	Solution structure of homeobox domain of Arabidopsisthaliana zinc finger homeobox family protein	X	X
10045	Solution structure of homeobox domain of Arabidopsis thaliana hypothetical protein F22K18.140	X	X
10046	Solution structure of the PB1 domain of mouse mitogen activated protein kinase kinase 5 (MAP2K5)	X	X
10047	Solution Structure of the Homeobox Domain of Human Homeodomain Leucine Zipper-Encoding Gene (Homez)	X	X
10048	Solution Structure of the UBA Domain of Human Tudor Domain Containing Protein 3	X	X
10049	Solution structure of the N-terminal Domain I of mouse transcription elongation factor S-II protein 3	X	X
10050	Solution structure of N-terminal ubiquitin-like domain of human NEDD8 ultimate buster-1	X	X
10051	Backbone 1H and 15N assignment for the human c-Ha Ras (Y32W) in the GDP-bound state	X	X
10052	characterization of PCP-0SH in the D1 state was examined by using H/D exchange experiments.	X	X
10053	Backbone 1H, 13C, and 15N assignments of a 59 kDa Salmonella typhimurium periplasmic oligopeptide binding protein OppA	X	X
10054	Solution structure of the first cold-shock domain of the human KIAA0885 protein (UNR protein)	X	X
10055	Solution Structure of Glia Maturation Factor-gamma from Mus Musculus	X	X
10056	Solution structure of the Ras-binding domain of mouse RGS14	X	X
10057	Solution structure of Iron-sulfur cluster protein U (IscU)	X	X
10058	Solution Structure of the PICOT homology 2 domain of the mouse PKC-interacting cousin of thioredoxin protein	X	X
10059	Solution Structure of the Band 7 Domain of the mouse Flotillin 2 Protein	X	X
10060	Solution structure of hypothetical protein C330018D20Rik from Mus musculus	X	X
10061	Solution structure of PDZ domain of mouse Cypher protein	X	X
10063	Solution structure of the fourth SH3 domain of human intersectin 2 (KIAA1256)	X	X
10064	Solution Structure of The forth PDZ Domain of Human Atrophin-1 Interacting Protein 1 (KIAA0705 Protein)	X	X
10065	Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik)	X	X
10066	Solution structure of the third PDZ domain of human KIAA1526 protein	X	X
10067	Solution Structure of The FHA Domain of Arabidopsis thaliana Hypothetical Protein	X	X
10068	Solution Structure of the CH domain from Mouse Trangelin	X	X
10069	Solution structure of the Villin headpiece domain of human actin-binding LIM protein homologue (KIAA0843 protein)	X	X
10070	Solution structure of RRM domain in heterogeneous nuclear ribonucleoprotein H'	X	X
10071	Solution structure of RRM domain in RNA-binding protein NP_057951	X	X
10072	Solution structure of RRM domain in HNRPC protein	X	X
10073	C2 domain-containing protein from putative elicitor-responsive gene	X	X
10074	The first C2 domain of human synaptotagmin XIII	X	X
10075	The fourth FN3 domain of human sidekick-2	X	X
10076	The eighth FN3 domain of human sidekick-2	X	X
10077	Solution structure of the RNA binding domain of eukaryotic initiation factor 4B	X	X
10078	Backbone Resonance Assignments for LolA	X	X
10079	Solution structure of putative domain of human KIAA0561 protein	X	X
10080	Solution structure of mouse putative 42-9-9 protein	X	X
10081	Solution structure of the PDZ domain of mouse Rhophilin-2	X	X
10082	Solution structure of RRM domain in calcipressin 1	X	X
10083	PDZ domain of human RIM2B	X	X
10084	Nuclear move domain of nuclear distribution gene C homolog	X	X
10085	Solution structure of the first RRM domain in heterogeneous nuclear ribonucleoprotein H	X	X
10086	RA domain of guanine nucleotide exchange factor for Rap1	X	X
10087	Solution structure of C-terminal ubiquitin like domain of human 2'-5'-oligoadenylate synthetase-like protain (p59 OASL)	X	X
10088	Solution structure of the second PDZ domain of human scribble (KIAA0147 protein)	X	X
10089	Solution structure of phosphotyrosine interaction domain of mouse Numb protein	X	X
10090	Solution structure of hypothetical protein F20O9.120 from Arabidopsis thaliana	X	X
10091	Solution structure of the C-terminal ubiquitin-like domain of mouse tubulin-specific chaperone e	X	X
10092	Solution structure of the DEATH domain of Interleukin-1 receptor-associated kinase4 (IRAK4) from Mus musculus	X	X
10093	Solution structure of the second CUT domain of human Homeobox protein Cux-2	X	X
10094	Solution structure of the third CUT domain of human Homeobox protein Cux-2	X	X
10095	Solution structure of the KH domain of human ribosomal protein S3	X	X
10096	Backbone Resonance Assignments for LolB	X	X
10097	Solution Structure of the SH3 Domain Binding Glutamic Acid-rich Protein Like 3	X	X
10098	Solution Structure of The C1 Domain of The Human Diacylglycerol Kinase Delta	X	X
10099	Solution Structure of the First Fibronectin Type III domain of human KIAA1568 Protein	X	X
10100	Solution Structure of The Third PDZ Domain of Human Atrophin-1 Interacting Protein 1 (KIAA0705 Protein)	X	X
10101	Solution structure of four helical up-and-down bundle domain of the hypothetical rotein 2610208M17Rik similar to the protein FLJ12806	X	X
10102	Solution structure of the second fibronectin Type III domain of human KIAA1568 protein	X	X
10103	Solution structure of the fourth PDZ domain of human scribble (KIAA0147 protein)	X	X
10104	The forkhead associated (FHA) domain like structure from mouse polynucleotide kinase 3'-phosphatase	X	X
10105	Solution structure of the SWIB/MDM2 domain of the hypothetical protein At5g14170 from Arabidopsis thaliana	X	X
10106	Solution structure of the SWIB/MDM2 domain of the hypothetical protein At5g08430 from Arabidopsis thaliana	X	X
10107	Solution structure of the CH domain from mouse EB-1	X	X
10108	Solution Structure of DC1 Domain of PDI-like Hypothetical Protein from Arabidopsis thaliana	X	X
10109	Solution Structure of the PDZ Domain from Mouse Glutamate Receptor Interacting Protein 1A-L (GRIP1) Homolog	X	X
10110	Solution Structure of the Gas2 Domain of the Growth Arrest Specific 2 Protein	X	X
10111	Solution structure of the 6th HMG box of mouse UBF1	X	X
10112	Solution structure of the ubiquitin domain from mouse D7Wsu128e protein	X	X
10113	Solution Structure of the Pleckstrin Homology Domain of Mouse APS	X	X
10114	Solution Structure of the C-terminal Pleckstrin Homology Domain of Sbf1 from Mouse	X	X
10115	Solution Structure of the Pleckstrin Homology Domain of Oxysterol-Binding Protein-Related Protein 8 (KIAA1451 Protein)	X	X
10119	DnaJ domain of human KIAA0730 protein	X	X
10120	Solution structure of immunoglobulin like domain of mouse nuclear lamin	X	X
10121	Solution structure of a putative peptidyl-tRNA hydrolase domain in a mouse hypothetical protein	X	X
10122	Solution structure of the second SH3 domain of human intersectin 2 (KIAA1256)	X	X
10123	Solution structure of the PWWP domain of mouse Hepatoma-derived growth factor, related protein 3	X	X
10124	Solution structure of the second PDZ domain of human membrane associated guanylate kinase inverted-2 (MAGI-2)	X	X
10125	Solution structure of the dsRBD from hypothetical protein BAB26260	X	X
10126	Solution structure of the R3H domain from human hypothetical protein BAA76846	X	X
10127	Solution structure of the alpha-helical domain from mouse hypothetical PNPase	X	X
10128	Solution structure of the second FNIII domain of DSCAML1 protein	X	X
10129	Solution structure of the first Fn3 domain of Sidekick-2 protein	X	X
10130	Solution structure of a novel beta-grasp fold like domain of Hypothetical protein (Arabidopsis thaliana)	X	X
10131	Solution Structure of the N-terminal Pleckstrin Homology Domain Of TAPP2 from Mouse	X	X
10132	1H and 15N assignment of oxidized Pseudomonas aeruginosa cytochrome c551	X	X
10133	1H and 15N assignment of reduced Pseudomonas aeruginosa cytochrome c551	X	X
10134	1H and 15N assignment of oxidized Hydrogenobacter thermophilus cytochrome c552	X	X
10135	1H and 15N assignment of reduced Hydrogenobacter thermophilus cytochrome c552	X	X
10136	Solution structure of the first SH3 domain of human intersectin2 (KIAA1256)	X	X
10137	Lipocalin-type Prostaglandin D synthase	X	X
10138	Solution structure of the N-terminal domain of RimM from Thermus thermophilus HB8	X	X
10139	Backbone NMR assignments of RimM from Thermus thermophilus	X	X
10140	Backbone NMR assignments of of RimM complexed with rS19	X	X
10141	Solution structure of the alpha adaptinC2 domain from human Adapter-related protein complex 1 gamma 2 subunit	X	X
10142	Solution structure of the N-terminal extended 20th Filamin domain from human Filamin-B	X	X
10143	Solution structure of the 14th filamin domain from human Filamin-B	X	X
10144	Solution structure of the RhoGAP domain from human Rho GTPase activating protein 5 variant	X	X
10145	Solution structure of the N-teruminus extended RhoGAP domain from human Rho GTPase activating protein 5 variant	X	X
10146	Solution structure of the 21th filamin domain from human Filamin-B	X	X
10147	Solution structure of the CH domain from human Sperm flagellar protein 1	X	X
10148	Solution structure of three zf-C2H2 domains from mouse protein odd-skipped-related 2 splicing isoform 2	X	X
10149	Solution structure of the CH domain from human MICAL-2	X	X
10150	Solution structure of the SANT domain of fission yeast SPCC24B10.08c protein	X	X
10151	Solution structure of the C2H2 type zinc finger (region 887-919) of human Zinc finger protein 268	X	X
10152	Solution structure of the C2H2 type zinc finger (region 495-525) of human Zinc finger protein 268	X	X
10153	Solution structure of the C2H2 type zinc finger (region 519-551) of human Zinc finger protein 484	X	X
10154	Solution structure of the C2H2 type zinc finger (region 557-589) of human Zinc finger protein 473	X	X
10155	Solution structure of the C2H2 type zinc finger (region 603-635) of human Zinc finger protein 484	X	X
10156	Solution structure of the C2H2 type zinc finger (region 715-747) of human Zinc finger protein 484	X	X
10157	Solution structure of the C2H2 type zinc finger (region 626-654) of human B-cell lymphoma 6 protein	X	X
10158	Solution structure of the C2H2 type zinc finger (region 370-400) of human Zinc finger protein 473	X	X
10159	Solution structure of the 16th filamin domain from human Filamin-B	X	X
10160	Solution structure of the 17th filamin domain from human Filamin-B	X	X
10161	Solution structure of the 22th filamin domain from human Filamin-B	X	X
10162	Solution structure of the 23th filamin domain from human Filamin-B	X	X
10163	Solution structure of the 24th filamin domain from human Filamin-B	X	X
10164	Solution structure of the A1pp domain from human protein C6orf130	X	X
10165	Solution structure of the CBM_21 domain from human protein phosphatase 1, regulatory (inhibitor) subunit 3B	X	X
10166	Solution structure of the C2H2 type zinc finger (region 637-667) of human Zinc finger protein 268	X	X
10167	Solution structure of the C2H2 type zinc finger (region 584-616) of human Zinc finger protein 28 homolog	X	X
10168	Solution structure of the C2H2 type zinc finger (region 640-672) of human Zinc finger protein 28 homolog	X	X
10169	Solution structure of the C2H2 type zinc finger (region 171-203) of human Zinc finger protein 224	X	X
10170	Solution structure of the C2H2 type zinc finger (region 415-447) of human Zinc finger protein 28 homolog	X	X
10171	Solution structure of the C2H2 type zinc finger (region 311-343) of human Zinc finger protein 224	X	X
10172	Solution structure of the C2H2 type zinc finger (region 395-427) of human Zinc finger protein 224	X	X
10173	Solution structure of the C2H2 type zinc finger (region 592-624) of human Zinc finger protein 347	X	X
10174	Solution structure of the C2H2 type zinc finger (region 340-372) of human Zinc finger protein 347	X	X
10175	Solution structure of the C2H2 type zinc finger (region 556-588) of human Zinc finger protein 28 homolog	X	X
10176	Solution structure of the C2H2 type zinc finger (region 696-728) of human Zinc finger protein 28 homolog	X	X
10177	Solution structure of the C2H2 type zinc finger (region 687-719) of human Zinc finger protein 484	X	X
10178	Solution structure of the C2H2 type zinc finger (region 204-236) of human Zinc finger protein 473	X	X
10179	Solution structure of the C2H2 type zinc finger (region 724-756) of human Zinc finger protein 28 homolog	X	X
10180	Solution structure of the C2H2 type zinc finger (region 339-371) of human Zinc finger protein 224	X	X
10181	Solution structure of the C2H2 type zinc finger (region 367-399) of human Zinc finger protein 224	X	X
10182	Solution structure of the C2H2 type zinc finger (region 725-757) of human Zinc finger protein 473	X	X
10183	Solution structure of the C2H2 type zinc finger (region 379-411) of human Zinc finger protein 484	X	X
10184	Solution structure of the C2H2 type zinc finger (region 463-495) of human Zinc finger protein 484	X	X
10185	Solution structure of the C2H2 type zinc finger (region 607-639) of human Zinc finger protein 268	X	X
10186	Solution structure of the C2H2 type zinc finger (region 369-401) of human Zinc finger protein 95 homolog	X	X
10187	Solution structure of the C2H2 type zinc finger (region 479-511) of human Zinc finger protein 224	X	X
10188	Solution structure of the C2H2 type zinc finger (region 564-596) of human Zinc finger protein 347	X	X
10189	Solution structure of the C2H2 type zinc finger (region 341-373) of human Zinc finger protein 95 homolog	X	X
10190	Solution structure of the C2H2 type zinc finger (region 425-457) of human Zinc finger protein 95 homolog	X	X
10191	Solution structure of the C2H2 type zinc finger (region 719-751) of human Zinc finger protein 268	X	X
10192	Solution structure of the C2H2 type zinc finger (region 283-315) of human Zinc finger protein 224	X	X
10193	Solution structure of the Myb-like DNA-binding domain of human ZZZ3 protein	X	X
10194	Solution structure of the SH3 domain of mouse RUN and TBC1 domain containing 3	X	X
10195	Solution structure of the second SH3 domain of human Vinexin	X	X
10196	Solution structure of the C2H2 type zinc finger (region 768-800) of human Zinc finger protein 95 homolog	X	X
10197	Solution structure of the C2H2 type zinc finger (region 199-231) of human Zinc finger protein 224	X	X
10198	Solution structure of the C2H2 type zinc finger (region 423-455) of human Zinc finger protein 224	X	X
10199	Solution structure of the C2H2 type zinc finger (region 312-344) of human Zinc finger protein 347	X	X
10200	Solution structure of the C2H2 type zinc finger (region 342-372) of human Zinc finger protein 473	X	X
10201	Solution structure of the C2H2 type zinc finger (region 641-673) of human Zinc finger protein 473	X	X
10202	Solution structure of the C2H2 type zinc finger (region 491-523) of human Zinc finger protein 484	X	X
10203	Solution structure of the C2H2 type zinc finger (region 547-579) of human Zinc finger protein 484	X	X
10204	Solution structure of the C2H2 type zinc finger (region 612-644) of human Zinc finger protein 28 homolog	X	X
10205	Solution structure of the C2H2 type zinc finger (region 668-70) of human Zinc finger protein 28 homolog	X	X
10206	Solution structure of the C2H2 type zinc finger (region 780-812) of human Zinc finger protein 28 homolog	X	X
10207	Solution structure of the C2H2 type zinc finger (region 368-400) of human Zinc finger protein 347	X	X
10208	Solution structure of the C2H2 type zinc finger (region 315-345) of human Zinc finger protein 473	X	X
10209	Solution structure of the C2H2 type zinc finger (region 809-841) of human Zinc finger protein 473	X	X
10210	Solution structure of the C2H2 type zinc finger (region 528-560) of human Zinc finger protein 28 homolog	X	X
10211	Solution structure of the SH3 domain of human Tyrosine-protein kinase ITK/TSK	X	X
10212	Solution structure of the SH3 domain of the human SRC-like adopter protein (SLAP)	X	X
10213	Solution structure of the GUCT domain from human ATP-dependent RNA helicase DDX50, DEAD box protein 50	X	X
10214	Solution structure of the second WW domain from the human membrane-associated guanylate kinase, WW and PDZ domain-containing protein 1. MAGI-1	X	X
10215	Solution structure of the short-isoform of the second WW domain from the human membrane-associated guanylate kinase, WW and PDZ domain-containing protein 1 (MAGI-1)	X	X
10216	Solution structure of the C2H2 type zinc finger (region 411-441) of human Zinc finger protein 268	X	X
10217	Solution structure of the C2H2 type zinc finger (region 693-723) of human Zinc finger protein 268	X	X
10218	Solution structure of the C2H2 type zinc finger (region 355-385) of human Zinc finger protein 268	X	X
10219	Solution structure of the C2H2 type zinc finger (region 441-469) of human Zinc finger protein 268	X	X
10220	Solution structure of the C2H2 type zinc finger (region 397-429) of human Zinc finger protein 95 homolog	X	X
10221	Solution structure of the C2H2 type zinc finger (region 255-287) of human Zinc finger protein 224	X	X
10222	Solution structure of the C2H2 type zinc finger (region 775-807) of human Zinc finger protein 268	X	X
10223	Solution structure of the C2H2 type zinc finger (region 760-792) of human Zinc finger protein 347	X	X
10224	Solution structure of the C2H2 type zinc finger (region 859-889) of human Zinc finger protein 268	X	X
10225	Solution structure of the C2H2 type zinc finger (region 301-331) of human Zinc finger protein 268	X	X
10226	Solution structure of the C2H2 type zinc finger (region 273-303) of human Zinc finger protein 268	X	X
10227	Solution structure of the C2H2 type zinc finger (region 551-583) of human Zinc finger protein 268	X	X
10228	Solution structure of the C2H2 type zinc finger (region 628-660) of human Zinc finger protein 95 homolog	X	X
10229	Solution structure of the C2H2 type zinc finger (region 385-413) of human Zinc finger protein 268	X	X
10230	Solution structure of the C2H2 type zinc finger (region 563-595) of human Zinc finger protein 224	X	X
10231	Solution structure of the C2H2 type zinc finger (region 598-626) of human B-cell lymphoma 6 protein	X	X
10232	Solution structure of the C2H2 type zinc finger (region 796-828) of human Zinc finger protein 95 homolog	X	X
10233	Solution structure of the C2H2 type zinc finger (region 284-316) of human Zinc finger protein 347	X	X
10234	Solution structure of the C2H2 type zinc finger (region 648-680) of human Zinc finger protein 347	X	X
10235	Solution Structure of the C-terminal Phosphotyrosine Interaction Domain of APBB2 from Mouse	X	X
10236	Structure of the C-terminal PID Domain of Fe65L1 Complexed with the Cytoplasmic Tail of APP Reveals a Novel Peptide Binding Mode	X	X
10237	Solution structure of the chimera of the C-terminal PID domain of Fe65L and the C-terminal tail peptide of APP	X	X
10238	Solution structure of the chimera of the C-terminal tail peptide of APP and the C-terminal PID domain of Fe65L	X	X
10239	Solution structure of the chimera of the C-terminal tail peptide of APP and the C-terminal PID domain of Fe65L	X	X
10240	Solution structures of the SH3 domain of human Src substrate cortactin	X	X
10241	Solution structures of the SH3 domain of human rho guanine exchange factor (GEF) 16	X	X
10242	Solution structures of the PDZ domain of human Interleukin-16	X	X
10243	Solution structures of the C2H2 type zinc finger domain of human Zinc finger protein 24	X	X
10244	Solution structures of the C2H2 type zinc finger domain of human Zinc finger protein 462	X	X
10245	Solution structures of the SH3 domain of human megakaryocyte-associated tyrosine-protein kinase.	X	X
10246	Solution structures of the C2H2 type zinc finger domain of human Transcriptional repressor CTCF	X	X
10247	Solution structures of the LIM domain of human NEDD9 interacting protein with calponin homology and LIM domains	X	X
10248	Solution Structure of the HMG_box Domain of Murine Bobby Sox Homolog	X	X
10249	Solution structure of the C-terminal PH domain of human pleckstrin	X	X
10250	Solution structure of the PH domain of human Docking protein BRDG1	X	X
10251	Solution structure of the C-terminal PH domain of human pleckstrin 2	X	X
10252	Solution structure of the HMG_box domain of thymus high mobility group box protein TOX from mouse	X	X
10253	Solution structure of the PH domain of protein kinase C, D2 type from human	X	X
10254	Solution structure of the C-terminal PH domain of FYVE, RhoGEF and PH domain containing protein 3 (FGD3) from human	X	X
10255	Solution structure of the N-terminal PH domain of ARAP2 protein from human	X	X
10256	Solution structure of the C-terminal PH domain of hypothetical protein KIAA1914 from human	X	X
10257	Solution structures of the C2H2 type zinc finger domain of human zinc finger BED domain containing protein 2	X	X
10258	Solution structures of the fn3 domain of human ephrin type-B receptor 1	X	X
10259	Solution structures of the PDZ domain of human unnamed protein product	X	X
10260	Solution structures of the fn3 domain of human receptor-type tyrosine-protein phosphatase F	X	X
10261	Solution structures of the WHEP-TRS domain of human methionyl-tRNA synthetase	X	X
10262	Solution structures of the fn3 domain of human collagen alpha-1(XX) chain	X	X
10263	Solution structures of the 6th fn3 domain of human receptor-type tyrosine-protein phosphatase F	X	X
10264	The solution structure of the VHS domain of human Signal transducing adaptor molecule 2	X	X
10265	Solution structures of the fn3 domain of human receptor-type tyrosine-protein phosphatase F	X	X
10266	Solution structures of the fn3 domain of human receptor-type tyrosine-protein phosphatase F	X	X
10267	Solution structures of the PDZ domain of mus musculus PDZ domain-containing protein 1	X	X
10268	Solution structures of the CA domain of human protocadherin 9	X	X
10269	Solution structures of the Chromo domain of human chromodomain helicase-DNA-binding protein 4	X	X
10270	Solution structures of the fn3 domain of human contactin 1	X	X
10271	Solution structures of the fn3 domain of human collagen alpha-1(XX) chain	X	X
10272	Solution structures of the SH3 domain of human KIAA0418	X	X
10273	Solution structures of the TGS domain of human developmentally-regulated GTP-binding protein 1	X	X
10274	Solution structures of the fn3 domain of human collagen alpha-1(XX) chain	X	X
10275	Solution structures of the PAAD_DAPIN domain of mus musculus interferon-activatable protein 205	X	X
10276	Solution structure of the Tudor domain of Tudor domain containing protein 3 from mouse	X	X
10277	Solution structure of the Chromo domain of chromobox homolog 2 from human	X	X
10278	Solution structure of the PH domain of Pleckstrin homology domain-containing protein family B member 1 from mouse	X	X
10279	Solution structure of the PH domain of Docking protein 2 from human	X	X
10280	Solution structure of the PH domain of Oxysterol binding protein-related protein 11 from human	X	X
10281	Solution structure of the homeobox domain of the human paired box protein Pax-6	X	X
10282	Solution structure of the homeobox domain of the human hypothetical protein FLJ21616	X	X
10283	Solution structure of the first homeobox domain of AT-binding transcription factor 1 (ATBF1)	X	X
10284	Solution structure of the second homeobox domain of AT-binding transcription factor 1 (ATBF1)	X	X
10285	Solution structure of the third homeobox domain of AT-binding transcription factor 1 (ATBF1)	X	X
10286	Solution structure of the homeobox domain of the hypothetical protein, DKFZp686K21156	X	X
10287	Solution structure of the second homeobox domain of Zinc fingers and homeoboxes protein 3 (Triple homeobox 1 protein)	X	X
10288	Solution structure of the homeobox domain of Hepatocyte nuclear factor 1-beta (HNF-1beta)	X	X
10289	Solution structure of the homeobox domain of Zinc finger homeobox protein 1b (Smad interacting protein 1)	X	X
10290	The solution structure of the homeobox domain of human Homeobox protein DLX-5	X	X
10291	The solution structure of the homeobox domain of human homeobox protein TGIF2LX	X	X
10292	Solution structure of the third homeobox domain of Zinc fingers and homeoboxes protein 2	X	X
10293	Solution structure of the homeobox domain of LIM/homeobox protein Lhx9	X	X
10294	Solution structure of the homeobox domain of Homeobox protein OTX2	X	X
10295	Solution structure of the homeobox domain of Homeobox protein BarH-like 1	X	X
10296	Solution structure of the homeobox domain of Homeobox protein goosecoid	X	X
10297	Solution structure of the homeobox domain from human NIL-2-A zinc finger protein, transcription factor 8	X	X
10298	structure of the third Homeodomain from the human homeobox and leucine zipper protein, Homez	X	X
10299	Solution structures of the fn3 domain of human Tripartite motif protein 9	X	X
10300	Solution structures of the fn3 domain of human Proto-oncogene tyrosine-protein kinase MER precursor	X	X
10301	Solution structures of the SH3 domain of human Crk-like protein	X	X
10302	Solution structures of the SH3 domain of human SH3-containing GRB2-like protein 2	X	X
10303	Solution structure of the C2H2 type zinc finger (region 752-784) of human Zinc finger protein 28 homolog	X	X
10304	Solution structure of the C2H2 type zinc finger (region 544-576) of human Zinc finger protein 95 homolog	X	X
10305	Solution structure of the C2H2 type zinc finger (region 536-568) of human Zinc finger protein 347	X	X
10306	Solution structure of the 1st zf-C2H2 domain from Human B-cell lymphoma 6 protein	X	X
10307	Solution structure of the C2H2 type zinc finger (region 426-458) of human Zinc finger protein 473	X	X
10308	Solution structure of the C2H2 type zinc finger (region 484-512) of human Zinc finger protein 473	X	X
10309	Solution structure of the C2H2 type zinc finger (region 771-803) of human Zinc finger protein 484	X	X
10310	Solution structure of the C2H2 type zinc finger (region 396-428) of human Zinc finger protein 347	X	X
10311	Solution structure of the PH domain of PEPP-3 from human	X	X
10312	Solution structure of the PH domain of Protein kinase C, nu type from human	X	X
10313	Solution structure of the PH domain of PIP2-dependent ARF1 GTPase-activating protein from human	X	X
10314	Solution structure of the PH domain of Evectin-2 from mouse	X	X
10315	Solution structure of the PH domain of Rho GTPase activating protein 21 from human	X	X
10316	Solution structure of the PH domain of TBC1 domain family member 2 protein from human	X	X
10317	Solution structure of the PH domain of pleckstrin homology domain-containing protein family A member 5 from human	X	X
10318	Solution structure of the PTB domain of KIAA1075 protein from human	X	X
10319	Solution structure of the PH domain of KIAA0640 protein from human	X	X
10320	Solution structure of the 9th filamin domain from human Filamin-B	X	X
10321	Solution structure of the 11th filamin domain from human Filamin-B	X	X
10322	Solution structure of the 12th filamin domain from human Filamin-B	X	X
10323	Solution structure of the 13th filamin domain from human Filamin-B	X	X
10324	Solution structure of the 20th Filamin domain from human Filamin-B	X	X
10325	Solution structure of the 15th Filamin domain from human Filamin-B	X	X
10326	Solution structure of the 18th Filamin domain from human Filamin-B	X	X
10327	Solution structure of the filamin domain from human tripartite motif protein 45	X	X
10328	Solution structure of the 14th Filamin domain from human Filamin C	X	X
10329	Solution structure of the 16th Filamin domain from human Filamin C	X	X
10330	Solution structure of the 17th Filamin domain from human Filamin C	X	X
10331	Solution structure of the 22th Filamin domain from human Filamin C	X	X
10332	Solution structure of the 23th Filamin domain from human Filamin C	X	X
10333	Solution structure of the filamin domain from human BK158_1 protein	X	X
10334	Solution structure of the 19th filamin domain from human Filamin-B	X	X
10335	Solution structure of the 10th filamin domain from human Filamin-B	X	X
10336	Solution structure of the DUF1000 domain of a thioredoxin-like protein 1	X	X
10337	Solution structure of SH3 domain in Suppressor of T-cell receptor signaling 1	X	X
10338	Solution Structure of the First UBA Domain in the Human Ubiquitin Specific Protease 5 (Isopeptidase 5)	X	X
11000	C-Terminal Domain of Epsilon Subunit of F1F0-ATP Synthase from The Thermophilic Bacillus PS3 WITH ATP	X	X
11002	NMR structure of the antimicrobial peptide RP-1 bound to SDS micelles	X	X
11003	NMR structure of the antimicrobial peptide RP-1 bound to DPC micelles	X	X
11004	NMR Structure of Ebola fusion peptide in SDS micelles at pH 7	X	X
11005	Solution structure of a bent alpha-helix	X	X
11007	FBP28WW2 domain in complex with PTPPPLPP peptide	X	X
11008	FBP28WW2 domain in complex with a PPPLIPPPP peptide	X	X
11009	SOLUTION STRUCTURE OF THE LSM DOMAIN OF Dm EDC3 (ENHANCER OF DECAPPING 3)	X	X
11010	Rac1/PRK1 Complex	X	X
11013	The dynein stalk head, the microtubule binding domain of dynein, derived from mouse	X	X
11016	Humal Insulin Mutant B31Lys -B32Arg	X	X
11017	NMR solution structure of TnpE protein from Shigella flexneri. Northeast Structural Genomics Target SfR125.	X	X
11018	NMR structure note: murine Itk SH3 domain	X	X
11019	Cox17	X	X
11020	Solution structure of human Cu(I)Cox17	X	X
11021	NMR STRUCTURE OF THE MUTANT OF CHIGNOLIN, CLN025	X	X
11022	1H chemical shift assignment for big defensin	X	X
11024	NMR STRUCTURE OF THE S. AUREUS VRAR DNA BINDING DOMAIN	X	X
11026	SOLUTION STRUCTURE OF ALPHA-SPECTRIN SH3-BERGERAC FROM CHICKEN	X	X
11027	SPECTRIN SH3 CHIMERA WITH A LIGAND LINKED TO BE BOUND IN ORIENTATION II	X	X
11031	The solution structure of phtotactic transducer protein HtrII linker region from Natronomonas pharaonis	X	X
11032	Solution structure of the knotted tudor domain of the yeast histone acetyltransferase protein, Esa1	X	X
11033	Solution structure of the presumed chromodomain of the yeast histone acetyltransferase protein, Esa1	X	X
11035	1H, 13C, and 15N chemical shift assignments for Thermus thermophilus HB8 TTHA1718 protein	X	X
11037	1H, 13C, and 15N chemical shift assignments for Thermus thermophilus HB8 TTHA1718 protein in living E. coli cells	X	X
11038	The DNA binding domain of RTBP1	X	X
11043	Structure of chimeric variant of SH3 domain - SHH	X	X
11045	Mhr1p-bound ssDNA	X	X	X
11046	hsRad51-bound ssDNA	X	X	X
11047	RecO-bound ssDNA	X	X	X
11048	RecT-bound ssDNA	X	X	X
11053	Chemical shifts assignment for the West Nile virus NS2B(K96A)-NS3 protease	X	X
11054	Solution structure of a novel insect chemokine isolated from integument	X	X
11055	NMR structure of Grb2 SH2 domain complexed with the inhibitor	X	X
11056	KMTM7 a peptide derived from V-ATPase subunit a, putative TM7	X	X
11057	MICROTUBULE BINDING DOMAIN OF DYNEIN-C	X	X
11058	Chemical shift assignment of PACAP21 bound to phospholipid membranes by magic angle spinning solid-state NMR	X	X
11059	Chemical shift assignment of PACAP27 bound to phospholipid membranes by magic angle spinning solid-state NMR	X	X
11061	Solution structure of the monomeric form of mouse APOBEC2	X	X
11062	Solution structure of mouse lipocalin-type prostaglandin D synthase possessing a intrinsic disulfide bond.	X	X
11063	Backbone 1H, 13C, and 15N Chemical Shift Assignments for KP-PmrD	X	X
11065	Solution structure of the 4.1R FERM alpha lobe domain	X	X
11067	Backbone resonance assignments for the cytoplasmic regions of G protein-activated inwardly rectifying potassium channel1 (GIRK1)	X	X
11068	solution structure of 1-23 GBP (growth-blocking peptide)	X	X
11069	solution structure of 1-28 GBP (growth-blocking peptide)	X	X
11070	DPC micelle bound structure of 1-28 GBP (growth-blocking peptide)	X	X
11072	The solution structure of the N-terminal fragment of big defensin	X	X
11074	Chemical shifts assignment for the segmentally labelled beta subunit (391-473 residues) of the F1-ATPase in the F1 complex	X	X
11076	NMR based model structure of mesoderm development (MESD) in solution.	X	X
11077	Solution structure of the E. coli ribosome hibernation promoting factor HPF	X	X
11078	Solution structure of the TIR domain of human MyD88	X	X
11080	3D structure of Pin from the psychrophilic archeon Cenarcheaum symbiosum (CsPin)	X	X
11083	Solution structure of the Leucine Rich Repeat of human Acidic leucine-rich nuclear phosphoprotein 32 family member B	X	X
11084	Solution structure of the CH domain of human calponin-2	X	X
11085	Solution structure of the CH domain of human NEDD9 interacting protein with calponin homology and LIM domains	X	X
11086	Solution structure of the CH domain of human microtubule-associated protein RP/EB family member 3	X	X
11087	Solution structure of the PH domain of Kindlin-3 from human	X	X
11088	Solution structure of the PH domain of Dynamin-2 from human	X	X
11089	Solution structure of the PH domain of Pleckstrin homology domain-containing family A member 6 from human	X	X
11090	Solution structure of the N-terminal PapD-like domain of HYDIN protein from human	X	X
11091	Solution structure of the C-terminal PapD-like domain from human HYDIN protein	X	X
11092	Solution structure of the chromo domain of Mortality factor 4-like protein 1 from human	X	X
11093	Solution structure of the BTK motif of tyrosine-protein kinase ITK from human	X	X
11094	Solution structure of the complex of the PTB domain of SNT-2 and 19-residue peptide (aa 1571-1589) of hALK	X	X
11095	Solution structure of the chimera of the PTB domain of SNT-2 and 19-residue peptide (aa 1571-1589) of hALK	X	X
11096	Solution structure of the first fibronectin type III domain of human Netrin receptor DCC	X	X
11097	Solution structure of the fifth fibronectin type III domain of human Netrin receptor DCC	X	X
11098	Solution structure of the sixth fibronectin type III domain of human Netrin receptor DCC	X	X
11099	Solution structure of the fourth fibronectin type III domain of human Netrin receptor DCC	X	X
11100	The solution structure of the first thioredoxin domain of mouse Protein disulfide-isomerase A6	X	X
11101	The solution structure of the first thioredoxin domain of mouse Protein disulfide-isomerase A4	X	X
11102	The solution structure of the second thioredoxin domain of human Protein disulfide-isomerase A3	X	X
11103	Solution structure of the second fibronectin type III domain of human Netrin receptor DCC	X	X
11104	The solution structure of the second thioredoxin domain of mouse Protein disulfide-isomerase A4	X	X
11105	The solution structure of the thioredoxin domain of human Thioredoxin-related transmembrane protein 2	X	X
11106	The solution structure of the FN3 domain of human Midline 2 protein	X	X
11107	The solution structure of the third thioredoxin domain of human Thioredoxin domain-containing protein 5	X	X
11108	The solution structure of the thioredoxin domain of human Thioredoxin-like protein 2	X	X
11109	The solution structure of the third thioredoxin domain of mouse Protein disulfide-isomerase A4	X	X
11110	The solution structure of the 33rd fibronectin type III domain of human Tenascin-X	X	X
11111	The solution structure of the sixth fibronectin type III domain of human Neogenin	X	X
11112	The solution structure of the fourth fibronectin type III domain of human Neogenin	X	X
11113	The solution structure of the thioredoxin-like domain of human Thioredoxin-related transmembrane protein	X	X
11114	The solution structure of the second thioredoxin-like domain of human Protein disulfide-isomerase	X	X
11115	Complex structure of the zf-CW domain and the H3K4me3 peptide	X	X
11116	The solution structure of the second thioredoxin-like domain of human Protein disulfide-isomerase A6	X	X
11117	The solution structure of the second fibronectin type III domain of mouse Ephrin type-A receptor 1	X	X
11118	The solution structure of the fifth fibronectin type III domain of human Neogenin	X	X
11119	The solution structure of the first fibronectin type III domain of human Neogenin	X	X
11120	The solution structure of the third fibronectin type III domain of human Neogenin	X	X
11121	The solution structure of the second fibronectin type III domain of human Neogenin	X	X
11122	The solution structure of the tetratrico peptide repeat of human Smooth muscle cell associated protein-1, isoform 2	X	X
11123	Solution structure of the SANT domain of human SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily C member 1	X	X
11124	Solution structure of the CH domain of human Calponin 1	X	X
11125	Solution structure of the 6th fibronectin type III domain from human fibronectin type III domain containing protein 3	X	X
11126	Solution structure of the second CH domain of human spectrin beta chain, brain 2	X	X
11127	Solution structure of the 2nd fibronectin type III domain from mouse biregional cell adhesion molecule-related/down-regulated oncogenes (Cdon) binding protein	X	X
11128	Solution structure of the 3rd fibronectin type III domain from mouse biregional cell adhesion molecule-related/down-regulated oncogenes (Cdon) binding protein	X	X
11129	Solution structure of the CH domain of human Rho guanine nucleotide exchange factor 6	X	X
11130	Solution structure of two zf-C2H2 domains from human Zinc finger protein 512	X	X
11131	Solution structure of the FYVE domain from human FYVE domain containing 27 isoform b protein	X	X
11132	Solution structure of the HMG box like domain from human hypothetical protein FLJ14904	X	X
11133	Solution structure of the fourth CH domain from human L-plastin	X	X
11134	Solution structure of the HMG box domain from human WD repeat and HMG-box DNA binding protein 1	X	X
11135	Solution structure of the 8th KH type I domain from human Vigilin	X	X
11136	Solution structure of the 12th KH type I domain from human Vigilin	X	X
11137	Solution structure of the 14th KH type I domain from human Vigilin	X	X
11138	Solution structure of the 13th KH type I domain from human Vigilin	X	X
11139	Solution structure of the 1st KH type I domain from human Vigilin	X	X
11140	Solution structure of the 4th KH type I domain from human Vigilin	X	X
11141	Solution structure of the CH domain from human Vav-3 protein	X	X
11142	Solution structure of the CH domain from human Smoothelin splice isoform L2	X	X
11143	Solution structure of the CH domain from human MICAL-3 protein	X	X
11144	Solution structure of the DnaJ domain from human Williams-Beuren syndrome chromosome region 18 protein	X	X
11145	Solution structure of the CH domain from human EH domain binding protein 1	X	X
11146	Solution structure of the eIF-5_eIF-2B domain from human Eukaryotic translation initiation factor 5	X	X
11147	Solution structure of the tandem HMG box domain from Human High mobility group protein B1	X	X
11148	Solution structure of the TIG domain from Human Nuclear factor of activated T-cells, cytoplasmic 4	X	X
11150	Solution structure of the Somatomedin B domain of human Ectonucleotide pyrophosphatase/phosphodiesterase family member	X	X
11151	Solution structure of the first Phorbol esters/diacylglycerol binding domain of human Protein kinase C, delta	X	X
11152	Solution structure of the fibronectin type III domain of human Integrin beta-4	X	X
11153	Solution structure of the SH3 domain of 130 kDa phosphatidylinositol 4,5-biphosphate-dependent ARF1 GTPase-activating protein	X	X
11154	Solution structure of the SH3 domain of Sorbin and SH3 domain-containing protein 1	X	X
11155	Solution structure of the SH3 domain of Abl interactor 2 (Abelson interactor 2)	X	X
11156	Solution structure of the SH3 domain of human Nostrin	X	X
11157	Solution structure of the BTK motif of human Cytoplasmic tyrosine-protein kinase BMX	X	X
11158	Solution structure of the HMG box of human Transcription factor SOX-17	X	X
11159	Solution structure of the Ring finger of human Retinoblastoma-binding protein 6	X	X
11160	Solution structure of the HMG box of human Myeloid/lymphoid or mixed-lineage leukemia protein 3 homolog	X	X
11161	Solution structure of the Zinc finger, C3HC4 type (RING finger) domain Tripartite motif protein 30	X	X
11162	Solution structure of the Zinc finger, C3HC4 type (RING finger) domain of RING finger protein 126	X	X
11163	Solution structure of the Zinc finger, C3HC4 type (RING finger) domain of Tripartite motif-containing protein 5	X	X
11164	Solution structure of the Zinc finger, C3HC4 type (RING finger) domain of TNF receptor-associated factor 3	X	X
11165	Solution structure of the C2H2 type zinc finger (region 329-359) of human Zinc finger protein 268	X	X
11166	Solution structure of the C2H2 type zinc finger (region 581-609) of human Zinc finger protein 268	X	X
11167	Solution structure of the C2H2 type zinc finger (region 508-540) of human Zinc finger protein 347	X	X
11168	Solution structure of the C2H2 type zinc finger (region 732-764) of human Zinc finger protein 347	X	X
11169	Solution structure of the C2H2 type zinc finger (region 435-467) of human Zinc finger protein 484	X	X
11170	Solution structure of the C2H2 type zinc finger (region 631-663) of human Zinc finger protein 484	X	X
11171	Solution structure of the C2H2 type zinc finger (region 659-691) of human Zinc finger protein 484	X	X
11173	Solution Structure of the First UBA Domain in the Human Ubiquitin Specific Protease 5 (Isopeptidase 5)	X	X
11176	Solution Structure of RNA aptamer against AML1 Runt domain	X			X
11177	Backbone chemical shift assignments for Thermus thermophilus RecO	X	X
11178	Solution structure of the SH3 domain of human olygophrein-1 like protein (KIAA0621)	X	X
11179	Solution structure of the SH3 domain of SH3-domain kinase binding protein 1	X	X
11180	Solution structure of the first SH3 domain of KIAA0318 protein	X	X
11181	Solution structure of the fourth fn3 domain of KIAA1496 protein	X	X
11182	Solution structure of the PDZ domain of human KIAA0340 protein	X	X
11183	Solution structure of the FNIII domain of human RIM-binding protein 2	X	X
11184	Solution structure of the second SH3 domain of human RIM-binding protein 2	X	X
11185	Solution structure of the third SH3 domain of human RIM-binding protein 2	X	X
11186	Solution structure of the fifth PDZ domain of InaD-like protein	X	X
11187	Solution structure of the 7th PDZ domain of InaD-like protein	X	X
11188	Solution structure of the first PDZ domain of InaD-like protein	X	X
11189	Solution structure of the second PDZ domain of human InaD-like protein	X	X
11190	Solution structure of the third PDZ domain of human InaD-like protein	X	X
11191	Solution structure of the eighth PDZ domain of human InaD-like protein	X	X
11192	Solution structure of the Ig-like domain(433- 525) of murine myosin-binding protein C, fast-type	X	X
11193	Solution structure of the first SH3 domain from human KIAA0418 protein	X	X
11194	Solution structure of the fifth SH3 domain from human KIAA0418 protein	X	X
11195	Solution structure of the PDZ domain of human Rho guanine nucleotide exchange factor 11	X	X
11196	Solution structure of the third SH3 domain from human KIAA1666 protein	X	X
11197	Solution structure of the sixth PDZ domain of human InaD-like protein	X	X
11198	Solution structure of the third PDZ domain of synapse-associated protein 102	X	X
11199	Solution structure of the PDZ domain of Enigma homologue protein	X	X
11200	Solution structure of the PDZ domain of Pals1 protein	X	X
11201	Solution structure of the fourth PDZ domain of KIAA1095 protein	X	X
11202	Solution structure of the PDZ domain of Spinophilin/NeurabinII protein	X	X
11203	Solution structure of the core domain of calcyclin binding protein; siah-interacting protein (SIP)	X	X
11204	Solution structure of the second PDZ domain of harmonin protein	X	X
11205	Solution structure of the first and second zf-C2H2 domain of Zinc finger protein 435	X	X
11206	Solution structure of the fourth PDZ domain of Glutamate receptor interacting protein 2	X	X
11207	Solution structure of the first PDZ domain of scribble homolog protein (hScrib)	X	X
11208	Solution structure of the second fn3 domain of Eph receptor A8 protein	X	X
11209	Solution structure of the SH3 domain of Endophilin B1 (Sh3g1b1)	X	X
11210	Solution structure of the first PDZ domain of amyloid beta A4 precursor protein-binding family A, member 1	X	X
11211	Solution structure of the third ig-like domain of Myosin-dinding protein C, slow-type	X	X
11212	Solution structure of the first ig-like domain of Myosin-binding protein C, slow-type	X	X
11213	Solution structure of the SH3 domain of Hypothetical protein SH3YL1	X	X
11214	Solution structure of the SH3 domain of Fyn-related kinase	X	X
11215	Solution structure of the PDZ domain of T-cell lymphoma invasion and metastasis 1 varian	X	X
11216	Solution structure of the third PDZ domain of PDZ domain containing protein 1	X	X
11217	Solution structure of the first SH3 domain of Stac protein	X	X
11218	Solution structure of the CIDE-N domain of human cell death activator CIDE-A	X	X
11219	Solution structure of the first SH3 domain of human sorbin and Sh3 domain-containing protein 1	X	X
11220	Solution structure of the second SH3 domain of human KIAA0769 protein	X	X
11221	Solution structure of the Ig-like domain (615-713) from human Obscurin-like protein 1	X	X
11222	Solution structure of the first SH3 domain of human KIAA0769 protein	X	X
11223	Solution structure of the Ig-like domain of human Leucine-rich repeat-containing protein 4	X	X
11224	Solution structure of the SH3 domain from Phospholipase C, gamma 2	X	X
11225	Solution structure of the SH3 domain of human SLIT-ROBO Rho GTPase-activating protein 2	X	X
11226	Solution structure of the PDZ domain from Human MAGUK p55 subfamily member 2	X	X
11227	Solution structure of the second fn3 domain from human Ephrin type-B receptor 4	X	X
11228	Solution structure of the SH3 domain from Rho guanine nucleotide exchange factor 9	X	X
11229	Solution structure of the Ig-like domain (714-804) from human Obscurin-like protein 1	X	X
11230	Solution structure of the 6th Ig-like domain from human KIAA1556	X	X
11231	Solution structure of the PKD domain from KIAA 1837 protein	X	X
11232	Solution structure of the PKD domain (329-428) from human KIAA0319	X	X
11233	Solution structure of the SH3 domain of human KIAA1783 protein	X	X
11234	Solution structure of the RING domain (1-66) from tripartite motif-containing protein 31	X	X
11235	Solution structure of the 6th Ig-like domain from human Myosin-binding protein C, fast-type	X	X
11236	Solution structure of the fourth Ig-like domain from myosin light chain kinase, smooth muscle	X	X
11237	Solution structure of the first and second PHD domain from Myeloid/lymphoid or mixed-lineage leukemia protein 3 homolog	X	X
11238	Solution structure of the C2H2-type zinc finger domain (699-729) from zinc finger protein 473	X	X
11239	Solution structure of the C2H2-type zinc finger domain (781-813) from zinc finger protein 473	X	X
11240	Solution structure of the e3_binding domain of dihydrolipoamide branched chaintransacylase	X	X
11242	Solution structure of the first SH3 domain of human vinexin	X	X
11244	Solution structure of the first SANT domain from human nuclear receptor corepressor 1	X	X
11245	Solution Structure of the murine ubiquitin-like 5 protein from RIKEN cDNA 0610031K06	X	X
11246	Solution structure of the FHA domain of mouse Afadin 6	X	X
11247	Solution structure of the FHA domain of human ubiquitin ligase protein RNF8	X	X
11248	Solution structure of the PDZ domain from mouse LIM domain kinase	X	X
11249	Assignment of holo form GrxS14 from Populus trichocarpa	X	X
11251	The solution structure of the C-terminal region of Zinc finger FYVE domain-containing protein 21	X	X
11252	Resonance assignments of HRDC domain from Bloom syndrome protein	X	X
11253	Solution Structure of the Ubiquitin-like Domain from Mouse Hypothetical 1700011N24Rik Protein	X	X
11254	Solution Structure of a N-terminal Ubiquitin-like Domain in Mouse Tubulin-specific Chaperone B	X	X
11255	Solution Structure of Anticodon Binding Domain from Nuclear Receptor Coactivator 5 (Human KIAA1637 Protein)	X	X
11256	Solution Structure of the N-terminal Ubiquitin-like Domain of Mouse Ubiquitin Specific Protease 14 (USP14)	X	X
11257	Solution Structure of Mouse Ubiquitin-like 3 Protein	X	X
11258	Solution Structure of Mouse Hypothetical Protein 2900073H19RIK	X	X
11259	Solution Structure of CUE domain in the C-terminal of Human Toll-interacting Protein (Tollip)	X	X
11260	Solution Structure of UBA domain of Human Ubiquitin Associated Protein 1 (UBAP1)	X	X
11261	Solution Structure of the N-terminal Ubiquitin-like Domain in the Human Ubiquilin 3 (UBQLN3)	X	X
11262	Solution Structure of the N-terminal Ubiquitin-like Domain in the 4931431F19Rik Protein	X	X
11263	Solution Structure of the N-terminal Ubiquitin-like Domain in the Human BAT3 Protein	X	X
11264	Solution Structure of Ras-binding Domain in Mouse AF-6 Protein	X	X
11265	Solution Structure of the N-terminal Ras-binding Domain (RBD) in Human a-Raf Kinase	X	X
11266	Solution Structure of the N-terminal Ubiquitin-like Domain in Human Np95/ICBP90-like Ring Finger Protein (NIRF)	X	X
11267	Solution Structure of Human SUMO-2 (SMT3B), a Ubiquitin-like Protein	X	X
11268	Solution Structure of the N-terminal Ubiquitin-like Domain in Mouse Ubiquitin-like Protein SB132	X	X
11269	Solution Structure of the N-terminal CUE Domain in the Human Mitogen-activated Protein Kinase Kinase Kinase 7 Interacting Protein 2 (MAP3K7IP2)	X	X
11270	Solution Structure of the Novel Identified Ubiquitin-like Domain in the Human Hypothetical Protein FLJ35834	X	X
11271	Solution Structure of the C-terminal UBA Domain in the Human Ubiquilin 3	X	X
11272	Solution Structure of the Novel Identified Ubiquitin-like Domain in the Human COBL-like 1 Protein	X	X
11273	Solution Structure of the Novel Identified UBA-like Domain in the N-terminal of Human Fas Associated Factor 1 Protein	X	X
11274	Solution Structure of the Novel Identified UBA-like Domain in the N-terminal of Human ETEA Protein	X	X
11275	Solution Structure of the RRM Domain in the Human Poly (ADP-ribose) Polymerase Family, Member 10 Variant	X	X
11276	Solution Structure of the CUE Domain in the Human CUE Domain Containing Protein 1 (CUEDC1)	X	X
11277	Solution Structure of the RA Domain in the Human Link Guanine Nucleotide Exchange Factor II (Link-GEFII)	X	X
11278	Solution Structure of the CUE Domain in the Human Activating Signal Cointegrator 1 Complex Subunit 2 (ASCC2)	X	X
11279	2DZI/Solution Structure of the N-terminal Ubiquitin-like Domain in Human Ubiquitin-like Protein 4A (GDX)	X	X
11280	2DZJ/Solution Structure of the N-terminal Ubiquitin-like Domain in Human Synaptic Glycoprotein SC2	X	X
11281	Structure of the UBX domain in Mouse UBX Domain-Containing Protein 2	X	X
11282	Solution Structure of the UBA domain in Human Protein FAM100B	X	X
11283	Solution Structure of the Ubiquitin-like Domain in Human FAS-associated factor 1 (hFAF1)	X	X
11284	Solution structure of the SH3 domain of human hypothetical protein FLJ21522	X	X
11285	Solution structure of the SH3 domain of mouse peroxisomal biogenesis factor 13	X	X
11286	Solution structure of the BSD domain of human Synapse associated protein 1	X	X
11287	Solution structure of the C2H2 type zinc-binding domain of human zinc finger protein 292	X	X
11288	Solution structure of the fibronectin type-III domain of human fibronectin type-III domain containing protein 3a	X	X
11289	Solution structure of the LIM domain of human Leupaxin	X	X
11290	Solution structure of the fibronectin type-III domain of human fibronectin type III domain containing protein 3	X	X
11291	Solution structure of the fibronectin type-III domain of mouse myosin-binding protein C, Fast-type homolog	X	X
11292	Solution structure of the fibronectin type-III domain of human protein tyrosine phosphatase, receptor type, D isoform 4 variant	X	X
11293	Solution structure of the LIM domain of human Cysteine-rich protein 2	X	X
11294	Solution structure of the RWD domain of human RWD omain containing protein 2	X	X
11295	Solution structure of the RWD domain of human protein C21orf6	X	X
11296	Solution structure of the RWD domain of human ring finger protein 25	X	X
11297	Solusion structure of the Todor domain of human Lamin-B receptor	X	X
11298	Solution structure of the BSD domain of human TFIIH basal transcription factor complex p62 subunit	X	X
11299	Solution structure of the SH3 domain of the human Proline-serine-threonine phosphatase-interacting protein 1	X	X
11300	Solution structure of the Myb_DNA-binding domain of human Cell division cycle 5-like protein	X	X
11301	Solution structure of the Myb_DNA-binding domain of human Cell division cycle 5-like protein	X	X
11302	Solution structure of the N-terminal C2H2 type zinc-binding domain of the Zinc finger protein 64, isoforms 1 and 2	X	X
11303	An extended conformation of the RWD domain of human Ring finger protein 25	X	X
11304	Solution structure of the Fibronectin type-III domain of human Neural cell adhesion molecule 2	X	X
11305	Solution Structure of the LIM Domain of the Human Actin Binding LIM Protein 2	X	X
11306	Solution Structure of the Ring-H2 Finger Domain of Mouse Deltex Protein 2	X	X
11307	Solution Structure of the RING finger Domain of the human UbcM4-interacting Protein 4	X	X
11308	Solution structure of the C2H2 zinc finger domain of the protein arginine N-methyltransferase 3 from Mus musculus	X	X
11309	Solution structure of the N-terminal zinc finger domain of mouse cell growth regulating nucleolar protein LYAR	X	X
11310	Solution structure of the C-terminal domain of mouse phosphoacetylglucosamine mutase (PAGM)	X	X
11311	Solution structure of the FAS1 domain of human transforming growth factor-beta induced protein IG-H3	X	X
11312	Solution structure of the C2H2 type zinc-binding domain of human zinc finger protein 64, isoforms 1 and 2	X	X
11313	Solution structure of the RING domain of the Zinc finger protein 183-like 1	X	X
11314	Solution Structure of the RING domain of the Synaptotagmin-like protein 4	X	X
11315	Solution structure of the RING domain of the Non-SMC element 1 protein	X	X
11316	Solution Structure of the zinc finger domain of Transcriptional repressor CTCF protein	X	X
11317	Solution Structure of the RING domain of the Tripartite motif protein 32	X	X
11318	Solution Strutcure of the SH3 domain of the Cdc42-interacting protein 4	X	X
11319	Solution Structure of the zinc finger BED domain of the zinc finger BED domain containing protein 1	X	X
11320	solution structure of the sh3 domain-binding glutamic acid-rich-like protein 2	X	X
11321	Solution Structure of the IBR domain of the RING finger protein 31 protein	X	X
11322	Solution structure of the SANT domain of human KIAA1915 protein	X	X
11323	Solution structure of the MYND domain of the human zinc finger MYND domain-containing protein 10	X	X
11324	Solution structure of the thap domain of the human thap domain-containing protein 2	X	X
11325	Solution structure of the RING domain of the human cellular modulator of immune recognition protein	X	X
11326	Solution structure of the RING domain of the human RING finger protein 146	X	X
11327	Solution structure of the B-box domain of the human tripartite motif-containing 63 protein	X	X
11328	Solution structure of the B-box domain of the zinc finger FYVE domain-containing protein 19 from Mus musculus	X	X
11329	Solution structure of the Bromodomain of human SWI/SNF related matrix associated actin dependent regulator of cromatin subfamily A member 2	X	X
11330	Solution structure of the plus-3 domain of human KIAA0252 protein	X	X
11331	Solution structure of the B-box domain of the human Midline-2 protein	X	X
11332	Solution structure of the RING domain of the human Polycomb group RING finger protein 6	X	X
11333	Solution structure of the CHY zinc finger domain of the RING finger and CHY zinc finger domain-containing protein 1 from Mus musculus	X	X
11334	Solution structure of the TFIIS domain II of human PHD finger protein 3	X	X
11335	Solution Structure of the RING domain of the human Cell growth regulator with RING finger domain 1 protein	X	X
11336	Solution Structure of the RING domain of the human ring finger protein 4	X	X
11337	Solution structure of the RWD domain of human RWD domain containing protein 3	X	X
11338	Solution structure of the RWD domain of human RWD domain containing protein 1	X	X
11339	Solution structure of the ring domain of the Baculoviral IAP repeat-containing protein 4 from Homo sapiens	X	X
11340	Solution structure of the RING domain of the human TNF receptor-associated factor 6 protein	X	X
11341	Solution structure of the RING domain of the human tripartite motif-containing protein 39	X	X
11342	Solution Structure of the RING domain of the human RING-box protein 2	X	X
11343	Solution structure of the RING domain of the RING finger and CHY zinc finger domain-containing protein 1 from Mus musculus	X	X
11344	Solution structure of the RING domain of the human RING finger protein 141	X	X
11345	Solution structure of the SWIRM domain of baker's yeast Transcriptional adapter 2	X	X
11346	Solution structure of Fn14 CRD domain	X	X
11347	Solution structure of the PHD domain in PHD finger protein 21A	X	X
11348	Solution structure of the NEUZ domain in KIAA1787 protein	X	X
11349	Solution structure of LIM domain in LIM-protein 3	X	X
11350	Solution structure of LIM domain in Four and a half LIM domains protein 2	X	X
11351	Solution structure of the NEUZ (NHR) domain in Neuralized from Drosophila melanogaster	X	X
11352	Solution structure of PHD domain in inhibitor of growth family, member 1-like	X	X
11353	Solution structure of PHD domain in inhibitor of growth protein 3 (ING3)	X	X
11354	Solution structure of PHD domain in ING1-like protein BAC25079	X	X
11355	Solution structure of Splicing Factor Motif in Pre-mRNA splicing factor 18 (hPRP18)	X	X
11356	Solution structure of SH3 domain in Rac/Cdc42 guanine nucleotide exchange factor(GEF) 6	X	X
11357	Solution structure of WW domain in transcription elongation regulator 1	X	X
11358	Assigned chemical shifts of the zf-CW domain with H3 peptide	X	X
11359	Assigned chemical shifts of the zf-CW domain with H3 dimethyl K4 peptide	X	X
11360	Assigned chemical shifts of the zf-CW domain with H3 trimethyl K4 peptide	X	X
11361	Assigned chemical shifts of the zf-CW domain with H4 trimethyl K20 peptide	X	X
11362	Assigned chemical shifts of the zf-CW domain in zinc finger CW-type PWWP domain protein 1	X	X
11363	Solution structure of zinc finger HIT domain in protein FON	X	X
11364	Solution structure of the first SURP domain of human splicing factor SF3a120	X	X
11365	Solution structure of the second SURP domain of human splicing factor SF3a120 in complex with a fragment of human splicing factor SF3a60	X	X
11366	Assigned chemical shifts of the human spliceosomal protein complex p14-SF3b155	X	X
11367	Assigned chemical shifts of the human spliceosomal protein SF3b155	X	X
11368	Solution structure of the C2H2 type zinc finger (region 656-688) of human Zinc finger protein 95 homolog	X	X
11369	Solution structure of the C2H2 type zinc finger (region 507-539) of human Zinc finger protein 224	X	X
11370	Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1, C terminal truncated	X	X
11371	Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1, D131A mutant	X	X
11372	Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1, K138A mutant	X	X
11373	Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1, T134A mutant	X	X
11374	Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1 with RNA (CCCCC)	X	X		X
11375	Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1 with RNA (UUUUU)	X	X		X
11376	Assigned chemical shifts of the second RNA recognition motif (RRM) of TIA-1	X	X
11377	Solution structure of the first C2H2 type zinc finger domain of Zinc finger protein 278	X	X
11378	Solution structure of the third zinc finger domain of Zinc finger protein 278	X	X
11379	Solution structure of the secound zinc finger domain of Zinc finger protein 278	X	X
11380	Solution structure of the 4th zinc finger domain of Zinc finger protein 278	X	X
11381	Solution structure of the first C2H2 type zinc finger domain of Zinc finger protein 32	X	X
11382	Solution structure of the secound C2H2 type zinc finger domain of Zinc finger protein 32	X	X
11383	Solution structure of the 20th C2H2 type zinc finger domain of Zinc finger protein 268	X	X
11384	Solution structure of the 24th C2H2 type zinc finger domain of Zinc finger protein 268	X	X
11385	Solution structure of the third C2H2 type zinc finger domain of Zinc finger protein 28 homolog	X	X
11386	Solution structure of the 9th C2H2 type zinc finger domain of Zinc finger protein 347	X	X
11387	Solution structure of the 16th C2H2 type zinc finger domain of Zinc finger protein 347	X	X
11388	Solution structure of the ARID domain of Jarid1b protein	X	X
11389	Solution structure of the ARID domain of JARID1D protein	X	X
11390	Solution structure of the death domain of Ankyrin-1	X	X
11391	Solution structure of the 10th C2H2 type zinc finger domain of Zinc finger protein 268	X	X
11392	Solution structure of the 4th C2H2 type zinc finger domain of Zinc finger protein 28 homolog	X	X
11393	Solution structure of the 8th C2H2 type zinc finger domain of Zinc finger protein 347	X	X
11394	Solution structure of the 17th C2H2 type zinc finger domain of Zinc finger protein 347	X	X
11395	Solution structure of the 11th C2H2 type zinc finger domain of Zinc finger protein 224	X	X
11396	Solution structure of the 6th C2H2 type zinc finger domain of Zinc finger protein 484	X	X
11397	Solution structure of the BACK domain of Kelch repeat and BTB domain-containing protein 4	X	X
11398	Solution structure of PDZ domain in protein XP_110852	X	X
11399	solution structure of RNA binding domain in PTB-like protein L	X	X
11400	Solution Structure of the RNA recognition motif in Arginine/serine-rich splicing factor 10	X	X
11401	Solution structure of the phorbol esters/diacylglycerol binding domain of protein kinase C gamma	X	X
11402	Solution structure of chromo domain 2 in Chromodomain-helicase-DNA-binding protein 6	X	X
11403	Solution structure of Zinc finger domain 7 in Zinc finger protein 32	X	X
11404	Solution structure of SH3 domain in Rho-GTPase-activating protein 4	X	X
11405	Assigned chemical shifts of RNA binding domain 3	X	X
11406	Assigned chemical shifts of RNA binding domain 3 in RNA (CUGCUG)	X	X		X
11407	Assigned chemical shifts of RNA binding domain 3 in RNA (UAUAUA)	X	X		X
11408	Assigned chemical shifts of RNA-binding domain 3 of CUGBP1 in complex with RNA (UG)3	X	X		X
11409	Assigned chemical shifts of RNA binding domain in human Tra2 beta protein in complex with RNA (GAAGAA)	X	X		X
11410	Assigned chemical shifts of RNA binding domain in human Tra2 beta protein in complex with RNA (GACUUCAACAAGUC)	X	X		X
11411	Assigned chemical shifts of RNA binding domain in human Tra2 beta protein in complex with RNA (AAAAAA)	X	X		X
11412	Assigned chemical shifts of RNA binding domain in human Tra2 beta protein in complex with RNA (UCAAU)	X	X		X
11413	Refinement of RNA binding domain in human Tra2 beta protein	X	X
11414	Solution structure of C2H2 type Zinc finger domain 345 in Zinc finger protein 278	X	X
11415	Solution structure of C2H2 type Zinc finger domain 3 in Zinc finger protein 32	X	X
11416	Solution structure of C2H2 type Zinc finger domain 5 in Zinc finger protein 32	X	X
11417	Solution structure of the J domain of DnaJ homolog subfamily B member 8	X	X
11419	NMR structure of vasoactive intestinal peptide in Methanol	X	X
11420	NMR structure of vasoactive intestinal peptide in DPC Micelle	X	X
11422	Solution structure of the E. coli ORF135 protein	X	X
11423	Solution structure of the C-terminal domain of the FliK	X	X
11424	Interplay between phosphatidyl-inositol-phosphates and claudins upon binding to the 1st PDZ domain of zonula ocludens 1	X	X
11425	1H, 13C, and 15N resonance assignment of the SPFH domain of human stomatin.	X	X
11426	Solution structure of SecDF periplasmic domain P4	X	X
11429	SOLUTION STRUCTURE OF THE N-TERMINAL DOMAIN OF THE HMGB2	X	X
11430	SOLUTION STRUCTURE OF THE C-TERMINAL DOMAIN OF THE HMGB2	X	X
11431	SOLUTION STRUCTURE OF THE C-TERMINAL DOMAIN OF THE HMGB2 (H22Y)	X	X
11434	NMR Chemical Shift Assignments for Ostrich egg white Lysozyme	X	X
11435	1H, 13C, and 15N Chemical Shift Assignments for amyloid-beta-(1-40)	X	X
11436	NMR Chemical Shift Assignments for E73A mutant of Ostrich egg white Lysozyme	X	X
11437	DNA oligmer containing propylene cross-linked cyclic 2' -deoxyuridylate dimer	X		X
11438	DNA oligomer containing ethylene cross-linked cyclic 2'-deoxyuridylate dimer	X		X
11441	NMR chemical shift of bryum coronatum chitinase	X	X
11442	Backbone 1H, 13C and 15N chemical shift assignments of Hd3a (K31A/E57A)	X	X
11450	1H, 13C, and 15N Chemical Shift Assignments for Musashi1 RBD1:r(GUAGU) complex	X	X		X
11451	NMR strucure of stereo-array isotope labelled (SAIL) peptidyl-prolyl cis-trans isomerase from E. coli (EPPIb)	X	X
11454	NMR Chemical Shift Assignments for QB domain of Sp1	X	X
11466	NMR chemical shift of bryum coronatum chitinase E61A mutant	X	X
11467	Family GH19 chitinase from Rye seeds	X	X
11470	NMR chemical shift assignments for the cytoplasmic region of the Mg2+-transporter MgtE in the Mg2+ unbound state	X	X
11471	NMR structure of FKBP12-mTOR FRB domain-rapamycin complex structure determined based on PCS	X	X
11472	Complex structure of WWE in RNF146 with ATP	X	X
11473	Solution structure of the CERT PH domain	X	X
11489	RNA aptamer against prion protein in complex with the partial binding peptide	X	X		X
11490	Backbone and side-chain 1H, 15N and 13C resonance assignments of the microtubule-binding domains of yeast cytoplasmic dynein in the high affinity state	X	X
11492	Dihydrofolate Reductase from E.coli G67 deletion mutant	X	X
11493	NMR chemical shift of Streptomyces sp. N174 chitosanase	X	X
11494	NMR chemical shift of E22A mutant of Streptomyces sp. N174 chitosanase	X	X
11495	Backbone and side-chain 1H, 15N and 13C resonance assignments of the microtubule-binding domains of yeast cytoplasmic dynein in the low affinity state	X	X
11496	Solution structure of the chromodomain of Chp1 in complex with H3K9me3 peptide	X	X
11497	Solution structure of the chromodomain of Swi6	X	X
11498	Backbone resonance assignment for the unique and SH3 domains of mouse lymphocyte specific kinase	X	X
11499	Solution structure of RNF146 WWE domain	X	X
11500	solution structure of PARP11 WWE domain	X	X
11501	solution structure of PARP14 WWE domain	X	X
11504	Structure of SPOC domain of the human transcriptional corepressor SHARP	X	X
11506	Solution structure of human full-length vaccinia related kinase 1 (VRK1)	X	X
11507	Solution structure of IseA, an inhibitor protein of DL-endopeptidases from Bacillus subtilis	X	X
11511	acidic intrinsically disordered region of SSRP1	X	X
11513	NMR chemical shift of carbohydrate binding module, C1, derived from GH8 chitosanase/glucanase from Paenibacillus fukuinensis D2	X	X
11515	goat alpha-lactalbumin at pH 2.0	X	X
11522	1H, 13C and 15N backbone resonance assignments of the monomeric human M-ficolin fibrinogen-like domain secreted by Brevibacillus choshinensis	X	X
11523	Solution structure of the second RRM domain of Nrd1	X	X
11524	NMR Structure of designed protein, AF.2A1, (Ensembles)	X	X
11525	Backbone 1H, 13C, and 15N Chemical Shift Assignments for PriC N-terminal domain	X	X
11527	Backbone 1H, 13C, and 15N Chemical Shift Assignments for PriB	X	X
11528	STRUCTURE OF METALLO-DNA IN SOLUTION	X		X
11529	Solution structure of a regulatory domain of meiosis inhibitor	X	X
11530	chitin binding domain1	X	X
11535	Solution structure of navitoxin	X	X
11536	Solution structure of MarkTX-7	X	X
11537	Solution structure of actinomycin	X	X
11538	Tachyplesin I in the presence of lipopolysaccharide	X	X
11539	Tachyplesin I in water	X	X
11540	Solution structure of esf3	X	X
11541	Solution Structure of Protein-RNA Complex	X	X		X
11542	Backbone 1H, 13C, and 15N Chemical Shift Assignments for yeast Tim50 PBD domain	X	X
11543	NMR solution structure of [G5,T7,S9]-oxytocin	X	X
11544	DESIGNED ARMADILLO REPEAT PROTEIN SELF-ASSEMBLED COMPLEX (YIIM2-MAII)	X	X
11546	1H, 15N and 13C resonance assignments of the conserved domain in the middle of Schizosaccharomyces pombe SAPK-interacting protein 1	X	X
11548	DESIGNED ARMADILLO REPEAT PROTEIN FRAGMENT (MAII)	X	X
11549	DnaT C-terminal domain	X	X
11555	Structure of the YAM domain of E. coli Transporter YajR	X	X
11556	Sequential backbone HN, N, Ca and Cb assignments of E.coli dihydrofolate reductase G67V mutant-folate binary complex	X	X
11561	Redox protein (oxidized form)	X	X
11562	Redox protein (reduced form)	X	X
11564	RPEL1 motif of MKL1	X	X
11565	L94P-RPEL1 motif of MKL1	X	X
11566	L105P-RPEL1 motif of MKL1	X	X
11567	RPEL2 motif of MKL1	X	X
11568	RPEL3 motif of MKL1	X	X
11569	Chemical Shift Assignments for MIP and MDM2 in bound state	X	X
11570	Solution Structure of the Bacillus anthracis Sortase A-substrate Complex	X	X
11578	Solution structure of the complex between p53 transactivation domain 2 and TFIIH p62 PH domain	X	X
11580	NMR Structures and Localization of Potential Fusion Peptides and Pre-transmembrane Region of SARS-CoV: Implications in Membrane Fusion	X	X
11581	NMR Structures and Localization of Potential Fusion Peptides and Pre-transmembrane Region of SARS-CoV: Implications in Membrane Fusion	X	X
11582	NMR Structures and Localization of Potential Fusion Peptides and Pre-transmembrane Region of SARS-CoV: Implications in Membrane Fusion	X	X
11583	Solution structure of rat P2X4 receptor head domain	X	X
11584	Backbone 1H, 13C, and 15N Chemical Shift Assignments for c-Myb R2R3 C130I	X	X
11585	Backbone 1H, 13C, and 15N Chemical Shift Assignments for c-Myb R2R3 V103L/C130I	X	X
11587	Solution structure of Human Pin1 PPIase mutant C113A	X	X
11588	Solution structure of Human Pin1 PPIase C113S mutant	X	X
11591	Solution structure of chitosan-binding module 1 derived from chitosanase/glucanase from Paenibacillus sp. IK-5	X	X
11592	Solution structure of chitosan-binding module 2 derived from chitosanase/glucanase from Paenibacillus sp. IK-5	X	X
11593	Effects of linker length and transient secondary structure elements in the intrinsically disordered RAM region of NICD on Notch signaling	X	X
11594	Solution structure of the complex between XPC acidic domain and TFIIH p62 PH domain	X	X
11595	Solution structure of Zalpha domain of goldfish ZBP-containing protein kinase	X	X
11596	Gallium ferredoxin	X	X
11599	NMR structure of eIF1	X	X
11601	pET22-hESRP1-RRM3	X	X
11604	Solution structure of the chromodomain of HP1alpha with the N-terminal tail	X	X
11605	Solution structure of the chromodomain of HP1alpha with the phosphorylated N-terminal tail	X	X
11606	Solution structure of the chromodomain of HP1a with the phosphorylated N-terminal tail complexed with H3K9me3 peptide	X	X
11607	Solution structure of a reverse transcriptase recognition site of a LINE RNA from zebrafish	X			X
11608	SOLUTION STRUCTURE OF DNA CONTAINING METALLO-BASE-PAIR	X		X
11609	Solution structure of the isolated histone H2A-H2B heterodimer	X	X
12000	Backbone chemical shifts assignments of a two-domain family GH19 chitinase allergen from Japanese cedar (Cryptomeria japonica) pollen,CJP-4.	X	X
12002	Backbone resonance assignments of the second LysM domain from Volvox carteri chitinase	X	X
12003	ILMV methyl assignments for the neuronal SNARE complex	X	X
12010	Backbone 1H, 13C, 15N chemical shift assignments for FliGc protein	X	X
12011	Backbone 1H, 13C, 15N chemical shift assignments for FliGc A282T mutated protein	X	X
12014	Backbone 1H, 13C, and 15N Chemical Shift Assignments for cyclophilin 1 from Trichomonas vaginalis	X	X
12016	Backbone 1H and 15N Chemical Shift Assignments for Sup35NM	X	X
12018	Backbone resonance assignments of the YAP-binding domain of transcription factor TEAD4 of mouse	X	X
12019	Solid-state NMR C-13 and N-15 chemical shifts of the chitin binding domain of chitinase A1 from Bacillus circulans WL-12	X	X
12020	1H and 15N Chemical Shifts Assignment for wild-type SPINK1	X	X
12021	1H and 13C Assignments for PPTI (Pseudocerastes Persicus Trypsin Inhibitor)	X	X
12022	sublancin chemical shifts	X	X
12024	Resonance assignments of a cellulosomal double-dockerin from Clostridium thermocellum	X	X
12026	NMR resonance assignments of the NZF domain of mouse HOIL-1L in free form and linear di-ubiquitin-bound form	X	X
12032	Solution NMR structure of the W187R mutant of 1918 NS1 effector domain	X	X
12033	c-MYC 353-437	X	X
12040	1H, 13C and 15N resonance assignments of the proteasome lid subunit Rpn12 from Saccharomyces cerevisiae	X	X
12041	1H, 13C and 15N resonance assignments of Q38FZ4, hypothetical protein from Trypanosoma brucei	X	X
15002	Solution structure of the THAP domain from C. elegans C-terminal binding protein (CtBP)	X	X
15003	SOLUTION STRUCTURE OF GROUP IV WW DOMAIN: A.NIDULANS PINA	X	X
15007	Structural Studies on Plasmodium vivax Merozoite Surface Protein-1	X	X
15012	chemical shift assignment of the protein Atu4866 from Agrobacterium tumefaciens	X	X
15013	Chimer between Spc-SH3 and P41	X	X
15014	Solution structure of the RING domain from human TRAF6.	X	X
15016	Solution structure of the Su(dx) WW4 - Notch peptide complex	X	X
15019	NMR assignments for a helical diacylglycerol kinase (DAGK), 40 kDa membrane protein from E. coli	X	X
15020	Structure of the N-WASP EVH1 domain in complex with an extended WIP peptide	X	X
15021	Structural and Dynamical Analysis of a Four-Alpha-Helix Bundle with Designed Anesthetic Binding Pockets	X	X
15023	1H, and 15N Chemical Shift Assignments for the N-terminal domain of Myxococcus xantus CarA protein.	X	X
15025	Backbone 1H Chemical Shift Assignments for peptide sMTM7 from subunit a of proton V-ATPase	X	X
15031	Solution Structure of alpha-Conotoxin BuIA	X	X
15032	Chemical shift assignments of the type 1 pilus subunit FimF	X	X
15034	1H,13C and 15N NMR Assignments of the Yellow Fever Envelope Protein Domain III	X	X
15035	1H, and 15N Chemical Shift Assignments for the N-terminal domain of Myxococcus xantus CarA protein.	X	X
15036	SOLUTION STRUCTURE OF HUMAN BETA-MICROSEMINOPROTEIN	X	X
15037	Solution structure of human beta-microseminoprotein	X	X
15038	1H, 13C, and 15N resonance assignments of FK506-binding domain of Plasmodium falciparum FKBP35	X	X
15039	solution structure of ta0956	X	X
15040	DPC micelle-bound NMR structures of Tritrp2	X	X
15041	DPC micelle-bound NMR structures of Tritrp3	X	X
15042	DPC micelle-bound NMR structures of Tritrp5	X	X
15043	DPC micelle-bound NMR structures of Tritrp7	X	X
15044	DPC micelle-bound NMR structures of Tritrp8	X	X
15045	NMR SOLUTION STRUCTURE OF A MINIMAL TRANSMEMBRANE BETA-BARREL PLATFORM PROTEIN	X	X
15046	1H, 13C, and 15N resonance assignments of subunit F of the A1AO ATP synthase from Methanosarcina mazei Go1	X	X
15047	Ubiquitin in 8 M Urea	X	X
15049	Resonance assignment of the first and second KH (hnRNP-K homology) domains of human poly(C)-binding protein-2 (PCBP2)	X	X
15050	piscidin solution structure in presence of DPC micelles	X	X
15051	DPC micelle-bound NMR structures of Tritrp1	X	X
15055	Structure for the N-terminus of chromosomal replication initiation protein dnaA from M. genitalium	X	X
15058	1H assignment of En-6	X	X
15060	NMR structure of the murine DLC2 (deleted in liver cancer -2) SAM (sterile alpha motif) domain	X	X
15061	NMR assignment of a KlbA intein precursor from Methanococcus jannaschii	X	X
15063	NMR structure of the mouse thiamine triphosphatase	X	X
15068	Structure-Activity Analysis of Quorum-Sensing Signaling Peptides from Streptococcus mutans	X	X
15069	Structure-Activity Analysis of Synthetic Quorum-Sensing Signal Peptides from Streptococcus mutans	X	X
15070	NMR Assignments of the apo Corynebacterium diphtheria Heme Oxygenase-G135A	X	X
15071	NMR Assignments of the apo Corynebacterium diphtheria Heme Oxygenase	X	X
15073	NMR assignments of CO-bound ferrous Corynebacterium diphtheria Heme Oxygenase	X	X
15074	Assignment of the 1H, 15N and 13C resonances and determination of the 3D- structure of In-Between-RING (IBR) domain of Parkin	X	X
15075	Merozoite surface protein 2 (MSP2) of Plasmodium falciparum: expression, structure and amyloid formation of the conserved N-terminal domain	X	X
15076	Dynein Light Chain LC8 at pH 5.5	X	X
15077	Dynein Light Chain LC8 at pH 5.5, complex with Swa peptide	X	X
15078	Dynein Light Chain LC8 at pH 5.5, complex with IC peptide	X	X
15079	Solution NMR structure of the ygdR protein from Escherichia coli. Northeast Structural Genomics target ER382A.	X	X
15080	U2 snRNA stem I from S. cerevisiae	X			X
15081	U2 snRNA stem I from human	X			X
15082	HN,CA,CB Chemical shift assignments for apo-Rat intestinal fatty acid binding protein, Clofibric acid-Rat intestinal fatty acid binding protein complex, Fenofibric acid-Rat intestinal fatty acid binding protein complex and Tolfenamic acid-Rat intestinal fatty acid binding protein complex.	X	X
15084	NMR structure of cl-BABP complexed to chenodeoxycholic acid	X	X
15085	Complete Assignment of a hypothetical portein RP4601 (NESG ID: RpT2)from Rhodopseudomonas palustris.	X	X
15086	Solution NMR structure of Hypothetical Protein Cgl2762 from Corynebacterium Glutamicum: Northeast Structural Genomics Consortium Target CgR3	X	X
15088	Northeast Structural Genomics Consortium Target ER411	X	X
15090	Solution NMR Structure of Salmonella typhimurium LT2 Secreted Protein STM0082: Northeast Structural Genomics Consortium Target StR109	X	X
15092	1H, 13C, 15N chemical shift assignments for the human E2 ubiquitin conjugating enzyme Ubc13	X	X
15094	1H, 13C, and 15N Chemical Shift Assignments for CutA1 from E. coli	X	X
15095	Solution Structure of a Dodecapeptide from Alpha-Synuclein Bound with Synphilin-1	X	X
15098	SOLUTION STRUCTURES OF THE BRK DOMAINS OF THE HUMAN CHROMO HELICASE DOMAIN 7 AND 8, REVEALS STRUCTURAL SIMILARITY WITH GYF DOMAIN SUGGESTING A ROLE IN PROTEIN INTERACTION	X	X
15100	NMR structure of E.coli YfgJ protein modelled with two Zn+2 bound. Northeast Structural Genomics Consortium Target ER317.	X	X
15101	Backbone 1H, 15N, and 13C Resonance Assignment and Secondary Structure Prediction of HP0495 from Helicobacter pylori	X	X
15102	IKs producing slow voltage-gated potassium channel subunit beta, KCNE1	X	X
15109	Solution structure of the CUL7-CPH domain from Homo Sapiens; Northeast Structural Genomics Consortium target HT1.	X	X
15110	Solution structure of V21C/V59C Lymphotactin/XCL1	X	X
15111	Solution Structure of the UBA Domain from Cbl-b	X	X
15112	Assignment of the reduced Cu,Zn Superoxide Dismutase from Salmonella choleraesuis	X	X
15113	Solution Structure of the Rous Sarcoma Virus Nucleocapsid Protein:muPsi RNA Packaging Signal Complex	X	X		X
15117	Backbone H, C, N Chemical Shifts for Influenza A NS1 (1-73) Protein Bound to dsRNA	X	X		X
15118	LPS-bound structure of a designed peptide	X	X
15120	SOLUTION STRUCTURE OF MATRIX METALLOPROTEINASE 3 (MMP-3) IN THE PRESENCE OF N-ISOBUTYL-N-[4-METHOXYPHENYLSULFONYL]GLYCYL HYDROXAMIC ACID (NNGH)	X	X
15121	Backbone 1H, 13C and 15N resonance assignments for the 26kD human deubiquitinating enzyme UCH-L3	X	X
15122	Structure and dynamics of surfactin studied by NMR in micellar media	X	X
15123	SeV Ntail(443-501)	X	X
15124	Discovery and optimization of a natural HIV-1 entry inhibitor targeting the gp41 fusion peptide	X	X
15125	N.N.	X	X
15128	Solution structure of the RGS domain of human RGS14	X	X
15131	NMR assignment of an intrinsically disordered protein under physiological conditions: the 18.5 kDa isoform of murine myelin basic protein	X	X
15132	The highly cooperative folding of small, naturally occurring proteins is likely the result of natural selection.	X	X
15133	Solution NMR structure of protein Uncharacterized BCR, Northeast Structural Genomics Consortium target CgR1	X	X
15134	Solution structure of phl p 3, a major allergen from timothy grass pollen	X	X
15139	NMR structure of the E.coli protein NirD, Northeast Structural Genomics target ET100	X	X
15140	Proton chemical shifts of mytilin	X	X
15141	Chemical shift assignment of TC-1	X	X
15142	Solution structure of dynein light chain 2A	X	X
15144	Side-chain relaxation in SH3 domain from alpha-spectrin measured at multiple temperatures	X	X
15145	1H, Chemical Shift Assignments for neurotensin in HFIP:H20 (80:20), TFE:D20(80:20), and DPC micelles	X	X
15148	HMGB1 AB boxes + basic tail backbone assignment	X	X
15149	HMGB1 Full Length backbone assignment	X	X
15153	Mouse Itch 3rd WW domain complex with the Epstein-Barr virus latent membrane protein 2A derived peptide EEPPPPYED	X	X
15154	HtrA1 bound to an optimized peptide: NMR assignment of PDZ domain and ligand resonances	X	X
15157	NMR structure of the UGUU tetraloop of Duck Epsilon apical stem loop of the Hepatitis B virus	X			X
15158	Solution structure of the adhesion protein Bd37 from Babesia divergens	X	X
15159	Mouse Itch 3rd domain phosphorilated in T30	X	X
15160	Solution Structure of the Ubiquitin-Binding Zinc Finger (UBZ) Domain of the Human DNA Y-Polymerase Eta	X	X
15163	Backbone 1H, 13C, and 15N Chemical Shift Assignments for LARG PDZ domain in complex with C-terminal octa-peptide of Plexin B1	X	X
15167	NMR Structure of E. Coli YehR Protein. Northeast Structural Genomics Target ER538.	X	X
15168	Backbone 1H, 13C, and 15N Chemical Shift Assignments for LARG PDZ domain	X	X
15169	The Trp-cage: Optimizing the Stability of a Globular Miniprotein	X	X
15172	1H, 13C and 15N chemical shift assignments for hypothetical protein TA0095 from Thermoplasma acidophilum	X	X
15176	Intrinsically unstructured proteins provide the specificity for protein phosphatase 1 regulation.	X	X
15177	Resonance assignments of the metal sensor CzrA in the apo-, Zn2- and DNA-bound (42 kDa) states	X	X
15178	Backbone, C' and CB 13C, 15N and 1H chemical shift assignments for the RGS domain of the human Regulator of G-protein Signalling 3(RGS3)protein	X	X
15179	Intrinsically unstructured proteins provide the specificity for protein phosphatase 1 regulation.	X	X
15180	Intrinsically unstructured proteins provide the specificity for protein phosphatase 1 regulation.	X	X
15183	Backbone and side-chain methyl order parameters and effective correlation times for calmodulin in complex with CaMKKalpha peptide	X	X
15184	backbone and side chain methly order parameters and correlation times for calmodulin in complex with the eNOS peptide	X	X
15185	backbone and side chain methly order parameters and correlation times for calmodulin in complex with the eNOS peptide	X	X
15186	backbone and side chain methly order parameters and correlation times for calmodulin in complex with the smMLCK peptide	X	X
15187	Backbone and side-chain methyl order parameters and effective correlation times for calmodulin in complex with Phosphodiesterase1A peptide	X	X
15188	backbone and side chain methly order parameters and correlation times for calcium-saturated calmodulin	X	X
15189	Solution structure of the N-terminal extracellular domain of the lymphocyte receptor CD5 (CD5 domain 1)	X	X
15190	Solution Structure of Protein HP0495 from H. pylori; Northeast structural genomics consortium target PT2; Ontario Centre for Structural Proteomics target HP0488	X	X
15191	backbone and sidechain order parameters for CaM-nNOSp	X	X
15192	NMR Solution Structure, Stability, and Interaction of the Recombinant Bovine Fibrinogen alphaC-Domain Fragment	X	X
15196	NMR structure of the HIV-2 nucleocapsid protein	X	X
15197	1H, 15N, and 13C chemical shift assignments for CaBP1	X	X
15198	Backbone 1H, 13C, and 15N Chemical Shift Assignments for all-Ala-HEWL	X	X
15200	NMR assignment of the apo-form of a Desulfovibrio gigas protein containing a novel Mo-Cu cluster	X	X
15201	Sequence-specific resonance assignments for OmpX in 8 M urea aqueous solution	X	X
15203	NMR Structure of Clostridium Perfringens Protein CPE0013. Northeast Structural Genomics Target CpR31.	X	X
15204	Backbone assignment of human IgG1 CH3 domain	X	X
15206	Differences in the electrostatic surfaces of the type III secretion needle proteins	X	X
15207	1H, 13C and 15N resonance assignments of YajG	X	X
15208	Embryonic Neural Inducing Factor Churchill is not a DNA-Binding Zinc Finger Protein: Solution Structure Reveals a Solvent-Exposed Beta-Sheet and Zinc Binuclear Cluster	X	X
15209	Structure of the hDLG/SAP97 PDZ2 in complex with HPV-18 papillomavirus E6 peptide	X	X
15210	NMR Structure of 50S Ribosomal Protein L14e from Sulfolobus Solfataricus; Northeast Structural Genomics Consortium Target SSR105.	X	X
15211	Solution NMR structure of protein , Northeastprotein yxeF Structural Genomics Consortium target Sr500a	X	X
15212	1H, 13C, and 15N Chemical Shift Assignments for the first Nterminal domain, RRM1, of hnRNP H	X	X
15213	Assignments of {lambda}-IntCB bound to a DNA half-site	X	X	X
15214	MxiHCdelta5 backbone assignment	X	X
15215	Solution structure of the alternative conformation of XCL1/Lymphotactin	X	X
15217	NMR SOLUTION STRUCTURE OF YKVR PROTEIN FROM BACILLUS SUBTILIS: NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET SR358	X	X
15218	1H and 13C Chemical shifts for the ATWLPPR peptide.	X	X
15219	Backbone 1H, 15N and 13C chemical shift assingments for human retinoid X receptor ligand-binding domain in complex with 9-cis retinoic acid and a glucocorticoid receptor interacting protein-1 peptide	X	X
15223	Duplex DNA containing an abasic site with an opposite G (alpha anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	X		X
15224	Duplex DNA containing an abasic site with an opposite G (beta anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	X		X
15225	1H, 13C, and 15N resonance assignments of domain 2 of non-structural protein 5A (NS5A) of hepatitis C virus	X	X
15228	Duplex DNA containing an abasic site with an opposite T (beta anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	X		X
15230	1H, 13C and 15N resonance assignments for the small GTPase RalB in its active conformation	X	X
15232	proline-free mutant of SNase V8	X	X
15238	Duplex DNA containing an abasic site with an opposite dC (alpha anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	X		X
15239	Duplex DNA containing an abasic site with an opposite dC (beta anomer) in 5'-G_AC-3' (10 structure ensemble and averaged structure)	X		X
15240	Solution structure of the ERCC1 central domain	X	X
15242	FHA domain of NIPP1	X	X
15243	1H, 15N, 13C chemical shifts of human translationally controlled tumor protein	X	X
15245	NMR SOLUTION STRUCTURE OF THE VILLIN HEADPIECE MUTANT G34L	X	X
15247	1H, 13C and 15N resonance assignments of the Escherichia coli YaeT POTRA domain	X	X
15248	Main chain NMR assignments of SBT70 in its prodomain-bound state	X	X
15249	Sequence-Specific 1H, 13C and 15N Resonance Assignments of the Cyclic Nucleotide Binding Domain from a Cyclic Nucleotide-Gated Potassium Channel in Complex with cAMP	X	X
15250	Main chain NMR assignments of SBT70	X	X
15252	Solution Structure of T4 Bacteriophage Helicase Uvsw.1	X	X
15253	NMR assignments of the binary hvDHFR1:folate complex	X	X
15254	Backbone Dynamics of Intramolecular Complex	X	X
15255	DtxR SH3	X	X
15256	Antheraea polyphemus pheromone-binding protein 1: structure and assignments at pH 4.5.	X	X
15257	Structural basis of RsmA/CsrA RNA recognition: Structure of RsmE bound to the Shine-Dalgarno sequence of hcnA mRNA	X	X		X
15258	NMR solution structure of Vibrio parahaemolyticus VP2129 homodimer. Northeast Structural Genomics target VpR61.	X	X
15259	LactococcinGa in DPC and TFE	X	X
15261	LactococcinGb in DPC and TFE	X	X
15264	Complete backbone 15N, 13C, and 1H resonance assignments for the N-terminal domain of AhpF	X	X
15265	solution structure of NESG target SsR10, Orf c02003 protein	X	X
15267	NMR structure of the anticoccidial peptide PW2 in DPC micelles	X	X
15268	Structure and Dynamics of Human Apolipoprotein C-III	X	X
15269	Complete resonance assignments and solution structure calcualtion of ATC2521 (NESG ID: AtT6) from Agrobacterium tumeraciens	X	X
15270	Solution structure of RPA3114, a SEC-C motif containing protein from Rhodopseudomonas palustris; Northeast Structural Genomics Consortium target RpT5 / Ontario Center for Structural Proteomics target RP3097	X	X
15271	Solution structure of the Somatomedin B domain from vitronectin produced in Pichia pastoris	X	X
15272	The NMR solution structure of a pH sensitive,D-amino acid containing conopeptide, mr12 .	X	X
15273	A L-amino acid mutant of a D-amino acid containing conopeptide	X	X
15275	Soution Structure of Af54 M-domain	X	X
15276	1H, 13C and 15N resonance assignment of 6aJL2(R25G), a highly fibrillogenic lamdaVI light chain variable domain.	X	X
15281	Solution NMR structure of CC0527 from Caulobacter crescentus. Northeast Structural Genomics target CcR55.	X	X
15282	Backbone 1H Chemical Shift Assignments for N-Me-Phe5	X	X
15284	Backbone 1H Chemical Shift Assignments for N-Me-Leu8	X	X
15285	Backbone 1H Chemical Shift Assignments for N-Me-Lys11	X	X
15286	NMR structure of Bungatoxin from Bungarus Candidus (Malayan Krait venom)	X	X
15287	Backbone 1H Chemical Shift Assignments for N-Me-Phe12	X	X
15288	NMR solution structure of Bacillus subtilis YobA 21-120: Northeast Structural Genomics Consortium target SR547	X	X
15289	1H, 15N chemical shift assignment of the THAP domain 1-81 from human THAP1 protein	X	X
15291	Backbone 1H Chemical Shift Assignments for N-Me-Gly13	X	X
15292	Backbone 1H Chemical Shift Assignments for N-Me-Ser14	X	X
15293	Backbone 1H Chemical Shift Assignments for N-Me-Leu8/N-Me-Ser14	X	X
15294	Backbone 1H Chemical Shift Assignments for N-Me-Val1/N-Me-Leu8/N-Me-Ser14	X	X
15295	Solution structure At3g28950.1 from Arabidopsis thaliana	X	X
15298	Beta-synuclein	X	X
15300	1H, 15N, 13C chemical shift assignment of the THAP domain 1-90 from human THAP1 protein	X	X
15301	Solution model of crosslinked complex of cytochrome c and adrenodoxin	X	X
15302	a novel lectin-like peptide from Odorrana grahami	X	X
15303	1H, 15N, 13C resonance assignments for bb' domains of human protein disulfide isomerase (PDI)	X	X
15304	NMR strcuture determination of the periplasmic domain of ExbD from E.coli	X	X
15305	1H Chemical Shift Assignments for Cardiotoxin A3 from Naja Atra at Neutral pH and temperature of 318K	X	X
15309	1H Chemical Shift Assignments for Cardiotoxin A5 from Naja Atra at Neutral pH and temperature of 318K	X	X
15315	Resonance assignments for the discoidin domain of DDR2.	X	X
15316	Electrostatic contributions to the stability of the GCN4 leucine zipper structure.	X	X
15317	NMR Solution Structure of Colwellia psychrerythraea protein CPS_2611. Northeast Structural Genomics target CsR4.	X	X
15318	Antibacterial Peptide from Eggshell Matrix: Structure and Self-assembly of a - defensin Like Peptide from the Chinese Soft-shelled Turtle Eggshell	X	X
15320	Solution structure of UPF0350 protein VC_2471: Northeast Structural Genomics Target VcR36	X	X
15322	1H, 13C, and 15N Chemical Shift Assignments for Chemotaxis Protein CheW	X	X
15323	Solution structure of Manduca sexta moricin	X	X
15324	A novel domain-swapped solution NMR structure of protein RPA2121 from Rhodopseudomonas palustris	X	X
15325	C-terminal domain of ORF1p from mouse LINE-1	X	X
15327	Chemical Shift Assignments for E. coli protein YqcC: Northeast Structural Genomics Consortium target ER225	X	X
15329	Solution NMR structure of Tubulin polymerization-promoting protein family member 3 from Homo sapiens. Northeast Structural Genomics target HR387.	X	X
15333	Resonance Assignment of the human Pirh2 RING domain; Northeast Structural Genomics Consortium Target HT2B	X	X
15335	Structure of Staphylococcus saprophyticus CHAP domain protein. Northeast Structural Genomics Target SyR11.	X	X
15336	1H, 13C and 15N Backbone Resonance Assignments of the Nonphosphorylated CFTR Regulatory Region	X	X
15337	Solution NMR Structure of SO0334 from Shewanella Oneidensis. Northeast Structural Genomics Target SoR75	X	X
15338	NMR Structure of Protein YfgJ from Salmonella Typhimurium. Northeast Structural Genomics Target StR86.	X	X
15339	Solution NMR Structure of Ribosome Modulation Factor VP1593 from Vibrio parahaemolyticus. Northeast Structural Genomics Target VpR55	X	X
15340	1H, 13C, and 15N Backbone Assignments and 13C Aliphatic Sidechain Assignments for PKA Phosphorylated CFTR Regulatory Region	X	X
15341	Solution Structure of Q5LLS5 from Silicibacter pomeroyi. Northeast Structural Genomics Consortium target SiR90.	X	X
15343	Solution NMR Structure of CAPER RRM2 Domain. Northeast Structural Genomics Target HR4730A.	X	X
15344	The solution structure of the protein coded by gene RHOS4_12090 of R. sphaeroides. Northeast structural genomics target RhR5	X	X
15346	NMR chemical shift assignments for E. coli YejL protein: target ER309 of the Northeast Structural Genomics Consortium	X	X
15347	Chemical Shift Assignments for protein NE0084 from Nitrosomonas europea: Northeast Structural Genomics Target NeT6	X	X
15348	Solution structure of the Bright/ARID domain from the human JARID1C protein.	X	X
15349	Solution structure of second SH3 domain of adaptor Nck	X	X
15350	Northeast Structural Genomics Target SR478	X	X
15351	Solution structure of first SH3 domain of adaptor Nck	X	X
15352	NMR Structure of protein Q6N9A4_RHOPA:Northeast Structural Genomics Consortium Target RpT8	X	X
15353	Solution NMR Structure of Bordetella bronchiseptica protein BB2007: Northeast Structural Genomics Consortium Target BoR54	X	X
15354	NMR Structure of protein Q60C73_METCA:Northeast Structural Genomics Consortium target McR1	X	X
15356	Solution NMR Structure of Human Myeloid Differentiation Primary Response (MyD88). Northeast Structural Genomics target HR2869A.	X	X
15357	the solution structure of SNase complex	X	X
15359	Solution structure of arenicin-1	X	X
15361	Solution Structure of MMP20 complexed with NNGH	X	X
15363	A D-amino acid containing conopeptide, marmophine, from Conus marmoreus	X	X
15364	Solution Structure of Human Immunodificiency Virus Type-2 Nucleocapsid Protein	X	X
15369	Maize Ribosome-Inactivating protein (MOD)	X	X
15370	solution structure of the atypical PDZ-like domain of synbindin	X	X
15371	antimicrobial resistance protein	X	X
15372	Solution Structure of the Tick Carboxypeptidase Inhibitor	X	X
15373	The prokaryotic Cys2His2 zinc finger adopts a novel fold as revealed by the NMR structure of A. tumefaciens Ros DNA binding domain	X	X
15378	NMR structure of the S. aureus VraR DNA binding domain	X	X
15379	Sup35 NM	X	X
15381	Solution structure of the E. coli Tat proofreading chaperone protein NapD	X	X
15383	1H, 13C, and 15N Chemical Shift Assignments for the N-domain of Bacillus subtilis ClpC	X	X
15384	Four-Alpha-Helix Bundle with Designed Anesthetic Binding Pockets II: Halothane Effects on Structure and Dynamics	X	X
15385	Solution structure of F104W cardiac troponin C	X	X
15386	Solution NMR structure of PefI protein from Salmonella typhimurium. Northeast Structural Genomics target StR82.	X	X
15388	Solution Structure of F153W cardiac troponin C	X	X
15390	Influenza Hemagglutinin Fusion Domain Mutant F9A	X	X
15391	Tetrameric structure of KIA7 peptide	X	X
15392	Tetrameric structure of KIA7F peptide	X	X
15400	Backbone and side chain chemical shift assignments of the F153-to-5-flurotryptophan mutant of human cardiac troponin C	X	X
15404	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for H. capsulatum CBP	X	X
15405	The NMR Solution Structure of Recombinant RGD-hirudin	X	X
15406	Solution structure of E.coli PapI	X	X
15407	Third SH3 domain of CD2AP	X	X
15408	NMR-detected conformational exchange observed in a computationally designed variant of protein Gb1	X	X
15411	NMR structure of the talin C-terminal actin binding site	X	X
15413	High resolution NMR structure of YW12D in the presence of Lipopolysaccharide (LPS)	X	X
15415	Solution structure of Sso6901 from Sulfolobus solfataricus P2	X	X
15419	Solution Structure of protein RPA3401, Northeast Structural Genomics Consortium Target RpT7, Ontario Center for Structural Proteomics Target RP3384	X	X
15422	Partial chemical shift assignments of KChIP4a in its Ca2+- and Mg2+-loaded form	X	X
15423	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments for FimA	X	X
15425	Partial chemical shift assignments of the N-terminal deletion mutant KChIP4a(Delta1-42) in its Ca2+- and Mg2+-loaded form	X	X
15427	Chemical shift assignments of the F104-to-5-flurotryptophan mutant of cardiac troponin C	X	X
15429	Solution-state NMR structures of apo-LFABP (Liver Fatty Acid-Binding Protein)	X	X
15430	The chemical shift assignment of gamma subunit of phosphodiesterase	X	X
15433	Solution-State Structures of Oleate-Liganded LFABP, Protein Only	X	X
15434	Solution-State Structures of Oleate-Liganded LFABP, Major Form of 1:2 Protein-Ligand Complex	X	X
15437	Assignment, structure, and dynamics of de novo designed protein S836	X	X
15439	URN1 FF domain yeast	X	X
15440	1H, 13C and 15N resonance assignments of the C-terminal domain of HasB from Serratia marcescens	X	X
15441	Backbone chemical shift assignments of dynein intermediate chain IC74 residues 84-143	X	X
15444	solution structure of DNA binding domain of ngTRF1	X	X
15445	15N relaxation and H/D exchange analysis of 15.5K free in solution	X	X
15449	Type I rat fatty acid synthase acyl carrier protein (ACP) domain	X	X
15450	ThrA3-DKP-insulin	X	X
15451	GABPa OST domain	X	X
15452	Backbone and sidechain 1H, 15N and 13C assignments of the human G-actin binding protein profilin II	X	X
15454	allo-ThrA3 DKP-insulin	X	X
15455	AbaA3-DKP-insulin	X	X
15456	NMR Solution Structure of homodimer protein SO_2176 from Shewanella oneidensis. Northeast Structural Genomics Consortium Target SoR77.	X	X
15457	NMR Structure of the Talin Rod domain, 1655-1822	X	X
15458	NMR Structure of the F0 domain (residues 1-85) of the Talin FERM domain	X	X
15460	High resolution structure of AK12 in the presence of Lipopolysaccharide (LPS)	X	X
15461	NMR resonance assignment of the Ccc2ab protein	X	X
15462	Solution NMR Structure of HI0947 from Haemophilus influenzae, Northeast Structural Genomics Consortium Target IR123	X	X
15464	NMR STRUCTURE OF HUMAN INSULIN MONOMER IN 35% CD3CN ZINC FREE, 50 STRUCTURES	X	X
15465	SOLUTION STRUCTURE OF THE N-TERMINAL DOMAIN OF PH1500	X	X
15466	STRUCTURE CHARACTERISATION OF PINA WW DOMAIN AND COMPARISON WITH OTHER GROUP IV WW DOMAINS, PIN1 AND ESS1	X	X
15469	NMR assignment of the domain 513-651 from the SARS-CoV nonstructural protein nsp3	X	X
15470	Resonance assignment of the Calmodulin-Munc13-1 peptide complex	X	X
15471	NMR Structure of Peptidyl-tRNA hydrolase domain protein from Pseudomonas syringae pv. tomato:Northeast Structural Genomics Consortium Target PsR211	X	X
15473	Backbone 1H, 13C, and 15N Chemical Shift Assignments for 8M Urea Denatured State of dSUMO-3(dSMT3)	X	X
15474	1H, 15N and 13C assignment and relaxation parameters of the denatured state of Azotobacter vinelandii apoflavodoxin	X	X
15476	Solution NMR structure of the folded N-terminal fragment of UPF0291 protein ynzC from Bacillus subtilis. Northeast Structural Genomics target SR384-1-46.	X	X
15477	Solution structure of the extracellular domain of Prod1, a protein implicated in proximodistal identity during amphibian limb regeneration	X	X
15478	1H and 15N resonance assignment of M7, a computationally-designed artificial protein	X	X
15479	1H, 13C and 15N Resonance Assignment for the transmembrane and cytoplasmic domains of human CD4	X	X
15481	15N and 1HN assignments of the EVH1 domain of human HOMER3A	X	X
15482	Solution NMR Structure of R. sphaeroides protein RSP_1027: Northeast Structural Genomics Consortium Target RhR95.	X	X
15483	SQAPI	X	X
15489	Chemical shift assignments of paenibacillin -- a novel lantibiotic with N-terminal acetylation	X	X
15490	Solution Structure of E coli NusG carboxyterminal domain	X	X
15491	Solution NMR structure of uncharacterized protein Q5E7H1 from Vibrio fischeri. Northeast Structural Genomics target VfR117.	X	X
15492	Backbone chemical shift assignment of a glutamate receptor ligand binding domain in complexes with five partial agonists	X	X
15493	Backbone chemical shift assignment of a glutamate receptor ligand binding domain in complexes with five partial agonists	X	X
15494	Backbone chemical shift assignment of a glutamate receptor ligand binding domain in complexes with five partial agonists	X	X
15495	Backbone chemical shift assignment of a glutamate receptor ligand binding domain in complexes with five partial agonists	X	X
15496	Backbone chemical shift assignment of a glutamate receptor ligand binding domain in complexes with five partial agonists	X	X
15497	Backbone 1H, 13C, and 15N Chemical Shift Assignments for MxiD in complex with MxiM	X	X
15498	Backbone and side-chain 1H, 13C and 15N resonance assignments for the E2 conjugating enzyme, UbcH7	X	X
15499	Solution Structure of human NEMO zinc finger	X	X
15500	Solution Structure of the EDA-ID-related C417F mutant of human NEMO zinc finger	X	X
15502	Mapping intramolecular interactions between domains in HMGB1 using a tail-truncation approach	X	X
15503	Backbone 1H, 13C, and 15N Chemical Shift Assignments for MxiM(28-142)	X	X
15504	Structural characterization of the type III pilotin-secretin interaction in Shigella flexneri by NMR spectroscopy	X	X
15506	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the intrinsically disordered translocation domain of colicin N	X	X
15507	Chemical Shift Assignments for Legionella pneumophila Mip bound to rapamycin	X	X
15510	N-terminal SH3 domain of human Nckalpha	X	X
15511	1H,13C and 15N chemical shift assignments for stereo-array isotope labelled (SAIL) C-terminal dimerization domain of SARS coronavirus nucleocapsid protein	X	X
15512	1H, 13C, and 15N NMR chemical shift assignments of the palladin Ig3 domain	X	X
15513	1H, 13C and 15N Resonance Assignemnt of HIV-1 VpU cytoplasmic domain	X	X
15514	Assignment of backbone 1H, 13C and 15N resonances of human IgG1 Fc (51.4 kDa)	X	X
15515	NMR STRUCTURAL STUDIES OF THE ANTIBIOTIC LIPOPEPTIDE DAPTOMYCIN IN DHPC MICELLES	X	X
15518	1H, 15N, 13CO, 13Calpha and 13Cbeta Chemical Shift Assignments of Human Peroxisome Proliferator-Activated Receptor Gamma Ligand-Binding Domain Bound to GW1929	X	X
15519	Backbone chemical shift assigment of chicken osteopontin	X	X
15522	Solution structure of pUL89(580-600) from Human Cytomegalovirus at pH 6.8.	X	X
15524	1H and 15N Resonance assignments for the human RLIP76 Ral binding domain	X	X
15525	1H, 13C and 15N Resonance assignments for the human RLIP76 Ral binding domain and RalB in complex	X	X
15528	Solution structure of the protease-resistent domain of Xenopus ePABP2	X	X
15529	Back bone chemical shifts of B. subtillis protein YkuJ, Northeast Structural Genomics Consortium Target SR360.	X	X
15530	Solution structure of Mj0056	X	X
15531	1H 13C and 15N chemical shift for human Granulocyte Macrophage Colony-Stimulating Factor	X	X
15532	Structure of the Wilms Tumor Suppressor Protein Zinc Finger Domain Bound to DNA	X	X
15533	Structure of the Wilms' Tumor Suppressor Protein Zinc Finger Domain Bound to DNA	X	X	X
15534	Solution Structure of the UBA domain from c-Cbl	X	X
15535	Solution NMR structures of two designed proteins with 88% sequence identity but different fold and function	X	X
15536	Solution structure of Engrailed homeodomain WT	X	X
15537	Solution NMR structures of two designed proteins with 88% sequence identity but different fold and function	X	X
15539	Backbone 1H, 13C, and 15N NMR assignments for the Cyanothece 51142 protein A1KYE3 - a protein in the DUF683 family associated with nitrogen fixation.	X	X
15540	1H, 15N, 13C Assignments of the C-terminal chromatin binding domain of the 43kDa subunit of chloroplast signal recognition particle	X	X
15542	SOLUTION NMR STRUCTURE OF UNCHARACTERIZED LIPOPROTEIN yajI FROM Escherichia coli: NORTHEAST STRUCTURAL GENOMICS TARGET ER540	X	X
15543	Solution conformation of RNA-bound NELF-E RRM	X	X		X
15544	Solution structure of designed peptide YW12D in the presence of SDS micelle	X	X
15545	1H 13C and 15N chemical shift for the human FLN29	X	X
15546	Chemical Shift Assignment of the Transmembrane Helices of DsbB by 3D Magic Angle Spinning NMR	X	X
15547	Solution structure of ubiquitin domain N-terminal to S27a ribosome subunit from Giardia lamblia	X	X
15548	Backbone assignment of stefin B monomer	X	X
15549	Solution Structure of Human C6orf115 Protein	X	X
15550	Solution structure of hPCIF1 WW domain	X	X
15551	Backbone 1H and 15N Chemical Shift Assignments for Dok1 PTB domain	X	X
15552	Beta3 Integrin Cytoplasmic Tail 1H and 15N Chemical Shift Assignments	X	X
15553	1H, 13C and 15N resonance assignments from the Gal_lectin domain of mouse Latrophilin-1 GPCR	X	X
15557	1H, 13C, and 15N Chemical Shift Assignment for actin depolymerizing and dynamics regulatory protein from Leishmania donovani	X	X
15558	1H, 13C and 15N resonance assignments of C2 domain of milk fat globule-EGF-factor 8-L	X	X
15560	1H, 13C, and 15N NMR assignments of an engineered intein based on Mycobacterium tuberculosis RecA	X	X
15561	NMR resonance assignments for Ca2+-bound DREAM	X	X
15562	Solution Structure of S. cerevisiae PDCD5-like Protein Ymr074cp	X	X
15563	Backbone 1H, 13C and 15N chemical shift assignment of N-terminal end (1-85) of human SRC	X	X
15567	Structure of the second PDZ domain of NHERF-1	X	X
15568	Solution NMR Structure of uncharacterized Lipoprotein B from Nitrosomona europaea. Northeast Structural Genomics Target NeR45A.	X	X
15569	SOLUTION STRUCTURE OF MSIN3A PAH1 DOMAIN	X	X
15570	SOLUTION STRUCTURE OF THE MSIN3A PAH1-SAP25 SID COMPLEX	X	X
15573	SOLUTION STRUCTURE OF 50S RIBOSOMAL PROTEIN LX FROM Methanobacterium thermoautotrophicum, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET TR80	X	X
15576	Ubiquitin-like domain of NFATC2IP. Northeast Structural Genomics Consortium Target hr5627.	X	X
15578	Evidence of reciprocical reorientation of the catalytic and hemopexin-like domains of full-length MMP-12	X	X
15579	NS2(1-27)	X	X
15580	NS4A(1-21)	X	X
15582	NS3(10-24)	X	X
15583	Solution structure of N-terminal Fowlicidin-1 in the presence of LPS	X	X
15584	NMR STRUCTURE OF PUTATIVE-tRNA HYDROLASE DOMAIN FROM SALMONELLA TYPHIMURIUM: NORTH EAST STRUCTURAL GENOMICS CONSORTIUM TARGET STR220	X	X
15585	Solution structure of protein ATU1810 from Agrobacterium tumefaciens; Northeast Structural Genomics Target AtR23; Ontario Center for Structural Proteomics Target ATC1776	X	X
15587	1H, 13C and 15N resonance assignment of Urm1 from Trypanosoma.brucei	X	X
15589	Backbone H, N and CA Chemical Shift Assignments for ApoMb(1-77) in Complex with DnaK Binding Domain	X	X
15591	NMR structure of the ubiquitin associated (UBA) domain of p62 (SQSTM1). RDC refined	X	X
15592	NMR structure of the ubiquitin associated (UBA) domain of p62 (SQSTM1) in complex with ubiquitin. RDC refined	X	X
15593	Solution structure of human protein C6orf130, a putative macro domain	X	X
15594	Rapid Measurement of Pseudocontact Shifts in Paramagnetic Proteins by GFT NMR Spectroscopy	X	X
15595	A novel solution NMR structure of protein yst0336 from Saccharomyces/Northest Structural Genomics Consortium Target YT51/Ontario Center for Structural Proteomics	X	X
15596	NMR Solution structure of Human MIP-3alpha/CCL20	X	X
15602	1H, 13C and 15N chemical shift assignments of human PARP-1 domain C	X	X
15603	SOLUTION NMR STRUCTURE OF LIPOPROTEIN SPR FROM ESCHERICHIA COLI K12. NORTHEAST STRUCTURAL GENOMICS TARGET ER541-37-162	X	X
15604	Solution NMR structure of Ssl0352 protein from Synechocystis sp. - Northeast Structural Genomics Consortium target SgR42	X	X
15605	HIV-1 gp41 Membrane Proximal Ectodomain Region peptide in DPC micelle	X	X
15607	Putative 32 kDa myrosinase binding protein At3g16450.1 from Arabidopsis	X	X
15608	NMR STRUCTURE OF PROTEIN VPA0419 FROM VIBRIO PARAHAEMOLYTICUS: NORTHEAST STRUCTURAL GENOMICS TARGET VPR68.	X	X
15610	Solution NMR Structure of BH09830 from Bartonella henselae Modeled with One Zn+2 Bound, Northeast Structural Genomics Consortium Target BnR55.	X	X
15611	Solution NMR structure of Nitrite reductase [NAD(P)H] small subunit from Erwinia carotovora, Northeast Structural Genomics Consortium target EwR120.	X	X
15612	Extended Polypeptide Linkers Establish the Spatial Architecture of a Pyruvate Dehydrogenase	X	X
15614	Solution structure of the complex between E.coli NusA-AR2 and RNAP-aCTD	X	X
15615	NMR Structure of the F0F1 double domain (residues 1-202) of the Talin FERM domain	X	X
15616	NMR Structure of the F1 domain (residues 86-202) of the Talin FERM domain	X	X
15617	Northeast Structural Genomics Consortium Target YG1 (Alg13), Chemical Shift Assignments	X	X
15618	NMR ASSIGNMENT OF THE DOMAIN 527-651 OF THE SARS-COV NONSTRUCTURAL PROTEIN NSP3	X	X
15620	Cam-HrTH-II	X	X
15621	Cam-HrTH-I	X	X
15622	Solution structure of an antilipopolysaccharide factor from shrimp	X	X
15623	1H, 13C, and 15N Chemical Shift Assignments for Ca2+-bound CaBP1	X	X
15624	Structure of Calmodulin complexed with the Calmodulin Binding Domain of Calcineurin	X	X
15625	NMR Structure of the VBS3 domain (residues 1815-1973) of Talin	X	X
15626	backbone assignment of yeast (Saccharomyces cerevisiae) ARF1 ,non-myristoylated, GDP-bound	X	X
15629	Conformation A configuration delta 7 and 8 and Conformation B Configuration lambda 4 of the Metal-Bound Pyoverdine PvdI, a siderophore of Pseudomonas aeruginosa	X	X
15632	Solution structure of C-terminal effector domain of putative two-component-system response regulator involved in copper resistance from Klebsiella pneumoniae	X	X
15633	Structure of a locked SDF1 dimer	X	X
15634	Solution Structure of Putative Ferrous Iron Transport Protein C (FeoC) of Klebsiella pneumoniae	X	X
15635	Structure of SDF1 in complex with the CXCR4 N-terminus containing a sulfotyrosine at postition 21	X	X
15636	Structure of SDF1 in complex with the CXCR4 N-terminus containing no sulfotyrosines	X	X
15637	Structure of SDF1 in complex with the CXCR4 N-terminus containing sulfotyrosines at postitions 7, 12 and 21	X	X
15638	Backbone 1H, 15N and 13C assignment of Rv1567c, an integral membrane protein from Mycobacterium tuberculosis	X	X
15639	1H-NMR Chemical shifts and vicinal coupling constants (3JHNHa) for 17-residue peptide corresponding to the segment within ice nucleation protein of X. campestris pv. campestris	X	X
15640	1H-NMR Chemical shifts and vicinal coupling constants (3JHNHa) for 17-residue peptide corresponding to the segment within ice nucleation protein of X. campestris pv. campestris	X	X
15642	Solution structure of the aminoterminal domain of E. coli NusG	X	X
15645	NMR STRUCTURE OF A MUTANT COLICIN E7 IMMUNITY PROTEIN IM7 WITH AN EXTENDED HELIX III	X	X
15651	NMR structure of the transmembrane domain of the Outer Membrane Protein A from Klebsiella pneumoniae in DHPC micelles.	X	X
15652	Solution NMR structure of the uncharacterized protein from Rhodospirillum rubrum gene locus Rru_A0810. Northeast Structural Genomics Target RrR43.	X	X
15653	Backbone 1H, 13C, and 15N NMR Assignments of the Tail Domain of Vinculin	X	X
15654	NMR Chemical Shift Assignments of Insulin-like Growth Factor-I (IGF-I)	X	X
15656	Apical Stem Loop Duck HBV	X			X
15661	Solution NMR Structure of protein hp1203 from Helicobacter pylori 26695	X	X
15662	1H, 13C, and 15N resonance assignments of murine amelogenin, an essential enamel biomineralization protein.	X	X
15663	Almost Complete Chemical Shift Assignments for a new calcium binding protein, EhCaM	X	X
15666	Mutant Collision E7 protein IM7 with an extended helix III in M Urea	X	X
15667	Solution structure of Fowlicidin-1 (LK19) in the presence of LPS	X	X
15669	Sequence-specific 1H, 13C and 15N resonance assignments of the GRP1 PH domain	X	X
15672	MMLV p12-CA(NTD)	X	X
15673	NMR solution structure of PisI	X	X
15674	Solution NMR structure of the chromobox protein homolog 7	X	X
15676	NMR Studies of a Pathogenic Mutant (D178N) of the Human Prion Protein	X	X
15677	Solubilization of transmembrane proteins in water: structural studies of a water-soluble analogue of the potassium channel KcsA	X	X
15678	Chemical Shift assignment of SeR13 from Staphylococcus Epidermidis, North East Structural Genomics Consortium Target SeR13	X	X
15680	Sequence-specific 1H, 13C and 15N backbone resonance assignments of the 34kDa catalytic domain of human PTPN7	X	X
15683	Solution NMR Structure of the folded C-terminal fragment of YiaD from Escherichia coli, Northeast Structural Genomics Consortium Target ER553.	X	X
15684	rat lipocalin 2	X	X
15687	Automated NMR Structure of the TA0895 by FAPSY	X	X
15688	Automated NMR Structure of the TA0956 by FAPSY	X	X
15689	Automated NMR Structure of the UBB by FAPSY	X	X
15690	The solution structure of the complex between MNK1 and HAH1 mediated by Cu(I)	X	X
15691	Structure of the DBD domain of E. coli antitoxin RelB	X	X
15693	Solution structure of Human Pax8 Paired Box Domain	X	X
15695	Solution NMR structure of the chromobox protein homolog 4	X	X
15698	Solution Structure of the Apo C terminal domain of Lethocerus troponin C isoform F1	X	X
15700	solution struture of human N-terminal domain of pirh2/Northeast Structure Genomics Consortium (NESG) target HT2A	X	X
15701	solution struture of human C-terminal domain of pirh2/Northeast Structural Genomics Consortium (NESG) target HT2C	X	X
15702	Solution NMR Structure of Bordatella pertussis protein BP2786, a Mth938-like domain: Northeast Structural Genomics Consortium target BeR31	X	X
15703	Soluble form of human earliest activation antigen of leukocytes CD69	X	X
15705	Pseudo Contact shifts and RDCs of Galectin-3 with C-terminal LBT tagged at a proton frequency of 600MHz.	X	X
15706	Backbone Chemical Shift Assignments for DPF inhibited Mature Subtilisin E	X	X
15707	NMR solution structure of the split PH domain from Phospholipase C gamma 2	X	X
15716	1H, 15N, 13C resonance assignment of the AlgE6R1 subunit from the Azotobacter vinelandii Mannuronan C5-epimerase	X	X
15718	Solution Structure of the inner DysF domain of human myoferlin	X	X
15719	Assignment of the central region (131-28) of human h1 calponin	X	X
15720	Solution structure of Arabidopsis thaliana protein At1g70830, a member of the major latex protein family	X	X
15721	Solution structure of protein ATU1203 from AGROBACTERIUM TUMEFACIENS. NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) target ATT10, Ontario Center for Structural Proteomics target ATC1183	X	X
15722	1H, 13C and 15N Resonance Assignments of Ca2+ bound collagen-binding domain derived from a clostridial collagenase	X	X
15724	3J coupling constants related to the phi-torsions in oxidised Flavodoxin from Desulfovibrio vulgaris (Hildenborough)	X	X
15725	3J coupling constants related to the chi1-torsions in oxidised Flavodoxin from Desulfovibrio vulgaris (Hildenborough)	X	X
15726	Backbone 1H, 13C, and 15N Chemical Shift Assignments for La NTD	X	X
15727	Full 1H, 13C, and 15N Chemical Shift Assignments for La NTD complexed with 5'UUUU RNA	X	X		X
15728	NMR structures of dimeric transmembrane domain of the receptor tyrosine kinase EphA1 in lipid bicelles at pH 4.3	X	X
15729	Solution Structure of Tick Carboxypeptidase Inhibitor at pH 3.5	X	X
15730	Solution structure of the folded domain of intermediate IIIa of Tick Carboxypeptidase Inhibitor	X	X
15731	Solution structure of the folded domain of intermediate IIIb of Tick Carboxypeptidase Inhibitor	X	X
15733	Solution structure of Lamin B Receptor Tudor domain	X	X
15735	truncated AcrA from Campylobacter jejuni for glycosylation studies	X	X
15736	Full length human frataxin	X	X
15737	Solution structure of an N-glycosylated protein using in vitro glycosylation	X	X			X
15738	Carbon storage regulator from Helicobacter pylori	X	X
15739	Hydramacin-1: Structure and antibacterial activity of a peptide from the basal metazoan Hydra	X	X
15740	Structure ensemble Backbone and side-chain 1H, 13C, and 15N Chemical Shift Assignments, 1H-15N RDCs and 1H-1H nOe restraints for protein K7 from the Vaccinia virus	X	X
15743	Sequence specific 1H, 13C and 15N resonance assignment of Hahellin from Hahella chejuensis, a putative member of the bg-crystallin superfamily	X	X
15744	Backbone assignment of lipid-free human apolipoprotein E (apoE)	X	X
15746	Bpp3783_115-220	X	X
15747	Structural and Functional Characterization of TM IX of the NHE1 Isoform of the Na+/H+ Exchanger	X	X
15748	D,L-Peptide Foldamers: A Beta-Hairpin/Beta-Helical Structure in Methanol	X	X
15749	D,L-Peptide Foldamers: A Curved Structure in PBS	X	X
15750	Solution NMR structure of the folded 79 residue fragment of Lin0334 fromListeria innocua. Northeast Structural Genomics Consortium target LkR15.	X	X
15752	Structure of a Glycosylphosphatidylinositol-anchored Domain from a Trypanosome Variant Surface Glycoprotein	X	X
15753	Structure of a Glycosylphosphatidylinositol-anchored Domain from a Trypanosome Variant Surface Glycoprotein	X	X
15756	1H, 13C and 15N backbone chemical shift assignments of the 2FNI-3FNI module pair from human fibronectin	X	X
15757	1H, 13C and 15N assignment for eosinophil cationic protein	X	X
15758	1H, 13C and 15N backbone chemical shift assignments of the 4FNI-5FNI module pair from human fibronectin	X	X
15759	1H, 13C and 15N backbone chemical shift assignments of the 3FNIII module from human fibronectin	X	X
15761	Chemical shift assignments for JHP0511 (HP0564) from Helicobacter pylori.	X	X
15762	NMR Structure of Protein yiiS from Shigella flexneri: Northeast Structural Genomics Consortium Target SfR90	X	X
15763	The solution structure of human Mia40	X	X
15765	Solution Structure of a Tetrahaem Cytochrome from Shewanella Frigidimarina	X	X
15766	human calpastatin Domain 1	X	X
15767	Backbone Resonance Assignments of the N-terminal half of hepatitis core protein	X	X
15768	Backbone Resonance Assignments of the N-terminal half of hepatitis core protein	X	X
15770	1H, 13C and 15N chemical shifts for the Myxococcus xanthus CarS1 antirepressor protein	X	X
15773	Analysis of Site-specific Histidine Protonation in Human Prolactin	X	X
15774	Rv1761c	X	X
15775	Backbone chemical shift assignment for the transmembrane and C-terminal domains of amyloid precursor protein (APP C99)	X	X
15778	Structure of the tyrosine-O-sulfated C5a receptor N-terminus in complex with the immune evasive protein CHIPS.	X	X
15782	1H, 13C and 15N chemical shifts of the sylvatic Dengue 1 Envelope Protein Domain III, strain P72-1244	X	X
15783	acidic fibroblast growth factor solution structure in the FGF-1-C2A binary complex: key component in the fibroblast growthfactor non-classical pathway	X	X
15784	1H, 13C, and 15N Chemical Shift Assignments for NikA(1-51)	X	X
15785	C2A domain of synaptototagmin I solution structure in the FGF-1-C2A binary complex: key component in the fibroblast growthfactor non-classical pathway	X	X
15786	1H,13C and 15N NMR assignments of duck HBV primer loop of the epsilon encapsidation signal	X			X
15787	1H and 15N chemical shift assignments for HINT1 protein	X	X
15788	X-ray crystallographic and Solution State NMR Spectroscopic Investigations of NADP+ Binding to Ferredoxin-NADP Reductase (FPR) from Pseudomonas aeruginosa	X	X
15789	Chemical shift assignments for human MCFD2	X	X
15790	NMR STRUCTURE OF THE N-TERMINAL COILED COIL DOMAIN OF THE ANDES HANTAVIRUS NUCLEOCAPSID PROTEIN	X	X
15791	Solution NMR Structure of UPF0339 Protein SO3888 from Shewanella Oneidensis. Northeast Structural Genomics Consortium Target SoR190	X	X
15796	E2-c-Cbl recognition is necessary but not sufficient for ubiquitination activity	X	X
15797	Solution structure of Tpx in the reduced state	X	X
15798	Solution structure of Tpx in the oxidized state	X	X
15799	HIV-1 Gag p6 C-terminal	X	X
15803	RalB in complex with its effector RLIP76	X	X
15804	Solution NMR Structure of M. thermoautotrophicum protein MTH_1000, Northeast Structural Genomics Consortium Target TR8	X	X
15805	NMR structure of protein PF0246 from Pyrococcus furiosus: target PfR75 from the Northeast Structural Genomics Consortium	X	X
15807	The Solution Structure of gpV, the Major Tail Protein from Bacteriophage Lambda	X	X
15808	Assignment of the 1H, 13C and 15N resonance of the Calponin Homology-2 domain of alpha-actinin-4	X	X
15809	myristoylated yeast ARF1, GDP bound	X	X
15810	Solution structure of uncharacterized protein PA1076 from Pseudomonas aeruginosa. Northeast Structural Genomics Consortium (NESG) target PaT3, Ontario Center for Structural Proteomics target PA1076.	X	X
15811	Solution structure of 30S ribosomal protein S27A from Thermoplasma acidophilum	X	X
15812	NMR Structure of FeoA-like protein from Clostridium acetobutylicum: Northeast Structural Genomics Consortium Target CaR178	X	X
15814	1H, 13C and 15N resonance assignments of the domain 5 of ABP-120 from Dictyostelium in native and 8M urea-denatured states.	X	X
15816	Solution NMR Structure of Allochromatium vinosum DsrR: Northeast Structural Genomics Consortium Target OP5	X	X
15817	Type III antifreeze protein isoform HPLC-12	X	X
15819	Solution NMR Structure of the replication Factor A Related Protein from Methanobacterium thermoautotrophicum. Northeast Structural Genomics Target TR91A.	X	X
15820	RRM1 of hnRNPLL	X	X
15821	Structure of uncharacterized protein MJ1198 from Methanocaldococcus jannaschii. Northeast Structural Genomics Target MjR117B	X	X
15822	NMR solution structure of A3DK08 protein from Clostridium thermocellum: Northeast Structural Genomics Consortium Target CmR9	X	X
15823	Solution NMR structure of protein Atu0742 from Agrobacterium Tumefaciens. Northeast Structural Genomics Consortium (NESG0) target AtT8. Ontario Center for Structural Proteomics target ATC0727.	X	X
15824	Bank Vole Prion Protein (121-231)	X	X
15825	Solution NMR Structure of Putative Lipoprotein from Pseudomonas syringae Gene Locus PSPTO2350. Northeast Structural Genomics Target PsR76A.	X	X
15827	Solution structure of antimicrobial peptide MSI-594, derived from Magainin-2 and Malittin, in the presence of LPS.	X	X
15828	NMR Structure for PF0385	X	X
15829	SOLUTION NMR STRUCTURE OF SAG0934 from Streptococcus agalactiae. NORTHEAST STRUCTURAL GENOMICS TARGET SaR32[1-108].	X	X
15833	NMR CHEMICAL SHIFT ASSIGNMENTS OF PUTATIVE UNCHARACTERIZED PROTEIN. FROM METHANOCALDOCOCCUS JANNASCHII, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET GsR195	X	X
15834	Solution NMR structure of FeoA protein from Chlorobium tepidum. Northeast Structural Genomics Consortium target CtR121	X	X
15835	Solution NMR structure of protein encoded by gene BPP1335 from Bordetella parapertussis: Northeast Structural Genomics Target BpR195	X	X
15836	Solution NMR structure of protein encoded by MTH693 from Methanobacterium thermoautotrophicum: Northeast Structural Genomics Consortium target tt824a	X	X
15837	NMR CHEMICAL SHIFT ASSIGNMENTS OF IRON(II) TRANSPORT PROTEIN A FROM CLOSTRIDIUM THERMOCELLUM , NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET VR131	X	X
15839	Solution structure of protein yiiF from Shigella flexneri serotype 5b (strain 8401) . Northeast Structural Genomics Consortium target sft1	X	X
15840	Chemical Shift assignment of RhR2 from Rodobacter Sphaeroides, North east Structural Genomics Consortium Target SeR13	X	X
15841	Solution NMR Structure of Protein FeoA from Clostridium thermocellum, Northeast Structural Genomics Consortium Target CmR17	X	X
15843	Solution NMR Structure of the N-Terminal Domain of Protein ECA1580 from Erwinia carotovora, Northeast Structural Genomics Consortium Target EwR156A	X	X
15844	NMR Solution Structure of a Thiamine Biosynthesis Protein from Geobacter Metallireducens: Northeast Structural Genomics Consortium Target GmR137	X	X
15845	Mouse Prion Protein (121-231) with Mutation S170N	X	X
15846	NMR solution Structure of Membrane associated protein from Bacillus cereus: Northeast Structural Genomics Consortium Target: BcR97A	X	X
15847	Solution NMR Structure of XF2673 from Xylella fastidiosa. Northeast Structural Genomics Consortium Target XfR39	X	X
15848	Solution NMR Structure of Putative N-Acetyl Transferase YhhK from E. coli Bound to Coenzyme A: Northeast Structural Genomics Consortium Target ET106	X	X
15849	SOLUTION NMR STRUCTURE OF the second OB-fold domain of replication protein A from Methanococcus maripaludis. NORTHEAST STRUCTURAL GENOMICS TARGET MrR110B.	X	X
15850	Solution NMR Structure of Putative Lipoprotein from Bacillus cereus Ordered Locus BC_2438. Northeast Structural Genomics Target BcR103A.	X	X
15851	NMR structure of calcium-loaded STIM1 EF-SAM	X	X
15853	Local and global structure of the monomeric subunit of the potassium channel KcsA probed by NMR	X	X
15856	NMR solution structure of the d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5(gamma)	X			X
15857	NMR solution structure of the d3'-hairpin including EBS1 together with IBS1 of the group II intron Sc.ai5(gamma)	X			X
15858	NMR solution structure of the exon/intron binding site 1 (EBS1/IBS1) of the group II intron Sc.ai5(gamma)	X			X
15859	NMR solution structure of the d3'-stem closed by a GAAA tetraloop of the group II intron Sc.ai5(gamma)	X			X
15860	NMR solution structure of modified DNA containing imidazole nucleosides at acidic, neutral and basic pH	X		X
15863	Solution structure of EAS D15 truncation mutant	X	X
15864	Solution structure of 1-112 fragment of human programmed cell death 5 protein	X	X
15865	Detailed Structural Characterization of Unbound Protein Phosphatase 1 Inhibitors	X	X
15866	CIN85 Sh3-C domain in complex with ubiquitin	X	X
15867	1H, 13C and 15N resonance assignment of 9.7 M urea-denatured GED of dynamin	X	X
15868	1H, 13C and 15N resonance assignment of guanidine-denatured GED of dynamin	X	X
15870	The domain features of the peripheral stalk subunit H of the methanogenic A1AO ATP synthase and the NMR solution structure of H1-47	X	X
15875	Backbone Chemical Shift Assignments and Relaxation Data for S. pombe Aps1d2-19	X	X
15876	Human LL-37 Structure	X	X
15877	LC3 p62 complex structure	X	X
15881	NMR assignment of Prespore Specific Antigen - a cell surface adhesion glycoprotein from Dictyostelium discoideum	X	X
15882	1H, 15N, 13C backbone assignment of the SPF45 UHM domain	X	X
15883	Backbone and 13C and 1H assignments for acid unfolded state and urea unfolded state of CTL9	X	X
15884	Backbone 1H, 13C, and 15N Chemical Shift Assignments for CTL9 native state at pH 3.8	X	X
15885	Backbone assignment of the UHM domain of Puf60 in the free form	X	X
15887	1H, 15N chemical shifts of the UHM domain of Puf60 in complex with U2AF65(85-112)	X	X
15888	1H, 15N chemical shifts of the UHM domain of Puf60 in complex with SF1(1-25)	X	X
15889	1H, 15N chemical shifts of the UHM domain of Puf60 in complex with SF3b155(194-229)	X	X
15890	1H, 15N chemical shifts of the UHM domain of Puf60 in complex with SF3b155(317-357)	X	X
15891	1H, 15N chemical shifts of the UHM domain of Puf60 in complex with Prp16(201-238)	X	X
15899	1H, 13C and 15N backbone chemical shift assignments of the C-terminal CH domain of human alpha-parvin	X	X
15901	Backbone 1H, 13C, and 15N Chemical Shift Assignments for D+PHS, a hyperstable variant of SNase, at pH 4.66	X	X
15902	Solution NMR structure of the OB domain of Ta0387 from Thermoplasma acidophilum. Northeast Structural Genomics Consortium target TaR80b.	X	X
15903	1H, 15N and 13C backbone and side chain resonance assignment of Rv0008c, an integral membrane protein from Mycobacterium tuberculosis	X	X
15904	1J coupling constants related to the Ca carbons in oxidised Flavodoxin from Desulfovibrio vulgaris (Hildenborough)	X	X
15905	1J coupling constants related to the Ca carbons in Ribonuclease T1 from Aspergillus oryzae	X	X
15906	1J coupling constants related to the Ca carbons in human Frataxin C-terminal domain (90-210)	X	X
15907	1J coupling constants related to the Ca carbons in human Ubiquitin	X	X
15908	1J coupling constants related to the Ca carbons in Xylanase from Bacillus agaradhaerens	X	X
15909	1J coupling constants related to the Ca carbons in DFPase from Loligo vulgaris	X	X
15911	NMR backbone assignments of the periplasmic loop P2 of the MalF subunit of the maltose ATP binding cassette transporter	X	X
15912	Solution Structure of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase	X	X
15913	Solution Structure of the IsdC NEAT domain bound to Zinc Protoporphyrin	X	X
15914	Backbone 1H, 13C and 15N Chemical Shift Assignments for Binder of Arl2 (BART)	X	X
15916	Solution NMR structure of protein ATU0232 from AGROBACTERIUM TUMEFACIENS. Northeast Structural Genomics Consortium (NESG) target AtT3. Ontario Center for Structural Proteomics target ATC0223.	X	X
15917	TEM-1 BETA-LACTAMASE VARIANT ALLOSTERICALLY REGULATED BY KANAMYCIN	X	X
15918	Backbone 1H, 13C, and 15N Chemical Shift Assignments for M-crystallin (calcium bound form) in presence of 4 M Gdn-Hcl	X	X
15919	NMR structure of a complex formed by the C-terminal domain of human RAP74 and a phosphorylated peptide from the central domain of the FCP1	X	X
15922	Solution structure of the PPIL1 bound to a fragment of SKIP	X	X
15923	Ca2+-S100B	X	X
15927	1H, 13C, 15N NMR resonance assignments of the actinoporin Sticholysin I	X	X
15928	Human ARNT C-Terminal PAS Domain, 3 Residue IB slip	X	X
15930	Sequence-specific 1H, 15N, and 13C resonance assignments and relaxation parameters for the whole region 4 of Escherichia coli RNA polymerase sigma70 subunit in 10% TFE	X	X
15933	NOGO66 in DPC.	X	X
15934	Backbone 1H, 13C, and 15N Chemical Shift Assignments for M-crystallin (calcium bound form) in presence of 6 M Gdn-Hcl	X	X
15935	Pfu RPP29d17-RPP21V14 complex	X	X
15936	Sequence-specific 1H, 15N, resonance assignments of nine 1H-{15N} HSQC spectras for the whole region 4 of Escherichia coli RNA polymerase sigma70 subunit recorded at TFE concentrations increasing in the range of 0-30%	X	X
15939	Solution Structure of FOXO3a Forkhead domain	X	X
15940	Association of subunit d (Vma6p) and E (Vma4p) with G (Vma10p) and the NMR solution structure of subunit G (G1-59) of the Saccharomyces cerevisiae V1VO ATPase	X	X
15942	1H, 13C and 15N assignments for rrm2 domain of PABP1	X	X
15943	Solution NMR Structure of protein of unknown function yegP from E. coli. Ontario Center for Structural Proteomics target EC0640_1_123 Northeast Structural Genomics Consortium Target ET102.	X	X
15945	MDM2 N-terminal domain	X	X
15948	1H, 13C, and 15N Chemical Shift Assignments for the RING finger of the E3 ubiquitin ligase Arkadia (RNF111)	X	X
15949	1H, 15N, 13C Resonance Assignments of the Reduced and Active Form of Human Protein Tyrosine Phosphatase, PRL-1	X	X
15950	solution structure of E.Coli SlyD	X	X
15951	HCV p7 tm2	X	X
15953	H55K mutant of LC8 at pH 6.7 from Drosophila Melanogaster	X	X
15954	human eIF5A	X	X
15955	Green Proteorhodopsin	X	X
15958	NMR Structure of Shq1p N-terminal domain	X	X
15959	Backbone 1H and 15N Chemical Shift Assignments for the Phosphotyrosine Binding Domain of Insulin Receptor Substrate 1 in the Apo and Phosphopeptide Bound Forms	X	X
15962	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the heme bound form of Truncated HasAp.	X	X
15963	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the heme bound form of Full-Length HasAp.	X	X
15964	Solution structure of Oxidised ERp18	X	X
15965	Structural Transitions of the N Terminus of a Short Non-Muscle Tropomyosin upon Binding to the C Terminus in Solution	X	X
15966	Solution NMR structure of integral membrane protein DsbB	X	X
15967	Structural characterization of IscU and its interaction with HscB	X	X
15972	1H, 13C and 15N resonance assignments of the PDZ of MAST205 in complex with the C-terminal tail from the rabies virus glycoprotein	X	X
15974	Chemical shifts of the b-b'-x region of human protein disulfide isomerase	X	X
15975	Sequence-specific 1H, 15N, and 13C resonance assignments and relaxation parameters for the whole region 4 of Escherichia coli RNA polymerase sigma70 subunit in 30% TFE	X	X
15977	Backbone and side chain 1H, 13C and 15N chemical shifts for the C-terminal domain of CdnL from Myxococcus xanthus	X	X
15978	Lipopolysaccharide Bound Structures of the Active Fragments of Fowlicidin-1, a Cathelicidin Family of Antimicrobial and Antiendotoxic Peptide from Chicken, Determined by Transferred Nuclear Overhauser Effect Spectroscopy	X	X
15979	Lipopolysaccharide Bound Structures of the Active Fragments of Fowlicidin-1, a Cathelicidin Family of Antimicrobial and Antiendotoxic Peptide from Chicken, Determined by Transferred Nuclear Overhauser Effect Spectroscopy	X	X
15980	Lipopolysaccharide Bound Structures of the Active Fragments of Fowlicidin-1, a Cathelicidin Family of Antimicrobial and Antiendotoxic Peptide from Chicken, Determined by Transferred Nuclear Overhauser Effect Spectroscopy	X	X
15981	Solution NMR Structure of Cgi121 from Methanococcus jannaschii. Northeast Structural Genomics Consortium Target MJ0187	X	X
15986	Chemical Shift Assignments of the Fibronectin 8-9FnI Domain Pair in Complex with a Type-I Collagen Peptide	X	X
15987	NMR structure of plasmid copy control protein ORF56 from sulfolobus islandicus	X	X
15988	TonB2 PROTEIN FROM Vibrio anguillarum	X	X
15989	Solution NMR structure of the R2R3 DNA binding domain of Myb1 protein from protozoan parasite Trichomonas vaginalis	X	X
15990	Structure of the Core Binding Domain of sigma54	X	X
15991	Structure of the Core Binding Domain of sigma54	X	X
15992	Solution structure of Vm24 synthetic scorpion toxin.	X	X
15998	Chemical shifts of the b'-x region of human protein disulfide isomerase	X	X
15999	Solution NMR structure of HTH_XRE family transcriptional regulator BT_p548217 from Bacteroides thetaiotaomicron. Northeast Structural Genomics Consortium Target BtR244.	X	X
16003	Backbone 1H, 13C, and 15N Chemical Shift Assignments for brain abundant protein 1 (BASP1)	X	X
16005	EphA2 dimeric structure in the lipidic bicelle at pH 5.0	X	X
16006	NMR structure of the protein TM1112	X	X
16007	NMR structure of the protein TM1367	X	X
16008	Solution structure of the SARS-unique domain-C from the nonstructural protein 3 (nsp3) of the severe acute respiratory syndrome coronavirus	X	X
16009	NMR resonance assignment of DnaE intein from Nostoc punctiforme	X	X
16010	How do Proteins Form Amyloid? Insight from the NMR Spectroscopic Characterization of 13C, 15N-labeled Ribonuclease A in 40% Acetic Acid	X	X
16011	NMR Spectroscopic Characterization of 13C, 15N-labeled Ribonuclease A in urea 8M	X	X
16014	Structure of protein complex	X	X
16015	Structure of protein complex	X	X
16016	NMR structure of TM0212 at 40 C	X	X
16018	Solution Structure of Hirsutellin A from Hirsutella thompsonii	X	X
16020	Magic-Angle-Spinning Solid-State NMR Structure of Influenza A M2 Transmembrane Domain	X	X
16022	Tetramer of KIA7W peptide	X	X
16023	Tetramer of KIA7H peptide	X	X
16026	ENHANCING THE ACTIVITY OF INSULIN BY STEREOSPECIFIC UNFOLDING	X	X
16027	ENHANCING THE ACTIVITY OF INSULIN BY STEREOSPECIFIC UNFOLDING	X	X
16029	Solution NMR structure of ubiquitin-like domain of Arabidopsis thaliana protein At2g32350. Northeast Structural Genomics Consortium target AR3433A	X	X
16030	Solution structure of protein BPP2914 from Bordetella parapertussis. Northeast Structural Genomics Consortium target BpR206	X	X
16031	Nav1.5 C-terminal EF-Hand Domain	X	X
16032	Nav1.2 C-terminal EF-Hand Domain	X	X
16035	Sequence-specific 1H, 13C and 15N backbone resonance assignments of BamC, a component of the outer membrane protein assembly machinery in Escherichia coli	X	X
16037	BlrP1 BLUF	X	X
16038	NMR Structure of the phosphorylated form of OdhI, pOdhI.	X	X
16039	NMR structure of the unphosphorylated form of OdhI, OdhI.	X	X
16040	Solution structure of onconase C87A/C104A	X	X
16042	human brain-type fatty acid binding protein (hb-FABP	X	X
16044	N-terminal backbone assignment of the polyoma virus large T antigen	X	X
16046	human brain-type fatty acid binding protein (hb-FABP bound to docosahexaenoic acid (DHA))	X	X
16047	human brain-type fatty acid binding protein (hb-FABP bound to elaidic acid	X	X
16048	human brain-type fatty acid binding protein (hb-FABP bound to oleic acid (OLA))	X	X
16049	human brain-type fatty acid binding protein (hb-FABP bound to linoleic acid (LNA))	X	X
16051	Solution NMR structure of the OB domain (residues 67-166) of MM0293 from Methanosarcina mazei. Northeast Structural Genomics Consortium target MaR214a.	X	X
16052	Assignment of 1HN, 13C, and 15N chemical shift resonances for the STAS domain of Rv1739c, a putative sulfate transporter of Mycobacterium tuberculosis	X	X
16053	Attachment of an NMR-invisible solubility enhancement tag (INSET) using a sortase-mediated protein ligation method	X	X
16054	Dimeric solution structure of the DNA loop d(TGCTTCGT)	X		X
16055	Dimeric solution structure of the cyclic octamer d(pCGCTCCGT)	X		X
16056	STRUCTURAL AND FUNCTIONAL ANALYSIS OF TM XI OF THE NHE1 ISOFORM OF THE NA+/H+ EXCHANGER	X	X
16060	Loop 3 of Short Neurotoxin II is an Additional Interaction Site with Membrane-Bound Nicotinic Acetylcholine Receptor as Detected by Solid-State NMR Spectroscopy	X	X
16061	Solution Structure of HybE from Escherichia coli	X	X
16062	NMR solution structure of the pheromone En-1 of Euplotes nobilii at -1.5 C	X	X
16064	Solution NMR structure of Bacteroides fragilis protein BF1650. Northeast Structural Genomics Consortium target BfR218	X	X
16065	Structure of E. coli toxin RelE(R81A/R83A)mutant in complex with antitoxin RelBc (K47-L79) peptide	X	X
16066	Structure of E. coli toxin RelE(R81A/R83A) mutant in the free state	X	X
16067	Backbone assignment of RelB antitoxin C-terminal peptide (RelBc) in the RelE-free state	X	X
16070	Apo Pin1 WW Domain	X	X
16071	Mouse prion protein fragment 90-231 at pH 7.0	X	X
16072	Solution NMR structure of SSP0047 from Staphylococcus saprophyticus. Northeast Structural Genomics Consortium Target SyR6.	X	X
16075	Mouse prion protein fragment mPrP[M129V](91-231) at pH 7.0	X	X
16076	Mouse prion protein fragment mPrP[P102L](91-231) at pH 7.0	X	X
16077	Mouse prion protein fragment mPrP[P105L](91-231) at pH 7.0	X	X
16078	Mouse prion protein fragment mPrP[A117V](90-231) at pH 7.0	X	X
16079	Mouse prion protein fragment mPrP[A113V,A115V,A118V](90-231) at pH 7.0	X	X
16080	Mouse prion protein fragment mPrP[K119I,H111I](90-231) at pH 7.0	X	X
16083	Northeast Structural Genomics Consortium (NESG), target MrR121A	X	X
16084	SOLUTION STRUCTURE OF TETRATRICOPEPTIDE REPEAT DOMAIN PROTEIN SRU_0103 FROM SALINIBACTER RUBER, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET SrR115C	X	X
16085	1H, 13C, 15N Chemical Shift Assignment for Saccharomyces cerevisiae Acyl Carrier Protein.	X	X
16088	Apo Pin1 WW Domain	X	X
16089	Solution NMR structure of ribosomal protein sso0164 from Sulfolobus solfataricus. NortheastStructural Genomics Consortium (NESG) target SsT4	X	X
16091	SOLUTION STRUCTURE OF 30S RIBOSOMAL PROTEIN S8E; FROM Methanothermobacter thermautotrophicus, NORTHEASTSTRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET TR71D	X	X
16093	Solution structure of protein SRU_2040 from Salinibacter ruber (strain DSM 13855). Northeast Structural Genomics Consortium target SrR106	X	X
16096	SOLUTION NMR STRUCTURE OF THE OB-FOLD DOMAIN OF HEME CHAPERONE CCME FROM DESULFOVIBRIO VULGARIS. NORTHEAST STRUCTURAL GENOMICS TARGET DVR115G.	X	X
16097	NMR solution structure of an uncharacterized protein from Chlorobium tepidum. Northeast Structural Genomics target CtR107	X	X
16098	Solution structure of Apo-form YjaB from Escherichia coli	X	X
16099	Solution NMR Structure of KAZAL-1 domain from Human Follistatin-related protein 3 (FSTL-3). Northeast Structural Genomics Target HR6186A.	X	X
16100	Solution NMR Structure of the C-Terminal Domain of Protein DR_A0006 from Deinococcus radiodurans, Northeast Structural Genomics Consortium Target DrR147D	X	X
16101	NMR solution Structure of O64736 protein from Arabidopsis thaliana:Northeast Structural Genomics Consortium MEGA Target AR3445A	X	X
16102	Solution NMR Structure of the Integrase-Like Domain from Bacillus cereus Ordered Locus BC_1272. Northeast Structural Genomics Target BcR268F	X	X
16103	1H, 13C, and 15N chemical shift assignments for murine FAIM-CTD	X	X
16104	THE DYNAMIC ALPHA-HELIX STRUCTURE OF MICELLE-BOUND HUMAN AMYLIN.	X	X
16105	THE DYNAMIC ALPHA-HELIX STRUCTURE OF MICELLE-BOUND HUMAN AMYLIN.	X	X
16108	Backbone and side-chain assignment of the lipidated and non-lipidated forms of the meningococcal outer membrane protein LP2086	X	X
16109	Solution Structure of human ubiquitin-like domain of Herpud2_9_85, Northeast Structural Genomics Consortium (NESG) target HT53A	X	X
16110	Solution structure of the conserved C-terminal dimerization domain of Borealin	X	X
16111	Sequence-specific 1H, 15N and 13C resonance assignments of Art v 1: a proline-rich allergen of Artemisia vulgaris pollen	X	X
16112	Solution structure of a K+-channel voltage-sensor paddle motif	X	X
16113	H, 13C, and 15N Chemical Shift Assignments of Protein yppE from Bacillus subtilis. Northeast Structural Genomics Consortium Target SR213	X	X
16115	Solution Structure of an SH3-like Domain from p80-Coilin	X	X
16116	NMR structures of GA95 and GB95, two designed proteins with 95% sequence identity but different folds and functions	X	X
16117	NMR structures of GA95 and GB95, two designed proteins with 95% sequence identity but different folds and functions	X	X
16118	Solution structure of PFE0790c, a putative bolA-like protein from the protozoan parasite Plasmodium falciparum: A Structural Genomics Center for Infectious Disease (SSGCID) community request.	X	X
16120	Sequence-specific 1H, 13C, and 15N resonance assignment of the Autophagy-related Protein Atg 8	X	X
16121	Structure of Archaeal L14e Ribosomal Protein from Sulfolobus sulfataricus	X	X
16122	HCV NS4B(227-254)	X	X
16124	Solution structure of RppH from Escherichia coli	X	X
16127	Solution Structure of the SAP30 zinc finger motif	X	X
16130	Backbone 1H, 13C, and 15N Chemical Shift Assignments for colicinN Tdomain residues 40-76 in complex with unlabbeled TolAIII	X	X
16131	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Colicin N Tdomain residues 40-76	X	X
16133	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TolAIII residues 296-421	X	X
16134	Backbone 1H, 13C, and 15N Chemical Shift Assignments for tolaIII residues296-421in complex with unlabelled colicin N Tdomain	X	X
16136	NMR assignment of jerdostatin from Trimeresurus jerdonii	X	X
16137	NMR structure of the first SAM domain from AIDA1	X	X
16138	NMR solution structure of metal-modified DNA	X		X
16139	NMR solution structure of the CASKIN SH3 domain	X	X
16140	[Sec13,Sec14]-kappa-hexatoxin-Hv1c	X	X
16141	NMR solution structure of the HACS1 SH3 domain	X	X
16142	Structure of SDF-1/CXCL12	X	X
16143	Structure of SDF-1/CXCL12	X	X
16144	Backbone and side chain 1H, 13C, and 15N NMR assignments for the organic hydroperoxide resistance protein (Ohr) from Burkholderia pseudomallei, Seattle Structural Genomics Center for Infectious Disease (SSGCID) target BupsA.00074	X	X
16146	Backbone resonance assignment of Staphylococcal Enterotoxin H	X	X
16147	NMR assignments of oxidised thioredoxin from Plasmodium falciparum	X	X
16148	NMR structure of Plantaricin K in DPC-micelles	X	X
16149	Plantaricin K in TFE	X	X
16150	NMR assignment of jerdostatin mutant R24K from Trimeresurus jerdonii	X	X
16151	NMR assignment of jerdostatin from Trimeresurus jerdonii, with deletion of two residues (N45 G46) from the C-terminal end	X	X
16152	NMR assignment of jerdostatin mutant R24K from Trimeresurus jerdonii, with deletion of two residues (N45 G46) from the end C-terminal	X	X
16153	Structure of the transcription repressor SvtR08 (gp08) from the hyperthermophilic archaeal virus SIRV1	X	X
16154	Solution NMR structure of the OB domain (residues 67-166) of MM0293 from Methanosarcina mazei. Northeast Structural Genomics Consortium target MaR214a.	X	X
16155	Solution NMR structure of protein HS00059 from Homo Sapiens. Northeast Structural Genomics Consortium (NESG) target HT98A.	X	X
16158	Beta1D Integrin Cytoplasmic Tail 1H and 15N Chemical Shift Assignments	X	X
16159	Beta1A Integrin Cytoplasmic Tail 1H and 15N Chemical Shift Assignments	X	X
16160	1H, 13C, and 15N Chemical Shift Assignments for Myosin Phosphatase Trageting Subunit 1 (residues 1-98)	X	X
16161	Solution NMR Structure of a domain from a Putative Phage Integrase Protein BF2284 from Bacteroides fragilis, Northeast Structural Genomics Consortium Target BfR257C	X	X
16162	Beta1D Integrin Cytoplasmic Tail (Polyhistidine-Tagged) 1H and 15N Chemical Shift Assignments	X	X
16163	NMR structure of the N-terminal domain of kindlin1	X	X
16167	NMR data for FXYD4 in micelles	X	X
16168	STRUCTURE OF THE NA,K-ATPASE REGULATORY PROTEIN FXYD1 IN MICELLES	X	X
16169	Barnase low pressure reference	X	X
16170	Barnase high pressure structure	X	X
16171	Barnase bound to d(CGAC), low pressure	X	X
16172	Barnase bound to d(CGAC) high pressure	X	X
16173	The structure of the cataract causing P23T mutant of human gamma-D crystallin	X	X
16174	15N, 13C and 1H resonance assignments for the Rv0287-Rv0288 complex	X	X
16175	Backbone assignments for odorant binding protein 1	X	X
16176	Prp40 FF4 domain	X	X
16177	Backbone and sidechain chemical shift assignments for E73 from SSV-RH	X	X
16183	Tammar Wallaby Prion Protein (121-230)	X	X
16184	Mouse Prion Protein (121-231) with Mutations Y225A and Y226A	X	X
16185	Mouse Prion Protein (121-231) with Mutation V166A	X	X
16186	Solution NMR structure of PSPTO_3016 from Pseudomonas syringae. Northeast Structural Genomics Consortium target PsR293.	X	X
16188	NMR structure of Rv2175c	X	X
16189	Structure of the amino-terminal domain of human FK506-binding protein 3 / Northeast Structural Genomics Consortium Target HT99A	X	X
16190	Structure of the N-terminal domain of human cardiac troponin C bound to calcium ion and to the inhibitor W7	X	X
16191	NMR-Assignments of a Cytosolic Domain of the C-Terminus of Polycystin-2	X	X
16195	Resonance assignments of the human AKAP13 PH domain and stabilizing DH helix	X	X
16209	Solution Structure of JARID1A C-terminal PHD finger	X	X
16210	Solution structure of JARID1A C-terminal PHD finger in complex with H3(1-9)K4me3	X	X
16211	Solution structure of putative prolyl isomerase PpiD from E.Coli	X	X
16212	Dimeric solution structure of the DNA loop d(TCGTTGCT)	X		X
16214	Zn finger protein YBIL from E.Coli; NESG target ET107; OCSP target EC0402	X	X
16215	Refined solution structure of des-pyro Glu brazzein	X	X
16216	Solution structure of protein ITSN1 from Homo sapiens. Northeast Structural Genomics Consortium target HR5524A	X	X
16217	Backbone 1H, 13CA, and 15N Chemical Shifts Assignments and 15N T1 and T2 Relaxation Parameters for the N-terminal (1-119) Fragment of sperm whale apomyoglobin	X	X
16218	Backbone 1H, 13CA, and 15N Chemical Shifts Assignments and 15N T1 and T2 Relaxation Parameters for the N-terminal (1-119) Fragment of sperm whale apomyoglobin in the presence of DnaK-beta	X	X
16219	Solution structure of SH3 domain of PTK6	X	X
16221	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Collagen Binding domain of MMP2	X	X
16228	1H, 13C, and 15N chemical shift assignments for stereo-array labeled (SAIL) ubiquitin	X	X
16229	1H, 13C, and 15N Chemical Shift Assignments for ring1B C-terminal domain/ cbx7 CBOX complex	X	X
16230	Solution Structure of Yeast Prp24-RRM2 Bound to a Fragment of U6 RNA	X	X		X
16231	Solution Structure of a Pathogen Recognition Domain from a Lepidopteran Insect, Plodia interpunctella	X	X
16234	Relaxation data of the N-terminal domain of capsid protein from the Mason-Pfizer monkey virus	X	X
16236	Bruno RRM3+	X	X
16237	Solution structure of the amino-terminal domain of OmpATb, a pore forming protein from Mycobacterium tuberculosis.	X	X
16238	Solution NMR structure of VC_A0919 from Vibrio cholerae. Northeast Structural Genomics Consortium Target VcR52.	X	X
16239	Plantaricin J in DPC-micelles	X	X
16240	Solution structure of full-length SlyD from E.coli	X	X
16241	Plantaricin J in TFE	X	X
16243	Backbone NH Assignments for Prp24-RRM23	X	X
16244	Backbone NH Assignments for Prp24-RRM23 Bound to AGAGAU RNA	X	X		X
16246	Resonance Assignments for Yeast Prp24-RRM2	X	X
16247	NMR solution structure of the b30-82 domain of subunit b of Escherichia coli F1FO ATP synthase	X	X
16248	PknB-phosphorylated Rv1827	X	X
16249	The carboxy-terminal non-repetitive domain of a spider dragline silk protein regulates nucleation of silk assembly	X	X
16250	NMR solution structure of the EH 1 domain from human intersectin-1 protein. Northeast Structural Genomics Consortium target HR3646e.	X	X
16251	Solution NMR structure of a phage integrase SSP1947 fragment 59-159 from Staphylococcus saprophyticus, Northeast Structural Genomics Consortium Target SyR103B	X	X
16252	1H, 13C, 15N Chemical shift assignments of A13 homeodomain	X	X
16253	NMR chemical shift assignments for Rv2377c, a MbtH-like protein from Mycobacterium tuberculosis: A Structural Genomics Center for Infectious Disease (SSGCID) community request	X	X
16256	Drosha RNA Binding Domain	X	X
16257	Nogo66 at pH4.0	X	X
16258	Solution Structure of RCL	X	X
16259	Beta7 Integrin Cytoplasmic Tail 1H and 15N Chemical Shift Assignments	X	X
16260	NMR assignments of FK506 binding domain from Plasmodium vivax	X	X
16261	1H, 15N, 13C assignments of the Riphicephalus (Boophilus) microplus antimicrobial protein microplusin	X	X
16262	NMR solution structure of the N-terminal domain of the DNA polymerase alpha p68 subunit	X	X
16263	Backbone and sidechain 1H, 15N and 13C assignments of the NLRP7 Pyrin domain	X	X
16265	Complete backbone 15N, 13C and 1H resonance assignments for the oxidized form of the N-terminal domain of AhpF	X	X
16267	Solution NMR structure of tungsten formylmethanofuran dehydrogenase subunit D from Archaeoglobus fulgidus, Northeast Structural Genomics Consortium target AtT7	X	X
16268	Human cannabinoid receptor-2 helix 6	X	X
16269	n-NafY. N-terminal domain of NafY	X	X
16270	SOLUTION STRUCTURE OF THE S. AUREUS SORTASE A-SUBSTRATE COMPLEX	X	X
16271	A PH domain within OCRL bridges clathrin mediated membrane trafficking to phosphoinositide metabolis	X	X
16272	Solution NMR structure of an O6-methylguanine DNA methyltransferase family protein from Vibrio parahaemolyticus. Northeast Structural Genomics Consortium target VpR247.	X	X
16273	A PH domain within OCRL bridges clathrin mediated membrane trafficking to phosphoinositide metabolism	X	X
16274	SLBP PAPA peptide	X	X
16276	NMR structure of the SO2144 H-NOX domain from Shewanella oneidensis in the Fe(II)CO ligation state	X	X
16278	NMR structure of the H103G mutant SO2144 H-NOX domain from Shewanella oneidensis in the Fe(II)CO ligation state	X	X
16279	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the yeast Hsp90 Middle Domain	X	X
16280	d(GAGCTC)2 assignments	X		X
16281	d(GAGCTC)2 plus dqdppn	X		X
16283	1.7-mm microcryoprobe solution NMR structure of an O6-methylguanine DNA methyltransferase family protein from Vibrio parahaemolyticus. Northeast Structural Genomics Consortium target VpR247.	X	X
16287	d(AGAGCTCT)2 plus dqdppn 1:2 assignments	X		X
16288	d(CGAGCTCG)2 plus dqdppn 1:2 assignments	X		X
16290	d(GCTATAGC)2 1:1 complex with dqdppn assignments	X		X
16291	d(AGAGCTCT)2 plus Ru ligand 1:2 assignments	X		X
16292	d(CGAGCTCG)2 plus Ru ligand 1:2 assignments	X		X
16293	Solution structure of CA150 FF1 domain and FF1-FF2 interdomain linker	X	X
16297	AIDA-1 SAM domain tandem	X	X
16298	Solution NMR structure of the domain N-terminal to the integrase domain of SH1003 from Staphylococcus haemolyticus. Northeast Structural Genomics Consortium Target ShR105F (64-166).	X	X
16299	NMR assignment of a 48 kDa tetramer of the T1 domain of the mammalian voltage gated potassium channel Kv1.4	X	X
16306	1H, 15N, and 13C resonance assignments of the 2/2 hemoglobin from the cyanobacterium Synechococcus sp. PCC 7002 in the ferric bis-histidine state	X	X
16307	1H, 15N, and 13C resonance assignments of the 2/2 hemoglobin from the cyanobacterium Synechococcus sp. PCC 7002 in the ferric bis-histidine state	X	X
16311	Solution structure of the complex of VEK-30 and plasminogen kringle 2	X	X
16312	Solution NMR structure of a domain from a putative phage integrase protein Nmul_A0064 from Nitrosospira multiformis, Northeast Structural Genomics Consortium Target NmR46C.	X	X
16313	NMR Solution Structure of a Tubulin folding cofactor B obtained from Arabidopsis thaliana: Northeast Structural Genomics Consortium target AR3436A	X	X
16315	NMR structure of fragment 87-196 from the putative phage integrase IntS of E. coli: Northeast Structural Genomics Consortium target ER652A	X	X
16316	NMR structure of IntB phage-integrase-like protein fragment 90-199 from Erwinia carotova subsp. atroseptica: Northeast Structural Genomics Consortium target EwR217E	X	X
16317	Solution structure of human interleukin-33	X	X
16318	NMR Structure of CBP TAZ2 and Adenoviral E1A Complex	X	X
16319	The solution structure of the circular bacteriocin carnocyclin A (CclA)	X	X
16320	Solution structure of an archaeal protein SSO6904 from hyperthermophilic Sulfolobus solfataricus	X	X
16321	Backbone 1H, 13C and 15N resonance assignments for the E2 conjugating enzyme, UbcH8	X	X
16323	SLBP RBD 30-mer peptide	X	X
16325	Chemical shift assignments of the second domain of the listeria protein Lin2157, Northeast Structural Genomics Consortium target Lkr136b	X	X
16329	1H, 15N and 13C chemical shift assignments for the oxidised form of the DsbA oxidoreductase from Staphylococcus aureus	X	X
16330	1H, 15N and 13C chemical shift assignments for the reduced form of the DsbA oxidoreductase from Staphylococcus aureus	X	X
16334	Sequence specific backbone resonance assignment of Neuronal Calcium Sensor 1(NCS1) in non-myristoylated form.	X	X
16335	Solution structure of protein YlbL (BSU15050) from Bacillus subtilis, Northeast Structural Genomics Consortium target sr713a	X	X
16336	Solution Structure Of Protein NMB1076 From Neisseria meningitidis. Northeast Structural Genomics Consortium Target MR101B.	X	X
16337	Backbone resonance assignments for the aminoglycoside phosphotransferase(3')-IIIa	X	X
16338	Solution NMR structure of the N-terminal Ubiquitin-like Domain from Tubulin-binding Cofactor B, CG11242, from Drosophila melanogaster. Northeast Structural Genomics Consortium Target FR629A (residues 8-92).	X	X
16340	100% complete assignment of non-labile 1H, 13C, and 15N signals for calcium-loaded Calbindin D9K P43G	X	X
16342	Backbone 1H, 13C, 15N and 13C-beta Chemical Shift Assignments for alpha-synuclein at pH 3	X	X
16343	NMR STRUCTURE OF HUMAN INSULIN MUTANT GLU-B21-D-GLU, HIS-B10 ASP PRO-B28-LYS, LYS-B29-PRO, 20 STRUCTURES	X	X
16344	Solution structure and backbone dynamics of the ribosomal protein S6wt.	X	X
16345	Solution structure and backbone dynamics of the permutant P54-55	X	X
16347	Solution NMR structure of protein ATC0852 from Agrobacterium tumefaciens. Northeast Structural Genomics Consortium (NESG) target AtT2.	X	X
16348	SOLUTION STRUCTURE OF DEAD RINGER-LIKE PROTEIN 1 (AT-RICH INTERACTIVE DOMAIN-CONTAINING PROTEIN 3A) FROM HOMO SAPIENS, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET HR4394C	X	X
16349	SOLUTION STRUCTURE OF C-terminal Domain of Tyrosine-protein kinase ABL2 FROM HOMO SAPIENS, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET HR5537A	X	X
16350	NMR solution structure of the pheromone En-A1 from Euplotes nobilii	X	X
16352	Solution NMR structure of protein AF2094 from Archaeoglobus fulgidus. Northeast Structural Genomics Consotium (NESG) target GT2	X	X
16353	SOLUTION STRUCTURE OF SH2 DOMAIN OF PROTO-ONCOGENE TYROSINE-PROTEIN KINASE FER FROM HOMO SAPIENS, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET HR3461D	X	X
16354	NMR solution structure of the N terminal domain of subunit E (E1-52) of A1AO ATP synthase from Methanocaldococcus jannaschii	X	X
16355	NMR Solution Structure of a Putative Uncharacterized Protein obtained from Arabidopsis thaliana: Northeast Structural Genomics Consortium target AR3449A	X	X
16356	Structure of a two-G-tetrad intramolecular G-quadruplex formed by a variant human telomeric sequence in K+ solution	X		X
16357	Solution NMR Structure of a dimeric protein of unknown function from Methanobacterium thermoautotrophicum, Northeast Structural Genomics Consortium Target TR5	X	X
16359	chemical shift assignment of West Nile protease in the absence of inhibitor	X	X
16360	1H, 13C and 15N NMR sequence-specific resonance assignments and relaxation parameters for human apo-S100A1(aa) in the reduced form	X	X
16361	NMR structure of the p62 PB1 domain	X	X
16362	1H, 13C and 15N NMR assignments of StnII-R29Q, a defective lipid binding mutant of the sea anemone actinoporin Sticholysin II.	X	X
16363	Solution structure of the Nuclear coactivator binding domain of CBP	X	X
16364	Solution NMR structure of FHA domain of Mb1858 from Mycobacterium bovis. Northeast Structural Genomics Consortium Target MbR243C (24-155).	X	X
16365	Solution NMR structure of yeast protein YOR252W [residues 38-178]: Northeast Structural Genomics Consortium target YT654	X	X
16366	Solution NMR structure of Themotoga maritima protein TM1076: Northeast Structural Genomics Consortium target VT57	X	X
16367	NMR Evidence for differential phosphorylation-dependent interactions in WT and DeltaF508 CFTR	X	X
16368	Solution NMR structure of the homodimeric winged helix-turn-helix DNA-binding domain (fragment 1-100) Mb0332 from Mycobacterium bovis, a possible ArsR-family transcriptional regulator. Northeast Structural Genomics Consortium Target MbR242E.	X	X
16370	Solution NMR Structure of the Ig-like C2-type 2 Domain of Human Myotilin. Northeast Structural Genomics Target HR3158.	X	X
16371	Solution Structure Of Protein DSY2949 From Desulfitobacterium hafniense. Northeast Structural Genomics Consortium Target DhR27	X	X
16373	Solution NMR structure of an integrase domain from protein SPA4288 from Salmonella enterica, Northeast Structural Genomics Consortium Target SlR105H	X	X
16374	Solution Structure of C-terminal domain of reduced NleG2-3 (residue 90-191) from Pathogenic E. coli O157:H7. Northeast Structural Genomics Consortium and Midwest Center for Structural Genomics target ET109A	X	X
16375	Solution Structure of C-terminal domain of oxidized NleG2-3 (residue 90-191) from Pathogenic E. coli O157:H7. Northeast Structural Genomics Consortium and Midwest Center for Structural Genomics target ET109A	X	X
16376	Solution NMR structure of the monomeric W187R mutant of A/Udorn NS1 effector domain. Northeast Structural Genomics target OR8C[W187R].	X	X
16377	RpR325/RPA3574 from Rhodopseudomonas palustris	X	X
16378	Chemical shift assignment of GtR34C from Geobacillus thermodenitrificans. North East Structural Genomics Consortium Target GtR34C	X	X
16380	NMR solution structure of A2LD1 (gi:13879369)	X	X
16381	Sequence-specific resonance assignments of human VDAC-1 in LDAO micelles	X	X
16382	Solution NMR structure of the Rhodanese-like domain from Anabaena sp Alr3790 protein. Northeast Structural Genomics Consortium Target NsR437A	X	X
16384	Solution NMR Structure of protein yutD from B.subtilis, Northeast Structural Genomics Consortium Target Target SR232	X	X
16385	Solution NMR structure of the CARDB domain of PF1109 from Pyrococcus furiosus. Northeast Structural Genomics Consortium target PfR193A	X	X
16386	Solution NMR Structure of the EGF-like 1 Domain of Human Fibulin-4. Northeast Structural Genomics Target HR6275.	X	X
16387	Solution NMR Structure of denovo designed ferrodoxin fold like protein, Northeast Structural Genomics Consortium Target Target OR15	X	X
16388	NMR Solution structure of a diflavin flavoprotein A3 from Nostoc sp. PCC 7120, Northeast Structural Genomics Consortium Target NsR431C	X	X
16390	NMR solution structure of human ubiquitin-like domain of ubiquilin 1, Northeast Structural Genomics Consortium (NESG) target HT5A	X	X
16392	NMR relaxation data for the beta-lactamase TEM-1	X	X
16393	NMR Evidence for differential phosphorylation-dependent interactions in WT and deltaF508 CFTR	X	X
16394	NMR Evidence for differential phosphorylation-dependent interactions in WT and deltaF508 CFTR	X	X
16395	Assignments of M.HhaI bound with hemimethylated DNA	X	X
16396	The solution structure of CBD of human MCM6	X	X
16397	Solution structure of SCA7 zinc finger domain from human ataxin-7 protein	X	X
16398	1H, 13C and 15N Chemical Shift Assignment for the Psb27 Protein of Synechocystis PCC 6803	X	X
16399	Role of Trp-Trp interactions in Trpzip beta-hairpin formation, structure and stability	X	X
16402	Solution structure of SCA7 zinc finger domain from human Ataxin-7-L3 protein	X	X
16407	Role of Trp-Trp interactions in Trpzip beta-hairpin formation, structure and stability	X	X
16411	Solution structure of Rtt103 CTD interacting domain	X	X
16412	Solution structure of Rtt103 bound to CTD peptide	X	X
16413	C17orf37 Human 9606 Eukaryota Matazoa Homo sapiens	X	X
16414	Interaction of the Second Binding Region Troponin I with the Regulatory Domain of Skeletal Muscle Troponin C as Determined by NMR Spectroscopy	X	X
16415	1H NMR and fluorescence studies of the complexation of DMPG by wheat non-specific lipid transfer protein. Global fold of the complex	X	X
16416	A solution NMR study of the binding kinetics and the internal dynamics of an HIV-1 protease-substrate complex	X	X
16417	An Atomic Resolution Model for Assembly, Architecture, and Function of the Dr Adhesins	X	X
16418	Interaction between calcium-free calmodulin and IQ motif of neurogranin studied by nuclear magnetic resonance spectroscopy	X	X
16419	Local Perturbations by Ligand Binding of Hydrogen Deuterium Exchange Kinetics in a Four-helix Bundle Protein, Acyl Coenzyme A Binding Protein (ACBP)	X	X
16420	Protein stablilization by specific binding of guanidinium to a functional arginine-binding surface on an SH3 domain	X	X
16421	Solution Structure and Backbone Dynamics of the Trypanosoma cruzi Cysteine Protease Inhibitor Chagasin	X	X
16422	Solution Structure and Dynamics of the N-terminal Cystosolic Domain of Rhomboid Intramembrane Protease from Pseudomonas aeruginosa: Insights into a Functional Role in Intramembrane Proteolysis	X	X
16423	Solution structure of a neurotrophic ligand bound to FKB12 and its effects on protein dynamics	X	X
16424	Solution Structure of BamE, a component of the outer membrane protein assembly machinery in Escherichia coli	X	X
16426	NMR-derived structure of residues 29-138 of murine Ets-1, containing the PNT domain, along with phosphorylated Thr38 and Ser41	X	X
16439	Combined high- and low-resolution techniques reveal compact structure in central portion of factor H despite long inter-modular linkers	X	X
16442	Solution structure of At3g03773.1 protein from Arabidopsis thaliana	X	X
16443	NMR Solution structures of fully oxidised cytochrome c3 from Desulfovibrio desulfuricans ATCC 27774	X	X
16444	NMR Chemical Shifts of GB1-SC35	X	X
16445	Backbone and side chain 1H, 13C, 15N chemical shift assignments for K2	X	X
16446	Chemical shift assignments for Ncs1p	X	X
16450	Backbone and side chain 1H, 13C, 15N chemical shift assignments for YSK2	X	X
16453	Intramolecular Dynamics of Low Molecular Weight Protein Tyrosine Phosphatase in Monomer-Dimer Equilibrium Studied by NMR: A Model for Changes in Dynamics upon Target Binding	X	X
16454	NMR Solution Structure of Complement-like Repeat CR3 from the Low Density Lipoprotein REceptor-related Protein	X	X
16455	Study of the interaction between salivary proline-rich proteins and a polyphenol by 1H-NMR spectroscopy	X	X
16456	The layered fold of the TSR domain of P. falciparum TRAP contains a heparin binding site	X	X
16457	The Structural Basis for the Ligand Specificity of Family 2 Carbohydrate-binding Modules	X	X
16458	NMR-based modeling and binding studies of a ternary complex between chicken liver bile acid binding protein and bile acids	X	X
16459	Solution Structure of the Ran-binding Domain 2 of RanBP and its Interaction with the C Terminus of Ran	X	X
16460	The B12-Binding Subunit of Glutamate Mutase from Clostridium tetanomorphum Traps the Nucleotide Moiety of Coenzyme B12	X	X
16461	The C-terminal domain of the HIV-1 regulatory protein Vpr adopts an antiparallel dimeric structure in solution via its leucine-zipper-like domain	X	X
16462	Ligand-induced changes in dynamics in the RT loop of the C-terminal SH3 domain of Sem-5 indicate cooperative conformational coupling	X	X
16465	CALMODULIN WRAPS AROUND ITS BINDING DOMAIN IN THE PLASMA MEMBRANE CA2+ PUMP ANCHORED BY A NOVEL 18-1 MOTIF	X	X
16467	The Solution structure of the eTAFH domain of AML1-ETO complexed with HEB peptide	X	X
16468	High-resolution solution structure of the ASIC1a blocker PcTX1	X	X
16469	3J coupling constants related to the phi-torsion angles in Ribonuclease T1 (EC 3.1.27.3)	X	X
16470	Backbone 1H, 13C, and 15N Chemical Shift Assignments for ShcA PTB Domain	X	X
16471	Backbone 1H, 13C, and 15N Chemical Shift Assignments for IQGAP1 (401-533)	X	X
16472	NMR Solution Structure of SH2 Domain of the Human Tensin Like C1 Domain Containing Phosphatase (TENC1)	X	X
16473	Solution structure of zinc-substituted rubredoxin B (Rv3250c) from Mycobacterium tuberculosis. Seattle Structural Genomics Center for Infectious Disease(SSGCID)target MytuD.01635a	X	X
16475	Assignment of 1H, 13C and 15N backbone resonances of Escherichia coli LpxC bound to L-161,240	X	X
16476	Solution structure of protein Atu0922 from A. tumefaciens. Northeast Structural Genomics Consortium target AtT13. Ontario Center for Structural Proteomics target ATC0905.	X	X
16477	Solution structure of the transmembrane proximal region of the hepatis C virus E1 glycoprotein.	X	X
16478	Solution structure of UBA domain of XIAP	X	X
16480	NMR solution structure of double module LA45 of LDLR	X	X
16481	1H, 13C and 15N resonance assignments of the hyperthermostable 264-residue endo--1,3-glucanase LamA at 62 C	X	X
16482	Solution Structure of complement repeat CR17 from LRP-1	X	X
16483	Fusion construct of CR17 from LRP-1 and ApoE residues 130-149	X	X
16485	Solution structure of the THAP zinc finger of THAP1 in complex with its DNA target	X	X	X
16486	Solution NMR structure of the ACT domain from GTP pyrophosphokinase of Chlorobium tepidum. Northeast Structural Genomics Consortium Target CtR148A	X	X
16492	The Structure of Anti-TRAP	X	X
16498	Solution NMR structure of CLOLEP_01837 (fragment 61-160) from Clostridium leptum. Northeast Structural Genomics Consortium Target QlR8A.	X	X
16503	Ribonuclease A in 40% acetic acid and 8M urea pH 2	X	X
16504	Human cannabinoid receptor 1 - helix 7/8 peptide	X	X
16505	NMR structure of the octarepeat region of prion protein bound to pentosan polysulfate	X	X
16507	NMR structure of mouse Par3-PDZ3 in complex with VE-Cadherin C-terminus	X	X
16508	NMR chemical shift assignments of lipid-bound synaptobrevin	X	X
16509	Complement Repeats 16 17 and 18 from LRP-1	X	X
16510	The solution structure of the first PHD finger of autoimmune regulator in complex with non-modified histone H3 tail reveals the antagonistic role of H3R2 methylation	X	X
16511	A Doppel alpha-helix Peptide Fragment Mimics the Copper(II) Interactions with the whole Protein	X	X
16512	NMR chemical shift of synaptobrevin fragment 60-116	X	X
16514	NMR chemical shifts of soluble synaptobrevin (1-96) in buffer and in DPC micelle	X	X
16515	Solution structure of mouse Par-3 PDZ2 (residues 450-558)	X	X
16516	Backbone and 13Cb chemical shifts for human AP endonuclease 1 (APE1) residues 39-318	X	X
16517	Solution structure of an arsenate reductase (ArsC) related protein from Brucella melitensis. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target BrabA.00007.a.	X	X
16518	Backbone resonance assignments for oxidised Trypanosoma cruzi glutathione peroxidase	X	X
16519	Solution structure of human SDF1-alpha H25R	X	X
16520	Solution structure of humar Par-3b PDZ2 (residues 451-549)	X	X
16521	NMR solution structure of CV_2116 from Chromobacterium violaceum.Northeast Structural Genomics Consortium Target CvT4(1-82)	X	X
16522	A Doppel alpha-helix Peptide Fragment Mimics the Copper(II) Interactions with the whole Protein	X	X
16523	Backbone 1H, 13C, and 15N Chemical Shift Assignments and heteronuclear NOEs for pfColA	X	X
16536	Structure of the E1064A mutant of the N-domain of Wilson Disease Associated Protein	X	X
16538	15N, 13C and 1H Resonance Assignments of the Middle MA-3 Domain of the Tumour Suppressor Protein Pdcd4	X	X
16539	Solution structure of nasonin-1	X	X
16540	Solution structure of nasonin-1M	X	X
16541	Assignment of the Orphan Nuclear Receptor Nurr1 by NMR	X	X
16542	15N, 13C and 1H Backbone Resonance Assignments for the Complete Tandem MA-3 Region of the Tumour Suppressor Protein Pdcd4	X	X
16549	Solution NMR structure of the Mus81 N-terminal HhH. Northeast Structural Genomics Consortium target MmT1A	X	X
16550	Specific motifs of the V-ATPase a2-subunit isoform interact with catalytic and regulatory domains of ARNO	X	X
16551	Specific motifs of the V-ATPase a2-subunit isoform interact with catalytic and regulatory domains of ARNO	X	X
16555	1H, 15N and 13C assignments of the dimeric C-terminal domain of HIV-1 capsid protein	X	X
16556	Solution NMR structure of Streptomyces coelicolor SCO3027 modelled with Zn+2 bound. Northeast Structural Genomics Consortium Target RR58.	X	X
16557	Solution Structure Of Protein SOS-response transcriptional repressor, LexA From Eubacterium rectale. Northeast Structural Genomics Consortium Target ErR9A	X	X
16558	MAGI-1 PDZ1	X	X
16559	MAGI-1 PDZ1 / E6CT	X	X
16560	Solution NMR Structure of uncharacterized protein from gene locus NE0665 of Nitrosomonas europaea. Northeast Structural Genomics Target NeR103A	X	X
16561	Solution NMR structure of a Bacterial Ig-like (Big_3) domain from Bacillus cereus. Northeast Structural Genomics Consortium target BcR147A.	X	X
16562	SOLUTION NMR STRUCTURE OF DE NOVO DESIGNED ROSSMANN 2x2 FOLD PROTEIN, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET OR16	X	X
16563	Solution NMR structure of Lin0431 protein from Listeria innocua. Northeast Structural Genomics Consortium Target LkR112	X	X
16564	NMR Structure of Agrobacterium tumefaciens protein Atu1219: Northeast Structural Genomics Consortium target AtT14	X	X
16568	Solution Structure of Domain IV from the YbbR family protein of Desulfitobacterium hafniense	X	X
16569	Solution NMR structure of the N-terminal domain of cg2496 protein from Corynebacterium glutamicum. Northeast Structural Genomics Consortium Target CgR26A	X	X
16570	NMR Structure of YbbR family protein Dhaf_0833 (residues 32-118) from Desulfitobacterium hafniense DCB-2: Northeast Structural Genomics Consortium target DhR29B	X	X
16571	NMR assignments of the DNA binding domain of ML4 protein from Mesorhizobium loti	X	X
16572	NMR solution structure of Lamin-B1 protein from Home sapiens: Northeast Structural Genomics Consortium target, HR5546A(438-548)	X	X
16574	HUMAN NEDD4 3RD WW DOMAIN COMPLEX WITH THE HUMAN T-CELL LEUKEMIA VIRUS 1 GAG-PRO POLIPROTEIN DERIVED PEPTIDE SDPQIPPPYVEP	X	X
16575	HUMAN NEDD4 3RD WW DOMAIN COMPLEX WITH EBOLA ZAIRE VIRUS MATRIX PROTEIN VP40 DERIVED PEPTIDE ILPTAPPEYMEA	X	X
16576	Solution Structure Of Protein BH0266 From Bacillus halodurans. Northeast Structural Genomics Consortium Target BhR97a	X	X
16577	Backbone Chemical Shift Assignments of Mouse HOXA13 DNA Binding Domain in Complex with DNA Duplex	X	X	X
16578	Solution NMR structure of the apo form of a ribonuclease H domain of protein DSY1790 from Desulfitobacterium hafniense, Northeast Structural Genomics target DhR1A.	X	X
16579	2J coupling constants in oxidized Flavodoxin from Desulfovibrio vulgaris (Hildenborough)	X	X
16580	2J coupling constants in Ribonuclease T1 from Aspergillus oryzae	X	X
16581	2J coupling constants in human Frataxin C-terminal domain (90-210)	X	X
16582	2J coupling constants in human Ubiquitin	X	X
16583	2J coupling constants in Xylanase from Bacillus agaradhaerens	X	X
16584	2J coupling constants in DFPase from Loligo vulgaris	X	X
16585	Solution structure of SNase140	X	X
16586	Backbone assignment of 3F5 heavy chain antibody fragment in its free form	X	X
16587	Chemical shifts of a native-like folding intermediate of beta2-microglobulin	X	X
16588	NMR Assignment of the C-terminal Domain of yeast Aha-1	X	X
16589	peptide_ptha	X	X
16590	protein x	X	X
16591	1H and 15N chemical shifts for the immune inhibitory receptor LAIR-1 collagen binding domain	X	X
16592	Solution NMR structure of a domain from BT9727_4915 from Bacillus thuringiensis, Northeast Structural Genomics Consortium Target BuR95A	X	X
16593	1H, 15N and 13C chemical shifts for the apo form of F98N-flavodoxin from Anabaena PCC7119	X	X
16594	Solution structure of DnaK suppressor protein from Agrobacterium tumefaciens C58. Northeast Structural Genomics Consortium target AtT12/Ontario Center for Structural Proteomics Target atc0888	X	X
16598	1H, 13C and 15N backbone resonance assignments of cTEM-17m, a TEM-1/PSE-4 class A beta-lactamases chimera	X	X
16599	Backbone resonance assignments of clytin	X	X
16600	Backbone resonance assignments of cgGFP	X	X
16601	kkgf	X	X
16602	1H, 13C and 15N Chemical Shift Assignment Assignment of Human Membrane Protein KCNE3 in LMPC micelles	X	X
16603	Solution Structure of apo-IscU	X	X
16606	SOLUTION STRUCTURE OF THE KI O18/O8 Y87H IMMUNOGLOBULIN LIGHT CHAIN VARIABLE DOMAIN	X	X
16607	SOLUTION STRUCTURE OF THE AL-09 H87Y IMMUNOGLOBULIN LIGHT CHAIN VARIABLE DOMAIN	X	X
16608	NMR Structure of Proinsulin	X	X
16610	Solution structure of the N-terminal domain (residues 1-111) of Brugia malayi asparaginyl-tRNA synthetase	X	X
16611	Phosphorylation of SUMO-interacting motif by CK2 enhances Daxx SUMO binding activity.	X	X
16612	Solid-state NMR structure of the M2 transmembrane peptide of the influenza A virus in DMPC lipid bilayers bound to deuterated amantadine	X	X
16613	SARS Coronavirus-unique domain (SUD): Three-domain molecular architecture in solution and RNA binding	X	X
16615	Backbone assignment of E. coli HU protein	X	X
16617	Solution structure of Avian Thymic Hormone	X	X
16618	NMR structure of the J-domain (residues 2-72) in the Escherichia coli CbpA	X	X
16620	Solution NMR structure of zinc binding N-terminal domain of ubiquitin-protein ligase E3A from Homo Sapience. Northeast Structural Genomics Consortium (NESG) target HR3662A.	X	X
16621	1H, 13C, and 15N chemical shift assignment of KCNE3 in isotropic bicelles	X	X
16622	Bergerac-SH3: frustation induced by stabilizing the folding nucleus	X	X
16624	Solution Structure of an Acyl Carrier Protein Domain from Fungal Type I Polyketide Synthase	X	X
16626	Backbone and stereospecific beta-sidechain assignments of 1H, 13C and 15N for Ubiquitin Unfolded in 8M Urea, pH2.5.	X	X
16627	Backbone and stereospecific beta-sidechain assignments of 1H, 13C and 15N for Protein G Unfolded in 7.4M Urea, pH 2.0.	X	X
16628	Sequence-specific 1H, 13C and 15N resonance assignments of the nucleotide-free wildtype cyclic nucleotide binding domain from a cyclic nucleotide-activated K+ channel	X	X
16630	1H, 13C and 15N NMR assignments of StnII-Y111N, a mutant of the sea anemone actinoporin Sticholysin II	X	X
16632	Kalirin DH1 NMR structure	X	X
16634	Backbone Dynamics and Global Effects of an Activity Enhancing Mutation in Minimized Mtu RecA Inteins	X	X
16636	NMR solution structure of the DNA binding domain of Competence protein A	X	X
16638	Solution Structure of human sodium/ hydrogen exchange regulatory factor 1(150-358).	X	X
16639	Structure of a complex between domain V of beta2-glycoprotein I and the fourth ligand-binding module from LDLR determined with Haddock.	X	X
16641	RDC refined solution structure of the first SH3 domain of CD2AP	X	X
16642	High resolution structure of the second SH3 domain of CD2AP	X	X
16643	RDC refined high resolution structure of the third SH3 domain of CD2AP	X	X
16646	Solution structure of the RBD1,2 domains from human nucleolin	X	X
16647	Solution NMR structure of SH3 domain from CPF_0587 (fragment 415-479) from Clostridium perfringens. Northeast Structural Genomics Consortium (NESG) Target CpR74A.	X	X
16648	Solution NMR Structure of a Conserved Hypothetical Membrane Lipoprotein Obtained from Ureaplasma parvum: Northeast Structural Genomics Consortium Target UuR17A (139-239)	X	X
16652	Solution NMR Structure of asl3597 from Nostoc sp. PCC7120. Northeast Structural Genomics Consortium Target ID Nsr244.	X	X
16656	Solution NMR structure of the Q251Q8_DESHY(21-82) protein from Desulfitobacterium Hafniense. Northeast Structural Genomics Consortium Target DhR8C.	X	X
16657	Assignment and structural characterization of intrinsically disordered CDK inhibitor Sic1 from yeast	X	X
16658	Heterodimeric association of Transmembrane domains of ErbB1 and ErbB2 receptors Enabling Kinase Activation	X	X
16659	Assignment and structural characterization of intrinsically disordered CDK inhibitor phosphoSic1 from yeast	X	X
16660	SOLUTION CONFORMATION OF SUBSTANCE P IN WATER COMPLEXED WITH NK1R	X	X
16661	Pf ACP with Transit Peptide	X	X
16662	Solution NMR structure of apo Sterol Carrier Protein - 2 from Aedes aegypti (AeSCP-2)	X	X
16663	NMR STRUCTURE OF HUMAN INSULIN MUTANT GLY-B8-D-ALA, HIS-B10-2 ASP PRO-B28-LYS, LYS-B29-PRO, 20 STRUCTURES	X	X
16665	Solution NMR structure of Sterol Carrier Protein - 2 from Aedes aegypti (AeSCP-2) complex with C16 fatty acid (palmitate)	X	X
16666	Sequence-specific 1H, 15N and 13C resonance assignments of Sugarcane defensin 5 (Sd5).	X	X
16668	GTPase RhoA-GDP	X	X
16669	GTPase RhoA GTPgS	X	X
16670	NMR structure of the apoptosis- and inflammation-related NALP1 pyrin domain	X	X
16672	NMR structures of TM domain of the n-Acetylcholine receptor b2 subunit	X	X
16673	backbone resonance assignment for the class A beta-lactamase Bacillus licheniformis BS3	X	X
16674	NMR Solution structures of fully reduced cytochrome c3 from Desulfovibrio desulfuricans ATCC 2777	X	X
16675	The NMR structure of protein-glutaminase from Chryseobacterium proteolyticum	X	X
16678	1H, 13C and 15N Chemical Shift Assignments for Sensory Rhodopsin II	X	X
16680	Solution structure of human stem cell transcription factor Nanog	X	X
16681	Solution NMR Structure of the SH3 Domain from the p85beta subunit of Phosphatidylinositol 3-kinase from H.sapiens. Northeast Structural Genomics Consortium Target HR5531E.	X	X
16683	RRM domain of mRNA export adaptor REF2-I bound to HSV-1 ICP27 peptide	X	X
16686	Solution NMR structure of mucin-binding domain of protein lmo0835 from Listeria monocytogenes. Northeast Structural Genomics Consortium Target LmR64A	X	X
16687	1H, 13C and 15N assignments of the dimeric regulatory subunit (ilvN) of E.coli AHAS I	X	X
16688	Solution NMR structure of the CPE1231(468-535) protein from Clostridium perfringens. Northeast Structural Genomics Consortium Target CpR82B.	X	X
16689	Backbone and side chain 1H, 15N and 13C assignments for a thiol-disulphide oxidoreductase from the Antarctic bacterium Pseudoalteromonas haloplanktis TAC125	X	X
16690	Backbone 1H, 13C and 15N chemical shift assignments for the prolyl isomerase Ess1 from Candida albicans	X	X
16691	Solution NMR Structure of Probable 30S Ribosomal Protein PSRP-3 (Ycf65-like protein) from Synechocystis sp. (strain PCC 6803), Northeast Structural Genomics Consortium Target Target SgR46	X	X
16692	Solution NMR structure of a domain of protein A6KY75 from Bacteroides vulgatus, Northeast Structural Genomics target BvR106A	X	X
16696	HSV-1 ICP27 (REF-interation) peptide backbone assignment in free form	X	X
16697	RRM domain of mRNA export adaptor REF2-I backbone assignment	X	X
16698	HVS ORF57 8-120 backbone assignment	X	X
16703	SPI2	X	X
16704	SPI2 (T7Y)	X	X
16705	SPI2 (T7A)	X	X
16708	1H,13C,15N assignments of RNA recognition motifs 1 and 2 of BRUNOL-3	X	X
16710	Backbone and C-beta chemical shifts of Spider Roll, NESG target OR24	X	X
16711	NMR structure of the protein NP_415897.1	X	X
16715	1H, 13C, and 15N Chemical Shift Assignments for human Vaccinia-Related Kinase-1 Lysozyme	X	X
16721	Solution structure of BRD1 PHD1 finger	X	X
16726	Resonance assignment of myristoylated Neuronal Calcium Sensor 1(NCS1) in membrane bound form.	X	X
16727	The solution structure of the monomeric antimicrobial peptide culbertcidin	X	X
16729	NMR assignment of Salmonella typhimurium tip protein SipD	X	X
16731	Solution Structure of a putative disulphide-isomerase from Bacteroides thetaiotaomicron	X	X
16732	NMR structure of the PASTA domain 1 and 2 of Mycobacterium tuberculosis of PknB	X	X
16733	NMR structure of the PASTA domain 2 and 3 of Mycobacterium tuberculosis of PknB	X	X
16734	NMR structure of the PASTA domain 3 and 4 of Mycobacterium tuberculosis of PknB	X	X
16735	NMR resonance assignment of the apo C-terminal polypeptide of the Anthrax Lethal Factor catalytic domain	X	X
16736	NMR STRUCTURE OF P62 PB1 DIMER DETERMINED BASED ON PCS	X	X
16737	1H,13C and 15N chemical shift assignment for NMB1343 apoprotein	X	X
16738	solution structure of human vaccinia related kinase1(VRK1)	X	X
16739	1H, 13C, and 15N Chemical Shift Assignments for plectasin	X	X
16742	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Unfolded Bovine Pancreatic Ribonuclease A	X	X
16743	Three dimensional structure of HuPrP(90-231 M129 Q212P)	X	X
16744	Structure and identification of ADP-ribose recognition motifs of APLF and role in the DNA damage response	X	X
16746	Chemical shift assignment of GmR58A from Geobacter metallireducens. Northeast Structural Genomics Consortium Target GmR58A	X	X
16750	backbone chemical shifts assignments of acid-denatured c-src SH3 with increasing urea concentration	X	X
16751	NMR diffusion and relaxation study of drug-protein interaction	X	X
16752	Mapping the Interacting Regions between Troponins T and C	X	X
16753	NMR Study on the Structural Changes of Cytochrome P450cam upon the Complex Formation with Putidaredoxin	X	X
16754	Physical Interaction between Replication Protein A and Rad51 Promotes Exchange on Single-stranded DNA	X	X
16755	Complement assembly of two fragments of the streptococcal protein G B1 domain in aqueous solution	X	X
16756	Structure of a regulatory complex infolving the Ab1 SH3 domain, the Crk SH2 domain and a Crk-derived phosphopeptide	X	X
16757	Location and properties of metal-binding sites on the human prion protein	X	X
16758	The effect of protein concentration on ion binding	X	X
16759	Mapping of the anion binding sites on cytochrome c by differential chemical modification of lysine residues	X	X
16760	Fibrinopeptide A binds Gly-Pro-Arg-Pro	X	X
16761	Solution structue of the N-domain of Wilson disease protein: Distinct nucleotide-binding environment and effects of disease mutations	X	X
16762	Mapping the Ca2+-dependent binding of an invertebrate homolog of protein phosphatase 4 regulatory subunit 2 of the small EF-hand protein, calsensin	X	X
16763	Identification of a novel ubiquitin binding site of STAM1 VHS domain by NMR spectroscopy	X	X
16764	HALOTHANE BINDS TO DRUGGABLE SITES IN CALCIUM-CALMODULIN: Solution Structure of halothane-CaM N-terminal domain	X	X
16766	Solution Structure of the human BLM HRDC domain	X	X
16767	Human Regenerating Gene Type IV (REG IV) PROTEIN, P91S mutant	X	X
16770	NMR solution structure of a soluble PrgI mutant from Salmonella Typhimurium	X	X
16772	SOLUTION STRUCTURE OF CI-MPR ligand-free domain 5	X	X
16773	SOLUTION STRUCTURE OF CI-MPR domain 5 bound to N-acetylglucosaminyl 6-phosphomethylmannoside	X	X
16774	Solution structure of the Mycobacterium tuberculosis protein Rv0543c, a member of the DUF3349 superfamily. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target MytuD.17112.a	X	X
16775	Mesencephalic astrocyte-derived neurotrophic factor (MANF)	X	X
16776	C-terminal domain of mesencephalic astrocyte-derived neurotrophic factor (MANF)	X	X
16777	nmr chemical shift of hahellin in 8 M urea	X	X
16778	Solution structure of the CBX7 chromodomain in complex with a H3K27me2 peptide	X	X
16779	Backbone 1H, 13C, and 15N Chemical Shift Assignments for LMO2(LIM2)-Ldb1(LID)	X	X
16780	1H, 15N, 13C resonance assignments for CobR	X	X
16781	Backbone chemical shift assignments for the microtubule binding domain of the Dictyostelium discoideum dynein heavy chain	X	X
16782	Solution NMR structure of Photosystem II reaction center Psb28 protein from Synechocystis sp.(strain PCC 6803), Northeast Structural Genomics Consortium Target SgR171	X	X
16783	Smr in bicelles	X	X
16784	solution structure of conotoxin mr3c	X	X
16785	solution structure of cis-4-hydroxyproline contained conotoxin cis-mr3c	X	X
16786	solution structure of 4-hydroxyproline contained cis-conomarphin	X	X
16787	NMR assignments for Thermus thermophilus Rieske protein at pH 5.2 at the reduced state	X	X
16788	Solution structure of NusE:NusG-CTD complex	X	X
16790	Solution NMR structure of uncharacterized protein CV0863 from Chromobacterium violaceum. NESG target CvT3. OCSP target CV0863.	X	X
16791	solution NMR structure of yaiA from Escherichia Eoli. Northeast Structural Genomics Target ER244	X	X
16792	Solution NMR Structure of SAP domain of MKL/myocardin-like protein 1 from H.sapiens, Northeast Structural Genomics Consortium Target Target HR4547E	X	X
16794	NMR Solution Structure of Q7A1E8 protein from Staphylococcus aureus: Northeast Structural Genomics Consortium target: ZR215	X	X
16795	Solution NMR of Putative excisionase from Klebsiella pneumoniae, Northeast Structural Genomics Consortium Target Target KpR49	X	X
16797	Structure of the three-Cys2His2 domain of mouse testis zinc finger protein	X	X
16801	Structure of residues 160-235 of putative peptidoglycan binding protein lmo0835 from Listeria monocytogenes: target LmR64B of the Northeast Structural Genomics Consortium	X	X
16802	Solution structure of N-terminal domain of CcmH from Escherichia.coli	X	X
16803	1H, 13C and 15N backbone and side chain resonance assignment of the human RANTES-E66S mutant in a dimeric form	X	X
16804	NMR assignments for Thermus thermophilus Rieske protein at pH 5.2 in oxidized state	X	X
16805	Solution NMR of the specialized acyl carrier protein (RPA2022) from Rhodopseudomonas palustris, Northeast Structural Genomics Consortium Target RpR324	X	X
16806	Solution NMR Structure of the Slr1183 protein from Synechocystis sp. PCC 6803. Northeast Structural Genomics Consortium Target Target SgR145.	X	X
16807	Solution NMR Structure of the Holo Form of a Ribonuclease H domain from D.hafniense, Northeast Structural Genomics Consortium Target Target DhR1A	X	X
16808	Solution NMR Structure of Cyclin-dependent kinase 2-associated protein 1 (CDK2-associated protein 1; oral cancer suppressor Deleted in oral cancer 1, DOC-1) from H.sapiens, Northeast Structural Genomics Consortium Target Target HR3057H	X	X
16809	Ensemble Structures of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase.	X	X
16810	Solution NMR Structure of the N-terminal domain of protein PG_0361 from P.gingivalis, Northeast Structural Genomics Consortium Target Target PgR37A	X	X
16811	Solution Structure of Bacillus anthracis Sortase A (SrtA) Transpeptidase	X	X
16812	data-driven model of MED1:DNA complex	X	X	X
16813	Solution NMR structure of the parkin Ubl domain in complex with the endophilin-A1 SH3 domain	X	X
16814	Structure of the three-Cys2His2 domain of mouse testis zinc finger protein	X	X
16815	Structure of the three-Cys2His2 domain of mouse testis zinc finger protein	X	X
16816	Solution NMR Structure of SAP domain of MKL/myocardin-like protein 1 from H.sapiens, Northeast Structural Genomics Consortium Target Target HR4547E	X	X
16817	Solution structure of dermcidin-1L, a human antibiotic peptide	X	X
16820	SOLUTION STRUCTURE OF RIBOSOMAL PROTEIN S8E FROM Methanothermobacter thermautotrophicus, NORTHEASTSTRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET TR71D	X	X
16821	SOLUTION NMR STRUCTURE OF TETRATRICOPEPTIDE REPEAT DOMAIN PROTEIN SRU_0103 FROM SALINIBACTER RUBER, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET SRR115C	X	X
16824	Solution Structure of the GTPase Binding Domain of WASP in Complex with EspFU, an EHEC Effector	X	X
16831	Solution structure of C-domain of Lsr2	X	X
16833	Minimal Constraint Solution NMR Structure of Translationally-controlled tumor protein (TCTP) from C.elegans, Northeast Structural Genomics Consortium Target Target WR73	X	X
16834	NMR structure of fully methylated GATC site	X		X
16835	The NMR structure of the autophagy-related protein Atg8	X	X
16838	Backbone 1H, 13C, and 15N chemical shift assignments of the extracellular domain of tissue factor	X	X
16841	Chemical Shift Assignments of Fibronectin 6FnI1-2FnII7FnI	X	X
16842	1H and 15N resonance assignments for fully reduced triheme cytochrome PpcA from Geobacter sulfurreducens	X	X
16845	Cementoin backbone chemical assignment and spin relaxation	X	X
16847	Assignments for LC8 bound to a peptide corresponding to residues 233-249 of neuronal Nitric Oxide Synthase	X	X
16848	Solution structure of a novel Ubiquitin-binding domain from Human PLAA (PFUC, Gly76-Pro77 cis isomer).	X	X
16849	NMR Structure of Ni Substitued Desulfovibrio vulgaris Rubredoxin	X	X
16851	The structure of E-protein activation domain 1 bound to the KIX domain of CBP/p300 elucidates leukemia induction by E2A-PBX1	X	X
16853	NMR structure of the transmembrane and cytoplasmic domains of human CD4	X	X
16854	an eye lens fragment from human alpha-crystallin	X	X
16856	Solution Structure of acyl carrier protein from Borrelia burgdorferi, Seattle Structural Genomics Center for Infectious Disease (SSGCID) consortium	X	X
16857	Human Jagged-1, exon 6	X	X
16860	Solution NMR structure of holo acyl carrier protein from Geobacter metallireducens refined with NH RDCs. Northeast Structural Genomics Consortium Target GmR141.	X	X
16862	Chemical shift assignments of CaBP1 with 3 Ca2+ bound	X	X
16863	1H, 13C and 15N backbone and side chain resonance assignments of the N-terminal domain of the histidine kinase inhibitor KipI from Bacillus subtilis	X	X
16864	Sequence Specific 1H, 13C and 15N backbone resonance assignments of uvi31+ from Chlamydomonas reinhardtii	X	X
16868	Solution structure of the aminoterminal domain of E. coli NusA	X	X
16870	1H, 13C, and 15N resonance assignments of the N-terminal domain of human Tubulin Cofactor C	X	X
16871	Solution structure of the second PDZ domain from human zonula occludens-1: A dimeric form with 3D domain swapping	X	X
16876	1HN, 1HA, 13CA, 13CB, 13CO and 15N Chemical Shift Assignments for Intrinsically Disordered Dehydrin ERD14	X	X
16879	Chemical shift assignments of the 3rd PDZ domain of protein tyrosine phosphatase basophil like (PTP-BL)	X	X
16880	Solution Structure of UBM2 of murine Polymerase iota in Complex with Ubiquitin	X	X
16881	Solution NMR structure of of Streptomyces coelicolor polyketide cyclase SCO5315: Northeast Structural Genomics Consortium target RR365	X	X
16882	Solution Structure of the Ubiquitin-Binding Motif of Human Polymerase Iota	X	X
16883	the N-terminal domain of human H-REV107	X	X
16884	1H, 13C and 15N Chemical Shift assignments for RRM3 of Brunol-3.	X	X
16885	Solution Structure of UBM1 of murine Polymerase iota in Complex with Ubiquitin	X	X
16886	NS2 [27-59]	X	X
16891	Backbone 1H, 13C and 15N Chemical Shift Assignments for the free alpha chain of human haemoglobin	X	X
16892	NS2 [60-99]	X	X
16893	MDM4 binds ligands via an induced fit mechanism in which disordered regions become structured	X	X
16894	MDM4 binds ligands via an induced fit mechanism in which disordered regions become structured	X	X
16895	The solution structure of UBB+1, frameshift mutant of ubiquitin B	X	X
16897	The solution structure of MTH1821	X	X
16898	Backbone 1H, 13C and 15N Chemical Shift Assignments for the alpha chain of human haemoglobin bound to alpha-haemoglobin stabilizing protein (AHSP)	X	X
16899	The solution structure of the mutant of UBL domain of UBLCP1, I5M.	X	X
16900	MDM4 binds ligands via an induced fit mechanism in which disordered regions become structured	X	X
16901	Solution structure of the relaxin-like factor	X	X
16904	Backbone assignment of human alpha-synuclein in viscous 2 M glucose solution	X	X
16905	Sma0114	X	X
16907	The hemagglutinin fusion peptide (H1 subtype) at pH 7.4	X	X
16908	The high resolution structure of Ubiquitin like domain of UBLCP1	X	X
16910	Assignment of HN,HA,HB,N,CA,CB and C' of the STAS domain of motor protein Prestin (Anion Transporter SLC26A5)	X	X
16911	Chemical Shift Assignments from PfEMP1: Structured Core	X	X
16915	Human Insulin Mutant A22Gly-B31Lys-B32Arg	X	X
16916	Backbone 1H,13C, and 15N assignments of Streptococcus pneumoniae mevalonate diphosphate decarboxylase (spMDD) in complex with mevalonate 5-diphosphate (DPM) and AMPPCP	X	X
16919	Backbone 1H,13C, and 15N assignments of Streptococcus pneumoniae mevalonate diphosphate decarboxylase (spMDD) in apo-state	X	X
16921	1H, 13C, 15N chemical shifts for the bacterial cell division regulator MinE.	X	X
16926	NMR Structure of Escherichia coli BamE, a Lipoprotein Component of the beta-Barrel Assembly Machinery Complex	X	X
16928	1H, 13C and 15N chemical shift assignment of the N-terminal domain of the voltage-gated potassium channel-hERG	X	X
16929	NMR structure and calcium-binding properties of the tellurite resistance protein TerD from Klebsiella pneumoniae	X	X
16930	Chemical shift assignments of the Talin F2 domain (residues 196-309)	X	X
16932	Chemical shift assignments of the Talin F2F3 domain (residues 196-405)	X	X
16934	Solution NMR structure of the PBS linker domain of phycobilisome linker polypeptide from Anabaena sp. Northeast Structural Genomics Consortium Target NsR123E	X	X
16935	Solution structure of the PECAM-1 cytoplasmic tail with DPC	X	X
16942	Solution NMR Structure () from B.subtilis, Northeast Structural Genomics Consortium Target Target SR518	X	X
16944	Chemical shift assignment of CpR82G from Clostridium perfringens. North East Structural Genomics Consortium Target CpR82g.	X	X
16945	solution structure of Ca-free chicken parvalbumin 3 (CPV3)	X	X
16946	15N, 13C and 1H Resonance Assignments of the PAS domain of hERG (KV11.1)	X	X
16948	Resonance assignments of GTPase effector domain of Dynamin in the aprotic solvent deuterated Dimethyl Sulfoxide	X	X
16949	PDZ3 of ZO-1	X	X
16954	Structure of the AML1-ETO Nervy Domain - PKA(RIIa) complex and its contribution to AML1-ETO activity	X	X
16955	solution structure of calcium-bound CPV3	X	X
16957	Solution structure of the voltage-sensing domain of KvAP	X	X
16959	Chemical shift assignments of the Talin F1F2 double domain (residues 86-303 (delta D139-D168))	X	X
16961	Solution NMR structure of Dsy0195(21-82) protein from Desulfitobacterium Hafniense. Northeast Structural Genomics Consortium Target DhR8C.	X	X
16962	1J and 2J coupling constants in human oxidized ERp18	X	X
16963	Structure of the scorpion toxin U1-Liotoxin-Lw1a	X	X
16964	Solid-state NMR assignment of the globular domain of HET-s(1-227) prion protein in microcrystalline form.	X	X
16965	Backbone NMR assignment of the globular domain of HET-s(1-227) prion protein.	X	X
16967	Solution structure of MAST2-PDZ complexed with the C-terminus of PTEN	X	X
16968	The Solution Structure of a Conformationally Restricted Fully Active Derivative of the Human Relaxin-like Factor (RLF)	X	X
16970	Solution structure of the Bem1p SH3-CI domain from L.elongisporus in complex with Ste20p peptide	X	X
16971	backbone and sidechain 1H, 13C, and 15N assignments for F-plasmid TraI 381-569	X	X
16977	Resonance assignment of nsp7a from arterivirus	X	X
16978	1H, 15N, 13C chemical shifts and structure of CKR-brazzein	X	X
16979	Solution structure of Enzyme IIB subunit of PTS system from Escherichia coli K12. Northeast Structural Genomics Consortium target ER315/Ontario Center for Structural Proteomics target ec0544	X	X
16980	RDC and RCSA refinement of an A-form RNA: Improvements in Major Groove Width	X			X
16981	NMR Structure of the SARS Coronavirus Nonstructural Protein Nsp7 in Solution at pH 6.5	X	X
16982	Backbone assignment of the D-allose binding protein from Escherichia coli in the apo form	X	X
16983	The solution structure of the PHD3 finger of MLL	X	X
16984	Backbone assignments of D-allose binding protein from Escherichia coli in the complex form with D-allose	X	X
16988	Solution NMR Structure of a domain of adhesion exoprotein from Pediococcus pentosaceus, Northeast Structural Genomics Consortium Target PtR41O	X	X
16989	Solution structure of the RRM domain of CYP33	X	X
16991	Solution NMR Structure of the N-terminal Domain of Putative ATP-dependent DNA Helicase RecG-related Protein from Nitrosomonas europaea, Northeast Structural Genomics Consortium Target NeR70A	X	X
16992	1H,13C,15N backbone and sidechain assignment of human Raf kinase inhibitor protein from Escherichia coli	X	X
16994	Calmodulin, C-terminal domain, F92E mutant	X	X
16995	Solution structure of a bolA protein (ECH_0303) from Ehrlichia chaffeensis, the causative agent of human monocytic ehrlichiosis. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target EhchA.10365.a	X	X
16996	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human Rad51D from 1 to 83	X	X
16997	Solution structure of protein SF1141 from Shigella flexneri 2a. Northeast Structural Genomics Consortium (NESG) TARGET SFT2.	X	X
16998	Solution NMR Structure of Transcription factor NF-E2 subunit's DNA binding domain from Homo sapiens, Northeast Structural Genomics Consortium	X	X
16999	Solution structure of protein CV0426 from Chromobacterium violaceum. NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET CVT2.	X	X
17000	Structure of E1-69 of Yeast V-ATPase	X	X
17002	Solution NMR structure of the protein YP_510488.1	X	X
17003	Vpr(1-20) Vpr(21-40) Vpr(25-40)	X	X
17005	Three-dimensional structure of a truncated phosphoribosylanthranilate isomerase (residues 255-384) from Escherichia coli	X	X
17006	Solution structure of alpha-mannosidase binding domain of Atg19	X	X
17007	Solution structure of alpha-mannosidase binding domain of Atg34	X	X
17008	Solution NMR Structure of Peptide methionine sulfoxide reductase msrB from Bacillus subtilis, Northeast Structural Genomics Consortium Target SR10	X	X
17009	Sequence specific backbone assignment of the C-terminal domain of MqsA	X	X
17010	Backbone Amide relaxation parameters for wild-type Tryptophan Repressor	X	X
17011	s34r structure	X	X
17012	Backbone Amide relaxation parameters for mutant L75F Tryptophan Repressor	X	X
17013	Backbone Amide relaxation parameters for mutant A77V Tryptophan Repressor	X	X
17014	Backbone 1H,13C and 15N assignments of ChxR	X	X
17017	Solution NMR Structure of (Ubiquitin thioesterase OTU1 EC3.1.2.-) from Mus musculus, Northeast Structural Genomics Consortium Target MmT2A	X	X
17018	DAXX helical bundle (DHB) domain	X	X
17019	DAXX helical bundle (DHB) domain / Rassf1C complex	X	X
17020	Solution NMR structure of CV_0373(175-257) protein from Chromobacterium violaceum, Northeast Structural Genomics Consortium Target CvR118A	X	X
17021	Solution NMR Structure of Q8PSA4 from Methanosarcina mazei, Northeast Structural Genomics Consortium Target MaR143A	X	X
17022	Solution NMR Structure of A3DHT5 from Clostridium thermocellum, Northeast Structural Genomics Consortium Target CmR116	X	X
17023	Solution NMR structure of the ZNF216 A20 zinc finger	X	X
17024	Solution structure of the non-covalent complex of the ZNF216 A20 domain with ubiquitin	X	X
17025	Solution NMR Structure of protein BVU3908 from Bacteroides vulgatus, Northeast Structural Genomics Consortium Target BvR153	X	X
17026	Solution NMR Structure of protein BT2368 from Bacteroides thetaiotaomicron, Northeast Structural Genomics Consortium Target BtR375	X	X
17028	The Solution Structure of the C-terminal Ig-like Domain of the Bacteriophage Lambda Tail Tube Protein	X	X
17030	Solution NMR Structure of the Ras-binding domain of Serine/threonine-protein kinase B-raf from Homo sapiens, Northeast Structural Genomics Consortium Target HR4694F	X	X
17031	Solution NMR structure of the PBS linker polypeptide domain of phycobilisome linker protein apcE from Synechocystis sp. Northeast Structural Genomics Consortium Target SgR209C	X	X
17032	1H, 13C, and 15N chemical shifts and structure of brazzein-derived peptide CKR-PNG	X	X
17033	Solution NMR Structure of Nonsense mRNA reducing factor 3A from H. Sapiens, Northeast Structural Genomics Consortium Target HR4714B	X	X
17035	NMR Solution Structure of asr4154 from Nostoc sp. PCC7120 Northeast Structural Genomics Consortium target ID Nsr143	X	X
17036	SOLUTION STRUCTURE OF ZINC FINGER DOMAIN OF E3 UBIQUITIN-PROTEIN LIGASE PROTEIN Praja-1 FROM HOMO SAPIENS, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET HR4710B	X	X
17038	Solution NMR Structure of protein STY4237 (residues 36-120) from Salmonella enterica, Northeast Structural Genomics Consortium Target SlR115	X	X
17039	Solution NMR Structure of putative cell surface protein MA_4588 (272-376 domain) from Methanosarcina acetivorans, Northeast Structural Genomics Consortium Target MvR254A	X	X
17040	STRUCTURAL AND FUNCTIONAL ANALYSIS OF TM VI OF THE NHE1 ISOFORM OF THE Na+/H+ EXCHANGER	X	X
17041	Backbone dynamics of Tryptophan repressor protein in holo-form	X	X
17042	Backbone 1H, 15N, and 13C resonance assignment of rat-nNOS fragment (residues 134-298)	X	X
17043	TMS2 domain of Dengue virus NS4A protein	X	X
17044	Solution structure of Rtt103 CTD-interacting domain bound to a Ser2 phosphorylated CTD peptide	X	X
17045	KSR1 CA1 domain	X	X
17046	Backbone dynamics of Tryptophan repressor L75F mutant protein in holo-form	X	X
17047	Backbone dynamics of Tryptophan repressor A77V mutant protein in holo-form	X	X
17048	AP180 aa 623-680 Backbone Assignment	X	X
17052	Nuclear Magnetic Resonane Structural and Ligand Binding Studies of BLBC, a Two-Domain Fragment of Barley Lectin	X	X
17053	A NMR-based docking model for the physiological transient complex between cytochrome f and cytochrome c6	X	X
17054	Determination of the modified 'affinity index' of small ligands and macromolecular receptors from NMR spin-lattice relaxation data	X	X
17055	Binding Site Structure of One LRP-RAP Complex Implications for a Common Ligand-Receptor Binding Motif	X	X
17056	Four-alpha-Helix Bundle with Designed Anesthetic Binding Pockets. Part II: Halothane Effects on Structure and Dynamics	X	X
17057	Interaction of fatty acid with myoglobin	X	X
17058	The structure of Ce(III)-Angiotensin II complex as obtained from NMR data and molecular dynamics calculations	X	X
17059	Identification of a novel ubiquitin binding site of STAM1 VHS domain by NMR spectroscopy	X	X
17060	Replication protein A 32 interacts through a similar binding interface with TIPIN, XPA, and UNG2	X	X
17061	The Effects of CapZ Peptide (TRTK-12) Binding to S100B-Ca2+ as Examined by NMR and X-ray Crystallography	X	X
17064	13C, and 15N Chemical Shift Assignments for Anabaena sensory rhodopsin 1-229	X	X
17065	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Binary Tandem Ubiquitin Binding Domains of Signal Transducing Adapter Molecule 1	X	X
17069	Backbone dynamics of E73 from SSV-RH	X	X
17070	SOLUTION STRUCTURE OF THE R6 DOMAIN OF TALIN	X	X
17071	Solution NMR structure of the Cbx3 in complex with H3K9me3 peptide	X	X
17072	Solution NMR structure of the chromobox protein 7 with H3K9me3	X	X
17073	Structure of CBP nuclear coactivator binding domain in complex with p53 TAD	X	X
17074	An arsenate reductase	X	X
17075	Chemical shift assignments for Bacillus subtilis TatAd protein, the channel-forming component of the Tat protein transport system	X	X
17076	An arsenate reductase	X	X
17077	An arsenate reductase	X	X
17078	1H, 15N chemical shift assignments of the imino groups in the base pairs of Escherichia coli tRNALeu (CAG)	X			X
17079	Solution NMR structure ov the chromobox protein Cbx7 with H3K27me3	X	X
17080	Shc-PTB:biphosphorylated integrin beta3 cytoplasmic tail complex (1:1)	X	X
17081	Mouse Prion Protein (121-231) with mutation Y169G	X	X
17082	Mouse Prion Protein (121-231) with mutation F175A	X	X
17084	NMR structure of mouse PrP fragment 121-231 at 20 C.	X	X
17087	Mouse prion protein (121-231) with the mutations Y169A, Y225A, and Y226A.	X	X
17088	Solution structure of the pseudouridine modified P6.1 hairpin of human telomerase RNA	X			X
17089	SH3-F2	X	X
17090	Solution NMR structure of the protein YP_399305.1	X	X
17091	Zinc to cadmium replacement in the A. thaliana SUPERMAN Cys2His2 zinc finger induces structural rearrangements of typical DNA base determinant positions	X	X
17092	NMR solution structure of the N-terminal domain of DNA-binding protein SATB1 from Homo sapiens: Northeast Structural Genomics Target HR4435B(179-250)	X	X
17093	Structure and dynamics of a molten globular enzyme	X	X
17094	NMR and molecular modeling studies of the interaction of berenil and pentamidine with d(CGCAAATTTGCG)2	X		X
17095	Identification by NMR of the Binding Surface for the Histidine-Containing Phosphocarrier Protein HPr on the N-Terminal Domain of Enzyme of the Escherichia coli Phophotransferase System	X	X
17096	Stopped-flow NMR spectroscopy: Real-Time unfolding studies of 6-19F-tryptophan-labeled Escherichia coli dihydrofolate reductase	X	X
17097	Electrochemical and NMR spectroscopic studies of distal pocket mutants of nitrophorin 2: Stablility, structure, and dynamics of axial ligand complexes	X	X
17098	Cofactor fingerprinting with STD NMR to characterize proteins of unknown function: identification of a rare cCMP cofactor preference	X	X
17099	1H NMR Studies of the Binding of EDTA to Bovine Pancreatic Ribonuclease	X	X
17100	Backbone Dynamics of the C-terminal SH2 Domain of the p85alpha Subunit of Phosphoinositide 3-kinase: Effect of Phosphotyrosine-Peptide Binding and Characterization of Slow Conformational Exchange Processes	X	X
17101	1H NMR study of the interaction of N,N',N''-triacetyl chitotriose with Ac-AMP2, a sugar binding antimicrobial protein isolated from Amaranthus caudatus	X	X
17102	NMR measurement of the off rate from the first calcium-binding site of the synaptotagmin I C2A domain	X	X
17104	YP_001336205.1	X	X
17105	Solution Structure of the N-terminal Domain of NP_954075.1	X	X
17107	NMR STRUCTURE OF HUMAN INSULIN MUTANT GLY-B20-D-ALA, GLY-B23 2 PRO-B28-LYS, LYS-B29-PRO, 20 STRUCTURES	X	X
17108	NMR STRUCTURE OF HUMAN INSULIN MUTANT ILE-A2-LEU, VAL-A3-LEU 2 HIS-B10-ASP, PRO-B28-LYS, LYS-B29-PRO, 20 STRUCTURES	X	X
17109	The Structure of the Family D Sortase from Bacillus anthracis	X	X
17112	1H, 13C and 15N NMR Assignments of the C1B Subdomains of PKC-delta.	X	X
17113	1H, 13C and 15N NMR Assignments of the C1A Subdomains of PKC-delta.	X	X
17114	Binding Kinetics of Histone Chaperone Chz1 and Variant Histone H2A.Z-H2B by Relaxation Dispersion NMR Spectroscopy	X	X
17115	Effects of Domain Dissection on the Folding and Stability of the 43 kDa Protein PGK Probed by NMR	X	X
17116	1H NMR studies of pyridine binding to metmyoglobin	X	X
17118	Conformation of Pseudoazurin in the 152 kDa Electron Transfer Complex with Nitrite Reductase Determined by Paramagnetic NMR	X	X
17119	Defining the Intramembrane Binding Mechanism of Sarcolipin to Calcium ATPase USing Solution NMR Spectroscopy	X	X
17120	Binding of 1-methylimidazole to cytochrome c: kinetic analysis and resonance assignments by two-dimensional NMR	X	X
17121	Folding Kinetics of the SH3 Domain of PI3 Kinase by Real-time NMR Combined with Optical Spectroscopy	X	X
17122	Solution-state NMR Investigations of Triosephosphate Isomerase Active Site Loop Motion: Ligand Release in Relation to Active Site Loop Dynamics	X	X
17123	Comparison of the Structural and Dynamical Properties of Holo and Apo Bovine alpha-Lactalbumin by NMR Spectroscopy	X	X
17124	NP_888769.1	X	X
17126	NMR assigment of Heparanase construct Hep158-417	X	X
17131	NMR resonance assignment of the N-terminal domain of Latrodectus hesperus (black widow) major ampullate spider silk fibroin 1	X	X
17132	Solution Structure of human UBA-like domain of OTUD7A_11_83, NESG target HT6304a/OCSP target OTUD7A_11_83/SGC-Toronto	X	X
17133	Chemical shift assignments for the RanBP2-type ZnF from Ewing's Sarcoma (EWS)	X	X
17135	Mature Drosophila Frataxin Homolog (Dfh)	X	X
17138	Solution structure of the coiled-coil complex between MBD2 and p66alpha	X	X
17144	1H, 13C, and 15N backbone, side-chain, and heme chemical shift assignments for the oxidized form of the monoheme c-type cytochrome ApcA isolated from the acidophilic metal-reducing bacterium Acidiphilium cryptum	X	X
17145	Chemical Shifts of the R24H Pitx2 Homeodomain Mutant	X	X
17146	1H, 13C, and 15N backbone, side-chain, and heme chemical shift assignments for the reduced form of the monoheme c-type cytochrome ApcA isolated from the acidophilic metal-reducing bacterium Acidiphilium cryptum	X	X
17147	Chemical Shifts of the Pitx2 Homeodomain	X	X
17148	N-terminal domain of Nephila clavipes major ampulate spidroin 1	X	X
17149	Folding Intermediate of the Fyn SH3 A39V/N53P/V55L from NMR Relaxation Dispersion Experiments	X	X
17150	Solution Structure of cellobiose-specific phosphotransferase IIB component protein from Borrelia burgdorferi. Seattle Structure Genomics Center for Infectious Disease (SSGCID).	X	X
17153	Thiostrepton	X	X
17154	Thiostrepton (oxidized 9:CA-CB)	X	X
17155	Thiostrepton (epimer 9:CA)	X	X
17156	Thiostrepton (reduced 14:N-CA)	X	X
17160	1H, 13C, 15N resonance assignment of the chitin-binding protein CBP21 from Serratia marcescens	X	X
17162	Backbone 1H, 13C, and 15N Chemical Shift Assignments for a photochromic fluorescent protein Dronpa in the bright state	X	X
17163	Backbone 1H, 13C, and 15N Chemical Shift Assignments for a photochromic fluorescent protein Dronpa in the dark state	X	X
17169	Solution NMR Structure of DRBM 2 domain of Interleukin enhancer-binding factor 3 from homo sapiens, Northeast Structural Genomics Consortium Target HR4527E	X	X
17170	Resonance assignments of the Myb2 DNA binding domain in complex with its promoter MRE-1 from Trichomonas vaginalis	X	X
17171	The chemical shift assignment of the SWIRM domain of LSD1	X	X
17172	Bovine Pancreatic Ribonuclease A C-dimer	X	X
17173	1H, 13C, and 15N chemical shift assignments of the Nrd1-CTD Interacting Domain	X	X
17174	MOUSE PRION PROTEIN FRAGMENT 121-231 AT 37 C	X	X
17175	Solution NMR structure of hepothetical homodimer protein SP_0782 (7-79) from Streptococcus pneumoniae, Northeast Structural Genomics Consortium Target SpR104.	X	X
17176	Solution NMR structure of the BT_0084 lipoprotein from Bacteroides thetaiotaomicron, Northeast Structural Genomics Consortium Target BtR376.	X	X
17177	Partial backbone 1H,15N chemical shift of arrestin-1	X	X
17178	NMR relaxation studies of GdDTPA in human serum albumin solution	X	X
17179	NMR Studies of the Backbone Flexibility and Structure of Human Growth Hormone: A Comparison of High and Low pH Conformations	X	X
17180	The influence of dietary habits and pathological conditions on the binding of theophylline to serum albumin	X	X
17181	NMR Snapshots of a Fluctuating Protein Structure: Ubiquitin at 30bar-3kbar	X	X
17182	Weak Substrate Binding to Transport Proteins Studied by NMR	X	X
17183	Solid-state 31P NMR Spectroscopy of Microcrystals of the Ras Protein and its Effector Loop Mutants: Comparison Between Crystalline and Solution State	X	X
17184	Lactose Binding to Galectin-1 Modulates Structural Dynamics, Increases Conformational Entropy, and Occurs with Apparent Negative Cooperativity	X	X
17185	Determination of the Binding Specificity of the Integral Membrane Protein by Saturation Transfer Difference NMR: RGD Peptide Ligands Binding to Integrin alphaIIbBeta3	X	X
17186	NMR Reveals Anomalous Copper(II) Binding to the Amyloid ABeta Peptide of Alzheimer's Disease	X	X
17187	Elucidation of the poly-L-proline binding site in Acanthamoeba profilin I by NMR spectroscopy	X	X
17188	Solution structure of P2a-J2a/b-P2b of human telomerase RNA	X			X
17189	Pfu Rpp30 Free	X	X
17190	Complex Pfu Rpp30	X	X
17191	Solution NMR Structure of a putative Uracil DNA glycosylase from Methanosarcina acetivorans, Northeast Structural Genomics Consortium Target MvR76	X	X
17192	Solution NMR Structure of CH domain of Rho guanine nucleotide exchange factor 7 from Homo sapiens, Northeast Structural Genomics Consortium Target HR4495E	X	X
17195	Backbone assignments for the UBA Domain of E2-25K	X	X
17196	Solution structure of the putative copper-ion-binding protein from Bacillus anthracis str. Ames	X	X
17199	Solution structure of Rap1-Taz1 fusion protein	X	X
17200	NMR structure of UHRF1 Tandem Tudor Domains in a complex with Histone H3 peptide	X	X
17203	NMR structure of Acyl carrier protein from Brucella melitensis. Seattle Structure Genomics Center for Infectious Disease (SSGCID)	X	X
17204	the 1H, 13C and 15N resonance assignment of ubiquitin-like small archaeal modifier protein from Haloferax volcanii	X	X
17206	villin head piece domain of human ABLIM2	X	X
17207	Solution NMR Structure of the PBS linker domain of phycobilisome rod linker polypeptide from Synechococcus elongatus, Northeast Structural Genomics Consortium Target SnR168A	X	X
17208	Backbone 1H, 13C, and 15N chemical shift assignments for the nucleotide-binding domain of E.coli DnaK in the ADP.Pi-bound state	X	X
17209	Backbone 1H, 13C, and 15N chemical shift assignments for the nucleotide-binding domain of E.coli DnaK in the nucleotide-free state	X	X
17210	Backbone 1H, 13C, and 15N Chemical Shift Backbone 1H, 13C, and 15N chemical shift assignments for the nucleotide-binding domain of E.coli DnaK in the ATP-bound state	X	X
17213	Mouse prion protein (121-231) with the mutation Y169A	X	X
17215	13C NMR Spectroscopic and X-ray Crystallographic Study of the Role Played by Mitochondrial Cytochrome b5 Heme Propionates in the Electrostatic Binding to Cytochrome c	X	X
17216	How the HIV-1 Nucleocapsid Protein Binds and Destabilises the (-)Primer Binding Site During Reverse Transcription	X	X	X
17217	Solution Structure of the C-terminal Dimerization Domain of SARS Coronavirus Nucleocapsid Protein Solved by the SAIL-NMR Method	X	X	X
17218	Enzyme Dynamics During Catalysis	X	X
17219	Structural Insights into the Monosaccharide Specificity of Escherichia coli Rhamnose Mutarotase	X	X
17220	Energetics by NMR: Site-specific binding in a positively cooperative system	X	X
17221	Basic Requirements for a Metal-Binding Site in a Protein: The Influence of Loop Shortening on the Cupredoxin Azurin	X	X
17222	lac repressor-lac operator interaction: NMR observations	X	X	X
17223	Measurement of bond vector orientations in invisible excited states of proteins	X	X
17224	TROSY-NMR reveals interaction between ERp57 and the tip of the calreticulin P-domain	X	X
17225	The Solution Structure and DNA-binding Properties of the Cold-shock Domain of the Human Y-box Protein YB-1	X	X	X
17226	1H, 15N, and 13C chemical shift assignments, and 15N dynamics for trHbN-cyanomet from M. tuberculosis	X	X
17227	SOLUTION STRUCTURE OF GS-alfa-Ktx5.4 SYNTHETIC SCORPION LIKE	X	X
17231	Resonance assignments of ArsD	X	X
17232	Solution structure of the PlyG catalytic domain	X	X
17233	Solution structure of the PlyG cell wall binding domain	X	X
17234	NMR structure of the DNA-binding domain of E.coli Lrp	X	X
17235	Solution structure of a putative acyl carrier protein from Anaplasma phagocytophilum. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target AnphA.01018.a	X	X
17240	INFLUENZA HEMEGGLUTININ FUSION PEPTIDE MUTANT G13A	X	X
17241	YAP WW2	X	X
17243	The Solution Structure of Human Cardiac Troponin C in complex with the Green Tea Polyphenol; (-)-epigallocatechin-3-gallate	X	X
17244	Structural basis for histone code recognition by BRPF2-PHD1 finger	X	X
17245	Solution Structure of the Chemokine CCL21	X	X
17249	1H, 13C and 15N resonances of the AlgE62 subunit from Azotobacter vinelandii mannuronan C5-epimerase	X	X
17250	GNA1946	X	X
17251	the N-terminal domain of SARS-CoV main protease	X	X
17256	Solution structure of Ste5PM24 in the presence of SDS micelle	X	X
17258	Resonance assignments and secondary structure of a phytocystatin from Ananas comosus	X	X
17260	Backbone and side-chain 1H, 13C and 15N assignments of the UCHL1 S18Y variant	X	X
17263	Solution structure of the small archaeal modifier protein 1 (SAMP1) from Methanosarcina acetivorans.	X	X
17265	NMR structure of fusion of CtIP (641-685) to LMO4-LIM1 (18-82)	X	X
17267	Solution Structure of an Uncharacterized Thioredoin-like Protein from Clostridium perfringens	X	X
17268	Solution Structures of Oxidized and Reduced Thioredoxin C from M. tb	X	X
17270	Complex between BD1 of Brd3 and GATA-1 C-tail	X	X
17275	Solution Structure of Thioredoxin from Bacteroides Vulgatus	X	X
17276	Unbound TbRI-ED	X	X
17277	Solution Structure of a Putative Thioredoxin from Neisseria meningitidis	X	X
17278	NMR assignment of actin depolymerizing and dynamics regulatory protein from toxoplasma gondii	X	X
17279	Solution NMR structure of protein lipocalin 12 from rat epididymis	X	X
17280	Solution NMR Structure of BVU_3817 from , Northeast Structural Genomics Consortium Target BvR159	X	X
17281	Conformational and membrane interactins studies of antimicrobial peptide Alyteserin-1C	X	X
17282	Solution Structure of apo-IscU(WT)	X	X
17284	Solution NMR structure of E2 lipoyl domain from Thermoplasma acidophilum	X	X
17285	Structure of the first PHD finger (PHD1) from CHD4 (Mi2b).	X	X
17286	Solution structure of the C-terminal domain of hRpn13	X	X
17288	1H, 13C, and 15N backbone and side-chain chemical shift assignment of the staphylococcal toxin MazF	X	X
17289	NMR structure of calcium-loaded STIM2 EF-SAM.	X	X
17290	Backbone and side chain assignments for the intrinsically disordered cytoplasmic domain of human neuroligin-3	X	X
17292	NMR structure of the A730 loop of the Neurospora VS ribozyme	X			X
17293	Solution structure of human J-protein co-chaperone Dph4	X	X
17296	NMR solution structure of GLP-2 in 2,2,2 trifluroethanol	X	X
17297	NMR Solution structure of GLP-2 in DHPC micelles	X	X
17298	Resonance assignments of protein SSO1118 from hyperthermophilic archaeon Sulfolobus solfataricus P2	X	X
17301	NMR Structure of an Archaeal DNA Binding Protein Sso7c4	X	X
17302	1H and 15N RESONANCE ASSIGNMENT OF HUMAN APO L-FABP	X	X
17303	1H and 15N RESONANCE ASSIGNMENT OF HUMAN HOLO L-FABP	X	X
17304	Solution NMR Structure of de novo designed rossmann 2x3 fold protein, Northeast Structural Genomics Consortium Target OR28	X	X
17305	Three-dimensional structure of the N-terminal effector PYRIN domain of NLRP12	X	X
17306	NRC consensus ankyrin repeat protein backbone and sidechain assignments	X	X
17307	NMR Structure of the monomeric mutant C-terminal domain of HIV-1 Capsid in complex with stapled peptide Inhibitor	X	X
17312	Tah1 complexed by MEEVD	X	X
17314	Solution Structure of a Nonphosphorylated Peptide Recognizing Domain	X	X
17315	Structure of C-terminal dsRBD of the Fission Yeast DICER (Dcr1)	X	X
17316	Specifier domain and GA motif region of B. subtilis tyrS T box leader RNA	X			X
17318	NMR solution structure of the protein YP_001092504.1	X	X
17319	NMR solution structure of the protein NP_253742.1	X	X
17320	NMR structure of the protein YP_926445.1 from Shewanella Amazonensis	X	X
17321	New high resolution NMR structure of gpW (W protein of bacteriophage lambda) at neutral pH	X	X
17323	Solution NMR Structure of Med25(391-543) Comprising the Activator-Interacting Domain (ACID) of Human Mediator Subuniti 25. Northeast Structural Genomics Consortium Target HR6188A	X	X
17324	NMR Solution Structure of the winged-helix domain from MUS81 junction-specific endonuclease	X	X
17325	1H, 13C and 15N resonance assignment of the 117 residue fragment of Engrailed 2, a partially disordered protein.	X	X
17326	Shin-Dalgarno sequence of the hcnA gene of Pseudomonas fluourescens	X			X
17328	magnesium bound CIB1	X	X
17329	The Solution Structure of Calcium Bound CIB1	X	X
17330	NMR solution structure of GIP in micellular media	X	X
17331	NMR solution structure of GIP in Bicellular media	X	X
17332	Solution Structure of the talin Vbs2b domain	X	X
17333	Deubiquitinating function of ataxin-3: Insights from the solution structure of the Josephin domain	X	X
17334	EGF-like Domain Calcium Affinity Modulated by N-terminal Domain Linkage in Human Fibrillin-1	X	X
17338	EGF-like Module Pair 3-4 in Vitamin K-dependent Protein S: Modulation of Calcium Affinity of Module 4 by Module 3, and Interaction with Factor X	X	X
17339	The Solution Structure of a Fungal AREA Protein-DNA Complex: An Alternative Binding Mode for a Basic Carboxyl Tail of GATA factors	X	X	X
17340	An Antibody Binding Site on Cytochrome c Defined by Hydrogen Exchange and Two-Dimensional NMR	X	X
17341	1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine as a Substrate of Cytochrome P450 2D6: Allosteric Effects of NADPH-Cytochrome P450 Reductase	X	X
17344	Solution structure of CHD4-PHD2 in complex with H3K9me3	X	X
17345	Solution NMR structure of human NFATC2IP ubiquitin-like domain, NFATC2IP_244_338, NESG target HT65A/OCSP target hs00387_244_338/SGC-toronto	X	X
17350	SOLUTION STRUCTURE OF THE R2 DOMAIN OF TALIN	X	X
17355	NMR solution structure of meACP	X	X
17358	Solution structure of the third Immunoglobulin-like domain of nectin-1	X	X
17359	Solution NMR Structure of protein CD1104.2 from Clostridium difficile, Northeast Structural Genomics Consortium Target CfR130	X	X
17360	Solution structure of Ca2+/calmodulin complexed with a peptide representing the calmodulin-binding domain of calmodulin kinase I	X	X
17362	Backbone assignments for E2-25K	X	X
17363	NMR Structure of the B domain of talin	X	X
17364	The solution structure of the PTB Domain of TENC1 in complex with the peptide of DLC1	X	X
17365	ASHH2 a CW domain	X	X
17368	Fyn SH2 free form	X	X
17369	Fyn SH2 bound form	X	X
17370	Solution NMR structure of conjugate transposon protein BVU_1572(27-141) from Bacteroides Vulgatus, Northeast Structural Genomics Consortium Target BvR155.	X	X
17371	Solution NMR structure of N-terminal Ubiquitin-like domain of FUBI, a ribosomal protein S30 precursor from Homo sapiens. NorthEast Structural Genomics consortium (NESG) target HR6166	X	X
17373	PDZ2 from human SAP97	X	X
17374	1H, 13C and 15N resonance assignments for ADF/Cofilin from Trypanosoma brucei	X	X
17375	Assignment of Human Proliferating Cell Nuclear Antigen Complexed with a 20 Amino Acids Peptide from the C-terminal Region of p21 (WAF1/CIP1)	X	X
17376	Backbone Assignment of Human Proliferating Cell Nuclear Antigen Complexed with a 12 Amino Acids Peptide from the C-terminal Region of p21 (WAF1/CIP1)	X	X
17377	Solution structure of the MFS-bound Sans CEN2 peptide	X	X
17378	Structure of CEL-PEP-RAGE V domain complex	X	X
17379	QUI/G-quadruplex complex	X		X
17380	rbp56 RanBP2 zinc finger backbone chemical shifts	X	X
17381	Backbone 1H, 13C, and 15N Chemical Shift Assignments for a putative surface protein	X	X
17382	Solution structure of the human Raf-1 kinase inhibitor protein	X	X
17383	Crimean Congo Hemorrhagic Fever Gn zinc finger	X	X
17385	TEX13A RanBP2 zinc finger backbone chemical shifts	X	X
17386	RBM10 RanBP2 zinc finger backbone chemical shifts	X	X
17387	RBM5 RanBP2 zinc finger backbone chemical shifts	X	X
17388	Solution Structure of the Zinc Finger Domain of USP13	X	X
17396	1H, 13C, and 15N Chemical Shift Assignments for FCS domain from human polyhomeotic homolog 1	X	X
17398	A protein from yeast	X	X
17400	B. ste. A26I TRAP methyls	X	X
17403	1H, 15N and 13C resonance assignment of the N-terminal C39-peptidase like domain of the ABC transporter Haemolysin B (HlyB)	X	X
17407	The complex structure of homeodomain in solution	X	X
17411	Backbone 1H, 13C, and 15N Chemical Shift Assignments for CHIP (carboxyl terminal of Hsc70-interacting protein)	X	X
17412	GABARAPL-1 NBR1-LIR complex structure	X	X
17413	B. ste. A26I Holo TRAP Ile, Leu, and Val methyls	X	X
17414	Structure of an engineered splicing intein mutant based on Mycobacterium tuberculosis RecA	X	X
17415	Reduced and CO-bound cytochrome P450cam (CYP101A1)	X	X
17416	Aquifex aeolicus LpxC/CHIR-090 complex	X	X
17417	mutant C335A, K309C of the Nek2 kinase leucine zipper	X	X
17419	NMR STRUCTURE OF THE CYTIDINE REPRESSOR DNA BINDING DOMAIN IN PRESENCE OF OPERATOR HALF-SITE DNA	X	X
17421	Solution structure of human protein C6orf130 in complex with ADP-ribose	X	X
17422	Solution Structure of a DNA Duplex Containing the Potent Anti-Poxvirus Agent Cidofovir	X		X
17423	Solution Structure of a DNA Duplex Containing the Potent Anti-Poxvirus Agent Cidofovir	X		X
17424	Solution NMR Structure of Transmembrane and Cytosolic Regions of Integrin 1 in Detergent Micelles	X	X
17427	Chemical Shift Assignments for p21-KID Bound to Cdk2 and Cyclin A in Solution	X	X
17429	Solution NMR structure of the phycobilisome linker polypeptide domain of CpcC (20-153) from Thermosynechococcus elongatus, Northeast Structural Genomics Consortium Target TeR219A	X	X
17431	Solution structure of the E. coli outer membrane protein RcsF (periplasmatic domain)	X	X
17434	solution structure of the C-terminal domain of H-NS like protein Bv3F	X	X
17435	solution structure of the C-terminal domain of Salmonella H-NS	X	X
17436	Structure of the HIV-1 frameshift site RNA bound to a small molecule inhibitor of viral replication	X			X
17437	1H, 13C and 15N backbone chemical shift assignments of the UBC domain of Ube2S	X	X
17439	1H, 13C and 15N backbone chemical shift assignments of ubiquitin at pH 7.2	X	X
17440	Structure of trans-Resveratrol in complex with the cardiac regulatory protein Troponin C	X	X
17443	Solution structure of human ubiquitin conjugating enzyme Rad6b	X	X
17444	transmembrane domain of LR11/SorLA	X	X
17445	1H 15N 13C Backbone Assignment of Akap79 'M' domain, a human A-kinase anchor protein 5	X	X
17446	1H 15N 13C Backbone Assignment of Sap97 N terminal region and PDZ1 domain	X	X
17447	1H, 15N and 13C resonance assignment of a common Major Urinary Protein of the mouse	X	X
17448	Solution structure of the protein YP_546394.1, the first structural representative of the pfam family PF12112	X	X
17452	Chemical Shifts of the Pitx2 Homeodomain in complex with a TAAGCT non-consensus DNA site	X	X	X
17453	Oligomeric Structure of the Chemokine CCL5/RANTES from NMR, MS, and SAXS Data	X	X
17456	1H, 15N, 13C chemical shift assignment of the THAP domain 1-81 from the cell growth suppressor human THAP11 protein	X	X
17457	The Solution Structure of Bovine Ferricytochrome b5 Determined Using Heteronuclear NMR Methods	X	X
17458	NMR STRUCTURE OF THYMOSIN ALPHA-1	X	X
17459	Identification of the Binding Site for Acidic Phospholipids on the PH Domain of Dynamin: Implications for Stimulation of GTPase Activity	X	X
17460	The Stability and Dynamics of Ribosomal Protein L9: Investigations of a Molecular Strut by Amide Proton Exchange and Circular Dichroism	X	X
17461	Multiple Cycles of Global Unfolding of GroEL-bound Cyclophilin A Evidenced by NMR	X	X
17462	EGF-like Module Pair 3-4 in Vitamin K-dependent Protein S: Modulation of Calcium Affinity of Module 4 by Module 3, and Interaction with Factor X	X	X
17463	Structure of the soluble methane monooxygenase regulatory protein B	X	X
17464	Solution Structure of Acidic Fibroblast Growth Factor Bound to 1,3,6-Naphthalenetrisulfonate: A Minimal Model for the Anti-tumoral Action of Suramins and Suradistas	X	X
17465	Structural Characterisation of Apoflavodoxin shows that the Location of the Stable Nucleus Differs Among Proteins with a Flavodoxin-like Topology	X	X
17467	NMR assignment of the second B3 domain of VERNALIZATION1 from Arabidopsis thaliana	X	X
17468	Resonance assignment of a 179 residue fragment of hepatitis C virus non-structural protein 5A	X	X
17469	Quantitative NMR spectroscopy of supramolecular complexes: Dynamic side pores in ClpP are important for product release	X	X
17470	Nuclear magnetic resonance characterization of peptide models of collagen-folding diseases	X	X
17471	Backbone 1H, 13C, and 15N Chemical Shift Assignments for p38 alpha MAPK	X	X
17473	Backbone 1H and 15N Chemical Shift Assignments for chimeric fusion of S. cerevisiae and C. albicans Sup35	X	X
17475	Structural basis of p63a SAM domain mutants involved in AEC syndrome	X	X
17477	NMR Structure of the Mouse MFG-E8 C2 Domain	X	X
17481	Solution NMR Structure of Q5HLI9 from Staphylococcus epidermidis, Northeast Structural Genomics Consortium Target SeR147	X	X
17482	Structural Characterization of small heat shock protein (Hsp12)	X	X
17483	Structural characterization of small heat shock protein (Hsp12) in aqueous solution	X	X
17484	Solution NMR Structure of Homeobox domain of Homeobox protein Nkx-3.1 from homo sapiens, Northeast Structural Genomics Consortium Target HR6470A	X	X
17485	Solution structure of Pf1 SID1-mSin3A PAH2 Complex	X	X
17487	Backbone 1H, 13C, and 15N Chemical Shift Assignments for ICL3 of 5TH1A receptor	X	X
17490	Solution Structure of the C-terminal domain of Prp24	X	X
17491	Backbone Resonance Assignments for the C-terminus of Prp24	X	X
17492	Trn- peptide of the two-component bacteriocin Thuricin CD	X	X
17495	Trn- peptide of the two-component bacteriocin Thuricin CD	X	X
17498	Solid-state NMR assignment of alpha-synuclein amyloid fibrils	X	X
17499	Solid-state NMR assignment of the Ure2p prion C-terminal 70-354 in microcrystalline form.	X	X
17500	Papiliocin	X	X
17501	The NMR structure of the protein NP_344798.1 reveals a CCA-adding enzyme head domain	X	X
17502	NMR STRUCTURE OF THE C-TERMINAL RRM DOMAIN OF POLY(U) BINDING 1	X	X
17503	Staphylococcus aureus FusB	X	X
17507	DJ-1 backbone assignment	X	X
17508	Solution NMR Structure of RRM domain of RNA-binding protein FUS from homo sapiens, Northeast Structural Genomics onsortium Target HR6430A	X	X
17509	NMR structure of the protein YP_557733.1 from Burkholderia xenovorans	X	X
17510	1H, 13C and 15N backbone and side-chain resonance assignments of Drosophila melanogaster Ssu72	X	X
17511	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Leucine Zipper GCN4 coiled coil and x-form conformations.	X	X
17512	1H, 13C, and 15N resonance assignments for S. aureus primase C-terminal domain	X	X
17513	Towards an atomistic level understanding of the unfolded state of Immunity protein 7 in non-denaturing conditions	X	X
17515	solution structure of INAD PDZ5 complexed with Kon-tiki peptide	X	X
17523	Backbone and side-chain 1H, 15N, and 13C resonance assignments of Norwalk virus protease	X	X
17524	Solution NMR Structure of Mitotic checkpoint serine/threonine-protein kinase BUB1 N-terminal domain from Homo sapiens, Northeast Structural Genomics Consortium Target HR5460A	X	X
17525	ATR13 Chemical Shifts	X	X
17529	Third WW domain of human Nedd4L in complex with doubly phosphorylated human smad3 derived peptide.	X	X
17530	Solution NMR structure of the AHSA1-like protein RHE_CH02687 (1-152) from Rhizobium etli, Northeast Structural Genomics Consortium Target ReR242	X	X
17532	NMR structure of Ca2+-bound CaBP1 C-domain with RDC	X	X
17534	NMR resonance assignment of the autoimmunity protein SpaI from Bacillus subtilis ATCC 6633	X	X
17536	Molecular Determinants of Paralogue-Specific SUMO-SIM Recognition	X	X
17537	Solution structure of a Human minimembrane protein OST4	X	X
17538	Structure of the second WW domain from human YAP in complex with a human Smad1 derived peptide	X	X
17539	Structure of first WW domain of human YAP in complex with a human Smad1 doubly-phosphorylated derived peptide.	X	X
17540	Structure of the first WW domain of human YAP in complex with a mono-phosphorylated human Smad1 derived peptide	X	X
17541	Structure of the first domain of human Smurf1 in complex with a monophosphorylated human Smad1 derived peptide.	X	X
17542	Structure of the first domain of human Smurf1 in complex with a doubly phosphorylated human Smad1 derived peptide.	X	X
17543	Structure of the second domain of human Smurf1 in complex with a human Smad1 derived peptide containing a PY motif	X	X
17544	Structure of the second domain of human Nedd4L in complex with a doubly phosphorylated human Smad3 derived peptide.	X	X
17545	Structure of the first domain of human PIN1 in complex with a human Smad3 derived peptide.	X	X
17550	Backbone assignments of the IDOL RING domain	X	X
17552	Backbone resonance chemical shift assignments of Ph SAM linker	X	X
17553	Solution structure of acyl CoA binding protein from Babesia bovis T2Bo. Seattle Structure Genomics Center for Infectious Disease (SSGCID)	X	X
17554	solution structure of tandem UBA of USP13	X	X
17555	Chemical shift assignments of the VBS1 domain of talin	X	X
17556	1H, 13C, and 15N Chemical Shift Assignments of the yPEPmin fragment of Rsa1p	X	X
17558	Structure of the CHR of the Prion protein in DPC Micelles	X	X
17559	Assignment of the stem loop 2 of RsmZ	X			X
17560	Assignment of the stemloop 4 of RSMZ	X			X
17566	22 nt artificial stemloop TASL1	X			X
17567	26 nt artificial stemloop TASL2	X			X
17568	30 nt artificial stemloop TASL3	X			X
17570	Solid-state NMR assignment of the C-terminal domain of the Ure2p prion in its fibrillar form	X	X
17574	Structure of a yeast RNase III dsRBD complex with a non-canonical RNA substrate provides new insights into substrate recognition	X	X			X
17575	solution structure of the C domain of Rv0899 from mycobacterium tuberculosis	X	X
17578	Solution structure of the S. cerevisiae H/ACA RNP protein Nhp2p-S82W mutant	X	X
17579	H/ACA RNP protein Nhp2p	X	X
17580	Myc G-quadruplex formed at the 5'-end of NHEIII element	X		X
17583	Thurincin H	X	X
17584	1H 13C 15N resonance assignment of CD4+ T cell-derived peptide Thp5	X	X
17585	Rv0020c_Nter structure	X	X
17586	Rv0020c_FHA Structure	X	X
17589	Backbone Resonance Assignments for Prp24-RRM3	X	X
17590	Backbone assignments of Anabaena Sensory Rhodopsin Transducer with D-tails	X	X
17591	Backbone assignments of Anabaena Sensory Rhodopsin Transducer with F-tails	X	X
17592	Backbone assignments of Anabaena Sensory Rhodopsin Transducer with DNA	X	X	X
17594	Solution NMR structure of a helical bundle domain from human E3 ligase HECTD1. Northeast structural genomics consortium (NESG) target HT6305A	X	X
17596	Backbone and sidechain 1H, 13C and 15N chemical shift assignments of the hydrophobin DewA from Aspergillus nidulans	X	X
17597	Chemical shift assignments for Rv0577, a putative glyoxylase associated with virulence from Mycobacterium tuberculosis. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target MytuD.17269.a.	X	X
17599	Solution structure of Par-6 Q144C/L164C	X	X
17600	Solution structure of the isolated Par-6 PDZ domain	X	X
17602	Backbone 1H, 13C, and 15N Chemical Shift Assignments of wildtype phosphomannomutase/phosphoglucomutase	X	X
17606	Solution structure of RBBP1 chromobarrel domain	X	X
17607	Solution structure of RBBP1 tudor domain	X	X
17608	RLIP76 (GAP-GBD)	X	X
17609	Chemical shift assignment of Hr4436B from Homo Sapiens, Northeast	X	X
17611	Solution NMR structure of protein Rmet_5065 from Ralstonia metallidurans. Northeast Structural Genomics Consortium Target CrR115.	X	X
17612	Solution NMR Structure of a Protein With a Redesigned Hydrophobic Core, Northeast Structural Genomics Consortium Target OR38	X	X
17613	Solution NMR Structure of DE NOVO DESIGNED PROTEIN, P-LOOP NTPASE FOLD, Northeast Structural Genomics Consortium Target OR36	X	X
17614	Structure of the mitochondrial uncoupling protein 2 determined by NMR molecular fragment replacement	X	X
17616	Backbone Resonance assignment of 1H, 13C, 15N for P2 of plasmodium falciparum in 9M urea.	X	X
17620	1H,15N and 13C Assignment of the D2 domain of the Human Fibroblast Growth Factor Receptor 4	X	X
17626	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Act2-EF34 in complex with palladin peptide	X	X
17627	1H, 13C, and 15N chemical shift assignments for apo actinin-2 C-terminal EF-hand (Act2-EF34)	X	X
17628	NMR Structure of Alk1 extracellular domain	X	X
17629	Yeast Nbp2p SH3 domain in complex with a peptide from Ste20p	X	X
17630	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Human Just Another Zinc Finger Protein residues 23-117	X	X
17631	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human JAZ ZF2	X	X
17633	NMR structure of BC28.1	X	X
17634	Structure of the Cytidine Repressor DNA-Binding Domain; an alternate calculation	X	X
17635	solution structure of FUS/TLS RRM domain	X	X
17636	1H, 13C, and 15N NMR resonance assignments of reduced full length and shortened forms of the Grx domain of Mus musculus TGR	X	X
17637	1H, 13C, and 15N NMR resonance assignments of reduced full length and shortened forms of the Grx domain of Mus musculus TGR	X	X
17638	NMR Structure of the Complete Internal Fusion Loop from Ebolavirus GP2 at pH 5.5	X	X
17640	EL222(14-222)	X	X
17643	Backbone 1H, 13C, and 15N Chemical Shift Assignments for full-length YtvA from Bacillus subtilis	X	X
17645	Solution structure of myosin VI lever arm extension	X	X
17647	Backbone 13C, 15N, 1H chemical shift assignment of a thermostable mutant "6B" of a Lipase from Bacillus Subtilis	X	X
17648	Partial 13C,15N chemical shift assignments of A30P alpha-synuclein fibrils	X	X
17650	1H, 13C, and 15N resonance assignments and secondary structure prediction of the full-length transition state regulator AbrB from Bacillus anthracis	X	X
17651	Solution Structure of Histidine Phosphotransfer Domain of CheA	X	X
17652	Backbone 1H, 13C, and 15N Chemical Shift Assignments of S108C mutant of phosphomannomutase/phosphoglucomutase	X	X
17653	solution structure of the mSin3A PAH3-SAP30 SID complex	X	X
17655	Structure of Human Telomeric DNA in Crowded Solution	X		X
17656	1H, 13C and 15N NMR assignments of inactive form of P1 endolysin Lyz	X	X
17660	Backbone 1H, 13C, and 15N Chemical Shift Assignments for LmrA-NBD	X	X
17661	Solution structure of the long sarafotoxin srtx-i3	X	X
17662	Solution structure of the long sarafotoxin srtx-m	X	X
17663	HVS ORF57 56-140 backbone assignment	X	X
17664	HVS ORF57 103-120 backbone assignment	X	X
17669	1H Chemical Shift Assignments and structure of Trp-Cage mini-protein with D-amino acid	X	X
17670	Solution NMR Structure of Protein AAur_3427 from Arthrobacter aurescens, Northeast Structural Genomics Consortium Target AaR96	X	X
17671	Solution NMR Structure of the HIV-1 Exon Splicing Silencer 3	X			X
17672	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Human Just Another Zinc Finger Protein residues 228-277	X	X
17673	Not Available	X	X
17675	Backbone 1H,15N,13C and 13CB chemical shifts of folded state and denatured state for the N-terminal domain of ribosomal protein L9 (NTL9) V3AI4A double mutant	X	X
17678	HRas166*GppNHp backbone chemical shift assignments	X	X
17679	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Human Just Another Zinc Finger Protein residues 168-227	X	X
17680	Solution structure of Helix-RING domain in the Tyr363 phosphorylated form.	X	X
17682	The 912-888 alternate conformation for helix 27 of E.coli 16S rRNA	X			X
17683	Solution NMR Structure of Heat shock factor protein 1 DNA binding domain from homo sapiens, Northeast Structural Genomics Consortium Target HR3023C	X	X
17685	Solution structure of the C-terminal Pdr1 activating domain of Zuo1	X	X
17687	PARP BRCT Domain	X	X
17688	Solution NMR Structure of Tfu_2981 from Thermobifida fusca, Northeast Structural Genomics Consortium Target TfR85A	X	X
17689	Novel dimeric structure of phage phi29-encoded protein p56: Insights into Uracil-DNA glycosylase inhibition	X	X
17691	Solution structure of the HMG box DNA-binding domain of human stem cell transcription factor Sox2	X	X
17692	backbone resonance assignment of the DMSO-d6 denatured DLC8	X	X
17693	RRM domain of mRNA export adaptor REF2-I bound to HVS ORF57 peptide	X	X
17694	1H, 15N and 13C backbone and side-chain assignments of a family 32 carbohydrate-binding module (CBM32) from the Clostridium perfringens NagH	X	X
17695	Backbone Chemical Shift Assignments of the Extracellular domain of GLIC, a prokaryotic nAChR homologue	X	X
17697	Structure of a dimeric all-parallel-stranded G-quadruplex stacked via the 5'-to-5' interface	X		X
17700	13C, 15N Chemical shifts of E. coli thioredoxin using solid-state nmr spectroscopy	X	X
17701	20 NMR solution structures of Bacillus subtilis L,D-transpeptidase refined in water	X	X
17702	The protein complex for DNA replication	X	X
17703	Backbone and stereo-specific Ile(d1), Leu, Val methyl sidechain chemical shift assignments of RDE-4 (1-243)	X	X
17705	na1	X	X
17706	na2	X	X		X
17707	na3	X	X		X
17708	Solution-state structures of monomeric and dimeric G-quadruplexes adopted by a sequence from N-myc	X		X
17709	Solution-state structures of monomeric and dimeric G-quadruplexes formed by a sequence from N-myc	X		X
17711	Solution structure of the core SMN-Gemin2 complex	X	X
17714	human prion protein mutant HuPrP(90-231, M129, V210I)	X	X
17716	Structure of Cu(I)Cu(II)-CopK from Cupriavidus metallidurans CH34	X	X
17717	Monomeric Mouse ApoAI(1-216)	X	X
17718	Hydrogen Exchange in Unligated and Ligated Straphlococcal Nuclease	X	X
17719	Solution structure of esophageal cancer-related gene 2	X	X
17723	Chemical Shift Assignment and Solution Structure of ChR145 from Cytophaga Hutchinsonii. Northeast Structural Genomics Consortium Target ChR145.	X	X
17724	Micelle-bound KSR1 CA1CA1a	X	X
17725	KSR1(1-170)	X	X
17727	3D ssNMR structure of membrane embedded KcsA-Kv1.3 channel (Closed state)	X	X
17729	Structure of the DNA complex of the C-Terminal domain of Ler	X	X	X
17731	Structural Plasticity of Paneth cell alpha-Defensins: Characterization of Salt-Bridge Deficient Analogues of Mouse Cryptdin-4	X	X
17732	Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA	X	X	X
17733	Solution structure of (R7G)-Crp4	X	X
17734	Solution NMR structure of N-terminal domain of Salmonella effector protein PipB2. Northeast structural genomics consortium (NESG) target stt318a	X	X
17735	Solution structure of sf3636, a two-domain unknown function protein from Shigella flexneri 2a, determined by joint refinement of NMR, residual dipolar couplings and small-angle X-ray scatting, NESG target SfR339/OCSP target sf3636	X	X
17736	Solution NMR structure of the AHSA1-like protein CHU_1110 from Cytophaga hutchinsonii, Northeast Structural Genomics Consortium Target ChR152.	X	X
17737	Solution NMR structure of HopPmal_281_385 from Pseudomonas syringae pv. maculicola str. ES4326, Midwest Center for Structural Genomics target APC40104.5 and Northeast Structural Genomics Consortium target PsT2A	X	X
17738	Structure of a monomeric mutant of the HIV-1 capsid protein	X	X
17739	Solution NMR structure of HopABPph1448_220_320 from Pseudomonas syringae pv. phaseolicola str. 1448A, Midwest Center for Structural Genomics target APC40132.4 and Northeast Structural Genomics Consortium target PsT3A	X	X
17740	Backbone 1H, 13C, 15N assignment of Hck kinase regulatory segment	X	X
17741	Q436	X	X
17742	R458	X	X
17744	3D ssNMR structure of membrane embedded KcsA-Kv1.3 channel (Inactivated state)	X	X
17745	NMR Assignment of PFV RNase H domain	X	X
17747	Solution NMR Structure of Fumarate reductase flavoprotein subunit from Lactobacillus plantarum, Northeast Structural Genomics Consortium Target LpR145J	X	X
17748	Solution NMR Insights into Docking Interactions Involving Inactive ERK2	X	X
17749	Solution NMR structure of Diiron protein in presence of 2 eq Zn2+, Northeast Structural Genomics Consortium Target OR21	X	X
17750	Solution NMR structure of N-terminal domain of human E3 ubiquitin-protein ligase HECW2. Northeast structural genomics consortium (NESG) target ht6306a	X	X
17751	Solution structure of Diiron protein in presence of 8 eq Zn2+, Northeast Structural Genomics consortium target OR21	X	X
17752	SOLUTION STRUCTURE OF THE HUMAN PROLACTIN RECEPTOR ECD DOMAIN D2	X	X
17753	Solution NMR Structure of the Helix-loop-Helix Domain of Human ID3 Protein, Northeast Structural Genomics Consortium Target HR3111A	X	X
17754	Solution NMR structure of a MucBP domain (fragment 187-294) of the protein LBA1460 from Lactobacillus acidophilus, Northeast structural genomics consortium target LaR80A	X	X
17755	1H, 13C, and 15N resonance assignments of human regenerating family I-alpha protein (Reg I-alpha)	X	X
17762	Solution structure of the monomeric derivative of BS-RNase	X	X
17764	A partially folded structure of amyloid-beta(1 40) in an aqueous environment	X	X
17765	Identification of the key regions that drive functional amyloid formation by the fungal hydrophobin EAS	X	X
17766	Secondary structure of subunit E (E133-222) from Saccharomyces cerevisiae V1VO ATPase	X	X
17769	UBIQUITIN NMR STRUCTURE	X	X
17770	Sequence specific backbone resonance assignment of Vitamin D receptor ligand binding domain (VDRLBD) complexed with 1,25(OH)2 D3 and LXXLL motif (DRIP205)	X	X
17771	Resonance Assignments of Calmodulin Complexed with the Calmodulin-Binding Domain of Olfactory Nucleotide Gated Ion Channel	X	X
17773	Backbone (1)H, (13)C and (15)N NMR chemical shift assignments for the human DGCR8 core	X	X
17777	Solution structure of the N-terminal domain of the Shigella type III secretion protein MxiG	X	X
17780	Human prion protein with E219K protective polymorphism	X	X
17784	NMR structure of the PhyRSL-NepR complex from Sphingomonas sp. Fr1	X	X
17785	KRas171*GppNHp backbone chemical shift assignments	X	X
17793	Backbone chemical shift assignments for Ab42 with Met35 in its oxidized state	X	X
17794	Backbone chemical shift assignments for Ab42 with Met35 in its reduced state	X	X
17795	Backbone chemical shift assignments for A 40 with Met35 in its oxidised state	X	X
17796	Backbone chemical shift assignments for A 40 with Met35 in its reduced state	X	X
17799	NMR structure of the protein YP_001302112.1 from Parabacteroides distasonis	X	X
17803	Human Insulin Mutant A22Gly-B31Arg	X	X
17804	1H, 15N and 13C backbone resonance assignments of alpha1-antitrypsin	X	X
17805	THE HIGH RESOLUTION STRUCTURE OF UBIQUITIN LIKE DOMAIN OF UBLCP1	X	X
17806	NMR structure of the calcium-bound form of the protein YP_001302112.1 from Parabacteroides distasonis	X	X
17807	Solution structure of Ca2+/calmodulin complexed with a peptide representing the calmodulin-binding domain of L-selectin	X	X
17808	Structure of PHD domain of UHRF1 in complex with H3 peptide	X	X
17809	Solution NMR structure of the AHSA1-like protein AHA_2358 from Aeromonas hydrophila refined with NH RDCs. Northeast Structural Genomics Consortium Target AhR99.	X	X
17811	Solution structure of MsPTH	X	X
17812	NMR STRUCTURE OF UHRF1 PHD DOMAINS IN A COMPLEX WITH HISTONE H3 PEPTIDE	X	X
17813	NMR structure of the UHRF1 PHD domain	X	X
17815	Backbone 1H, 13C and 15N resonance assignments for IMP1 KH34	X	X
17817	Green Proteorhodopsin - Deuterated	X	X
17818	Solution NMR structure of a FKBP-type peptidyl-prolyl cis-trans isomerase from Giardia lamblia. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target GilaA.00840.a	X	X
17819	Backbone 1H, 13C, 15N assignment of Hck kinase regulatory segment complex with full length Nef	X	X
17820	Backbone resonance assignments for IsdH-N2N3	X	X
17821	Human C30S/C59S-Cox17 mutant	X	X
17822	Backbone 1H, 13C, and 15N Chemical Shift Assignments for QFM(Y)F	X	X
17824	Rbx1	X	X
17825	Solution Structure of the J Domain of HSJ1a	X	X
17826	Galectin-7	X	X
17828	Ubiquitin-like domain from HOIL-1	X	X
17829	FVIII C2 Domain	X	X
17832	1H, 15N and 13C resonance assignments for the N-terminal dimeric region of budding yeast histone chaperone Rtt106	X	X
17833	Skint1 IgV	X	X
17836	The assigned chemical shifts for the disordered forms of apo-IscU	X	X
17837	The assigned chemical shifts for the structured forms of apo-IscU	X	X
17839	Ga98 solution structure	X	X
17840	GB98 solution structure	X	X
17841	GB98-T25I,L20A	X	X
17842	Solution structure of outer membrane protein H (OprH) from P. aeruginosa in DHPC micelles.	X	X
17843	GB98-T25I solution structure	X	X
17844	The assigned chemical shifts of disordered-IscU complexed with IscS	X	X
17845	Backbone 1H, 13C, and 15N chemical shift assignments of oxidized yeast iso-1 cytochrome c	X	X
17846	Backbone 1H, 13C, and 15N chemical shift assignments of reduced yeast iso-1 cytochrome c	X	X
17847	Backbone 1H, 13C, and 15N chemical shift assignments of oxidized horse heart cytochrome c	X	X
17848	Backbone 1H, 13C, and 15N chemical shift assignments of reduced horse heart cytochrome c	X	X
17849	Solution structure of Ca2+-bound yCaM	X	X
17850	Solution structure of Ca2+/CNA1 peptide-bound yCaM	X	X
17853	Backbone and sidechain 1H 13C and 15N chemical shift assignement of the catalytic domain from	X	X
17855	Backbone 1H, 13C, and 15N Chemical Shift Assignments for high mobility group protein-like protein NHP1 from Babesia bovis T2Bo. Seattle Structure Genomics Center for Infectious Disease (SSGCID)	X	X
17857	Chemical Shift Assignments and solution structure of human apo-S100A1 E32Q mutant	X	X
17860	high resolution NMR solution structure of helix H1 of the chimpanzee HAR1 RNA	X			X
17861	high resolution NMR solution structure of helix H1 of the human HAR1F RNA	X			X
17862	Solution structure of Staphylococcus aureus IsdH linker domain	X	X
17864	1H, 13C, and 15N Chemical Shift Assignments for human FAIM-CTD	X	X
17866	1H,15N and 13C backbone and side chain chemical shifts of human halo S100P	X	X
17867	Structural Insight into the Unique Cardiac Myosin Binding Protein-C Motif: A Partially Folded Domain	X	X
17868	Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat	X	X
17869	Tri-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat	X	X
17870	Di-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat	X	X
17871	Di-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat	X	X
17872	Di-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat	X	X
17873	Mono-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat	X	X
17874	Mono-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat	X	X
17875	Mono-O-GalNAc glycosylated Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat	X	X
17876	STRUCTURAL AND FUNCTIONAL ANALYSIS OF A NOVEL POTASSIUM TOXI ARGENTINEAN SCORPION TITYUS TRIVITTATUS REVEALS A NEW KAPPA SUB-FAMILY	X	X
17878	Backbone 1H, 13C, and 15N Chemical Shift Assignments for La(4-325)	X	X
17879	NMR structure of Atg8-Atg7C30 complex	X	X
17880	1H, 13C, and 15N Chemical Shift Assignments for a yeast protein	X	X
17881	Dynamics of isolated C domain of calmodulin apo form	X	X
17882	Solution Structure of CssII	X	X
17883	The solution structure of the Lin28-ZnF domains bound to AGGAGAU of pre-let-7 miRNA	X	X		X
17888	NMR Structure of the Polyserine Tract of Apis mellifera Vitellogenin, residues 358-392	X	X
17889	The polyserine tract of Nasonia vitripennis Vg residues 351-385	X	X
17890	NMR structure of the lectin CCL2 (free)	X	X
17891	Solution Structure of KKGF	X	X
17892	NOE-based 3D structure of the CylR2 homodimer at 298K	X	X
17893	NOE-based 3D structure of the CylR2 homodimer at 270K (-3 Celsius degrees)	X	X
17894	NOE-based 3D structure of the predissociated homodimer of CylR2 in equilibrium with monomer at 266K (-7 Celsius degrees)	X	X
17895	NOE-based 3D structure of the monomer of CylR2 in equilibrium with predissociated homodimer at 266K (-7 Celsius degrees)	X	X
17896	NOE-based 3D structure of the monomeric intermediate of CylR2 at 262K (-11 Celsius degrees)	X	X
17897	NOE-based 3D structure of the monomeric partially-folded intermediate of CylR2 at 259K (-14 Celsius degrees)	X	X
17898	NOE-based 3D structure of the monomeric partially-folded intermediate of CylR2 at 257K (-16 Celsius degrees)	X	X
17899	1H, 13C and 15N NMR assignments of the aciniform spidroin (AcSp1) repetitive domain of Argiope trifasciata wrapping silk	X	X
17900	Solution NMR Structure of BfR322 from Bacteroides fragilis, Northeast Structural Genomics Consortium Target BfR322	X	X
17901	Partial 1H, 13C, 15N Chemical Shift Assignments for the U6 Spliceosomal snRNA 5' Stem-Loop 30-mer Construct.	X			X
17902	Solution structure of CCL2 in complex	X	X			X
17903	NMR Solution Structure of Yeast Iso-1-cytochrome c Mutant P71H in oxidized states	X	X
17904	NMR Solution Structure of Yeast Iso-1-cytochrome c Mutant P71H in reduced states	X	X
17905	1H, 13C and 15N resonance assignment of the Anticodon Binding Domain of Human Lysyl Aminoacyl tRNA Synthetase	X	X
17908	Solution structure Analysis of the ImKTx104	X	X
17911	C-terminal domain of SARS-CoV main protease	X	X
17912	The third SH3 domain of R85FL	X	X
17914	Integral membrane core domain of the mercury transporter MerF in lipid bilayer membranes	X	X
17915	PFBD: High-throughput Strategy of Backbone fold Determination for small well-folded proteins in less than a day	X	X
17916	Backbone assignments for the C-terminal domain of yeast Tfg2	X	X
17917	Backbone chemical shift assignments for the C-terminal domain of yeast Tfg1.	X	X
17918	Solution structure of the TbPIN1	X	X
17921	Partial 1H, 15N Chemical Shift Assignments of a GAAA Tetraloop Receptor Variant.	X			X
17922	Backbone 1H, 13C, 15N assignment of HIV-1 accessory protein Nef	X	X
17924	SEVI	X	X
17925	SEVI with Zn	X	X
17927	Solution Structure of a putative thiol-disulfide oxidoreductase from Bacteroides vulgatus	X	X
17930	monophosphorylated (747pY) beta3 integrin cytoplasmic tail under membrane mimetic conditions	X	X
17931	biphosphorylated (747pY, 759pY) beta3 integrin cytoplasmic tail under membrane mimetic conditions	X	X
17932	monophosphorylated (747pY) beta3 integrin cytoplasmic tail under aqueous conditions	X	X
17934	AIDA1 PTB domain	X	X
17935	1H, 13C, 15N assignment and secondary structure determination of GATase subunit of GMP Synthetase from Methanococcus jannaschii	X	X
17936	N/A	X	X
17937	Solid-state Chemical Shift Assignments for CAP-Gly Domain of Mammalian Dynactin	X	X
17938	Solution Chemical Shifts Assignments of 1H, 13C, and 15N for CAP-Gly	X	X
17940	1H, 13C and 15N backbone resonance assignment of the activated p38 mitogen-activated protein kinase	X	X
17941	the structure of subdomain IV-B from the CVB-3 IRES	X			X
17942	1H, 13C and 15N resonance assignment of a complex constisting of hDlg/SAP-97 residues 318-406 and HPV type 51 E6 protein residues 141-151	X	X
17943	1H, 13C and 15N NMR assignment of CGC-19, a single domain proteic constituent of a non ribosomal peptide synthetase.	X	X
17944	13C, 15N Chemical shifts of the C-terminal fragment of E. coli thioredoxin reassembly using solid-state NMR spectroscopy	X	X
17946	Aliphatic 1H, 13C, and 15N chemical shift assignments of dihydrofolate reductase from the psychropiezophile Moritella profunda in complex with NADP+ and folate	X	X
17948	NMR structure of Hsp12 in the presence of DPC	X	X
17949	Solution Structure of CssII	X	X
17950	Solution structure of DNA binding domain of AtTRB2	X	X
17952	Backbone 1H, 13C, and 15N Chemical Shift Assignments for E.coli Ribonuclease P protein	X	X
17953	NMR Structure of protoporphyrin-IX bound murine p22HBP	X	X
17955	(C9S, C14S)-leucocin A	X	X
17957	1H, 13C and 15N chemical shifts assignments of BA42 from Bizionia argentinensis	X	X
17958	C9L,C14L-LeuA	X	X
17961	S. cerevisiae U2/U6 snRNA complex	X			X
17962	Solution structure of putative oxidoreductase from Ehrlichia chaffeensis. (Seattle Structural Genomics Center for Infectious Disease (SSGCID))	X	X
17964	Backbone 1H, 13C, and 15N Chemical Shift Assignment for inactive HIV-1 protease CRF01_AE	X	X
17965	Solution NMR structure of Alr2454 protein from Nostoc sp. strain PCC 7120, Northeast Structural Genomics Consortium Target NsR264	X	X
17967	Structure of the monomeric N-terminal domain of HPV16 E6 oncoprotein	X	X
17968	Haddock model structure of the N-terminal domain dimer of HPV16 E6	X	X
17971	Solution NMR structure of homeobox domain (171-248) of human homeobox protein TGIF1, Northeast Structural Genomics Consortium Target HR4411B	X	X
17972	U2/U6 Helix I	X			X
17973	Onconase zymogen FLG variant	X	X
17978	Backbone and sidechain 1H, 13C and 15N chemical shift assignments of the hydrophobin MPG1 from the rice blast fungus Magnaporthe oryzae	X	X
17979	Solution structure of the Zn(II) form of Desulforedoxin	X	X
17980	Monomer-dimer equilibrium for 5 -5 stacking of propeller-type parallel-stranded G-quadruplexes: NMR structural study	X		X
17981	Dynamics of isolated C domain of calmodulin complexed with PEP-19 in the absence of Ca2+	X	X
17982	Dynamics of isolated C domain of calmodulin complexed with Ca2+	X	X
17983	Dynamics of isolated C domain of calmodulin complexed with PEP-19 in the presence of Ca2+	X	X
17985	Structure of BST-2/Tetherin Transmembrane Domain	X	X
17986	Solution structure of cyclic gomesin peptide	X	X
17987	New tricks of an old fold: structural versatility of scorpion toxins with common cysteine spacing	X	X
17989	NMR resonance assignment of the UUP protein C-terminal domain	X	X
17991	WSA major conformation	X	X
17992	WSA minor conformation	X	X
17994	Backbone 1H, 13C, and 15N Chemical Shift Assignment for inactive HIV-1 protease Bmut5	X	X
17995	Solution NMR structure of holo acyl carrier protein NE2163 from nitrosomonas europaea. Northeast structural genomics consortium target NET1	X	X
17996	Backbone 1H, 13C, and 15N Chemical Shift Assignment for inactive HIV-1 protease subtype C	X	X
17997	Solution structure of the Cd(II) form of Desulforedoxin	X	X
17998	Resonance assignments of the PPIase domain of FKBP42 from Arabidopsis thaliana	X	X
17999	Chemical Shift Assignments from PfEMP1: Full-length	X	X
18001	1H, 13C and 15N chemical shift assignments of the PPIase domain of human aryl-hydrocarbon receptor-interacting protein (AIP)	X	X
18002	Structural Basis of Phosphoinositide Binding to Kindlin-2 Pleckstrin Homology Domain in Regulating Integrin Activation	X	X
18003	solution structure of apo-NmtR	X	X
18004	Structural and functional analysis of the DEAF-1 and BS69 MYND domains	X	X
18005	TBA	X	X
18006	TBA	X	X
18007	TBA	X	X
18008	TBA	X	X
18011	NMR assignments for TB24	X	X
18012	Solution structure of N-terminal domain of human TIG3	X	X
18015	Chemical shift assignments for the homeodomain of Pitx2 in complex with a TAATCC DNA binding site	X	X	X
18016	Solution structure of MSMEG_1053, the second DUF3349 annotated protein in the genome of Mycobacterium smegmatis. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target MysmA.17112.b	X	X
18018	NMR structure of the putative ATPase regulatory protein YP_916642.1 from Paracoccus denitrificans	X	X
18022	Structure of the Cx43 C-terminal domain bound to tubulin	X	X
18023	Cyclo-TC1 Trp-cage	X	X
18026	Backbone Chemical Shift Assignments for Unmyristoylated GCAP1 bound to Ca2+ ions	X	X
18029	1H, 13C, and 15N Chemical Shift Assignments for sf-ALR	X	X
18031	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the ribosoaml assembly factor Fap7 from Pyrococcus horikoshii in its AP5A bound form	X	X
18032	Solution NMR structure of the specialized holo-acyl carrier protein RPA2022 from Rhodopseudomonas palustris refined with NH RDCs. Northeast Structural Genomics Consortium Target RpR324.	X	X
18037	NMR STRUCTURE OF THE IMIPENEM-ACYLATED L,D-TRANSPEPTIDASE FROM BACILLUS SUBTILIS	X	X
18045	1H,13C, and 15N chemical shift assignments for human endothelial monocyte-activating polypeptide II	X	X
18047	NMR structure of the protein NP_814968.1 from Enterococcus faecalis	X	X
18048	NPM1_C70	X	X
18049	Low resolution structure of RNA-binding subunit of the TRAMP complex	X	X
18051	Solution NMR structure of the N-terminal myb-like 1 domain of the human cyclin-D-binding transcription factor 1 (hDMP1). Northeast Structural Genomics Consortium (NESG) target ID hr8011a.	X	X
18052	Structural analysis of the pyroglutamate modified isoform of the Alzheimer's disease related beta-amyloid using NMR spectroscopy	X	X
18053	Solution NMR structure of C-terminal globular domain of human Lamin-B2. Northeast Structural Genomics Consortium target HR8546A.	X	X
18080	structure of amyloid precursor protein's transmembrane domain	X	X
18082	SOLUTION NMR-DERIVED STRUCTURE OF CALMODULIN N-LOBE BOUND WITH ER alpha PEPTIDE	X	X
18084	SOLUTION NMR-DERIVED STRUCTURE OF CALMODULIN C-LOBE BOUND WITH ER ALPHA PEPTIDE	X	X
18085	Alvinellacin	X	X
18086	GhoS (YjdK) monomer	X	X
18087	solution structure of human apo-S100A1 C85M	X	X
18088	Post-translational S-nitrosylation is an endogenous factor fine-tuning human S100A1 protein properties	X	X
18089	Post-translational S-nitrosylation is an endogenous factor fine-tuning human S100A1 protein properties	X	X
18090	Solution structure of the yeast Sti1 DP1 domain	X	X
18091	Solution structure of the yeast Sti1 DP2 domain	X	X
18092	Solution structure of the N-terminal domain of human polypeptide chain release factor eRF1	X	X
18093	NMR structures of the transmembrane domains of the nAChR a4 subunit	X	X
18095	Solution NMR Structure of Lysine-specific demethylase lid from Drosophila melanogaster, Northeast Structural Genomics Consortium Target FR824D	X	X
18096	NMR structures of the transmembrane domains of the AChR b2 subunit	X	X
18097	Backbone 1H, 13C, and 15N Chemical Shift Assignments for primate innate immunity protein	X	X
18098	Solution NMR Structure of mitochondrial succinate dehydrogenase assembly factor 2 from Saccharomyces cerevisiae, Northeast Structural Genomics Consortium Target YT682A	X	X
18099	Solution structure of Ca2+-CIB1 in complex with the cytoplasmic domain of the integrin aIIb subunit	X	X
18102	Structure, Activity and Interactions of the Cysteine Deleted Analog of Tachyplesin-1 with Lipopolysaccharide Micelles	X	X
18110	Solution Structure of C-terminal RAGE (ctRAGE)	X	X
18112	Minimal Constraints Solution NMR Structure of Prospero Homeobox protein 1 from Homo sapiens. Northeast Structural Genomics Consortium Target HR4660B.	X	X
18113	Sequence-specific 1H, 15N and 13C resonance assigments of Gad m 1: a allergenic parvalbumin from Atlantic Cod (Gadus morhua).	X	X
18114	Solution structure of human LL-23 bound to membrane-mimetic micelles	X	X
18115	Solution Structure of The C-terminal Domain (537-610) of Human Heat Shock Protein 70	X	X
18116	backbone and sidechain order parameters for ubiquitin at 1, 400, 800, 1200, 1600 and 2500 bar	X	X
18119	ITK-SH3	X	X
18121	1H, 13C, and 15N chemical shift assignments for CdnLNt from Myxoccoccus xanthus	X	X
18122	1H, 13C, and 15N resonance assignments of Photoactive Yellow Protein	X	X
18133	1H, 13C, 15N backbone and sidechain of human AK1 from Escherichia coli	X	X
18134	SOLUTION STRUCTURE OF THE FIRST SAM DOMAIN OF ODIN	X	X
18138	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Multi-Drug Resistant HIV-1 Protease Variant, MDR 769	X	X
18145	Solution NMR Structure of DE NOVO DESIGNED PROTEIN, IF3-like fold, Northeast Structural Genomics Consortium Target OR135 (CASD target)	X	X
18146	Insight into the antimicrobial activities based on the Structure-activity relationships of coprisin isolated from the Dung Beetle, Copris tripartitus	X	X
18147	Assigned NMR chemical shift of Escherichia coli Ribosome binding factor A	X	X
18148	VEGFR2-Integrin B3 interaction	X	X
18151	1H, 13C, and 15N chemical shift assignments for CdnL from Myxoccoccus xanthus	X	X
18153	The solution structure of thermomacin	X	X
18154	apo_YqcA	X	X
18156	Solution NMR Structure of the mitochondrial inner membrane domain (residues 164-251), FtsH_ext, from the paraplegin-like protein AFGL32 from Homo sapiens, Northeast Structural Genomics Consortium Target HR6741A	X	X
18157	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Avirulence homolog-5	X	X
18158	Solution NMR structure of N-terminal domain (6-74) of human ZBP1 protein, Northeast Structural Genomics Consortium Target HR8174A.	X	X
18161	Solution NMR Structure of DE NOVO DESIGNED PROTEIN, PFK fold, Northeast Structural Genomics Consortium Target OR134	X	X
18166	Solution NMR Structure of Stress-induced-phosphoprotein 1 STI1 from Homo sapiens, Northeast Structural Genomics Consortium Target HR4403E	X	X
18167	Solution Structure of Cyanobacterial PsbP (CyanoP) from Synechocystis sp. PCC 6803	X	X
18169	Solution structure of Ca-bound S100A4 in complex with non-muscle myosin IIA	X	X
18171	Solution structure of atTic-hip/hop domain (Residue 310-371)	X	X
18176	Backbone chemical shift assignments for the oxidized form of cVIMP-Cys	X	X
18177	Backbone chemical shift assignments for the reduced form of cVIMP-Cys	X	X
18178	Solution structure of AGR2 residues 41-175	X	X
18179	Solution structure of E60A mutant AGR2	X	X
18180	Solution NMR Structure of the uncharacterized protein from gene locus rrnAC0354 of Haloarcula marismortui. Northeast Structural Genomics Consortium Target HmR11.	X	X
18182	Identification and structural basis for a novel interaction between Vav2 and Arap3	X	X
18183	Identification and structural basis for a novel interaction between Vav2 and Arap3	X	X
18188	CohA2	X	X
18189	DocA	X	X
18190	NMR structure of the protein BC008182, a DNAJ-like domain from Homo sapiens	X	X
18193	1H, 13C, and 15N chemical shift assignments for the N-terminal domain of Thermus thermophilus CdnL	X	X
18194	1H, 13C, and 15N chemical shift assignments for the 72-residue N-terminal domain of Myxococcus xanthus CarD	X	X
18195	NMR Solution Structure of Optineurin Zinc-finger Domain	X	X
18196	Backbone assignment for an intracellular proteinase inhibitor of Bacillus Subtilis	X	X
18197	rat Angiogenin	X	X
18198	Chemical Shift Assignment of the PP1 Binding Domain of NIPP1	X	X
18200	Resonance assignments for C-terminal DNA-binding domain of RstA protein from Klebsiella pneumonia	X	X
18201	1H, 13C and 15N resonance assignments of the periplasmic signaling domain of HasR, a TonB-dependent outer membrane heme transporter	X	X
18202	Backbone and partial sidechain assignment (13C only) of hNaa50p assignment	X	X
18203	NMR solution structure of Mu-contoxin BuIIIB	X	X
18204	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human PEBP1	X	X
18205	PDZ Domain of CAL (Cystic Fibrosis Transmembrane Regulator-Associated Ligand)	X	X
18206	Conotoxin analogue [D-Ala2]BuIIIB	X	X
18209	Solution-state structure of an intramolecular G-quadruplex w th propeller, diagonal and edgewise loops	X		X
18211	1H, 15N and 13C resonance assignments for the LOTUS2 and LOTUS3 RNA binding domains of mouse TDRD7	X	X
18214	Solution NMR structure of TSTM1273 from Salmonella typhimurium LT2, NESG target STT322, CSGID target IDP01027 and OCSP target TSTM1273	X	X
18215	Solution NMR Structure of the uncharacterized protein from gene locus VNG_0733H of Halobacterium salinarium, Northeast Structural Genomics Consortium Target HsR50.	X	X
18216	NMR structure of an acyl-carrier protein from Rickettsia prowazekii.(Seattle Structural Genomics Center for Infectious Disease (SSGCID))	X	X
18228	Backbone and side chain assignment of TpbA	X	X
18229	NMR structure of the complex between the PH domain of the Tfb1 subunit from TFIIH and Rad2	X	X
18230	Solution structure and dynamics of human S100A1 protein modified at cysteine 85 with homocysteine disulfide bond formation in calcium saturated form.	X	X
18231	Solution structure of S100A1 Ca2+	X	X
18234	Solution structure of P1-CheY/P2 complex in bacterial chemotaxis	X	X
18236	Backbone and sidechain 13C, 15N, and 1H assignments of cruzain in complex with K777	X	X
18238	SOLUTION STRUCTURE OF AN APOPTOSIS ACTIVATING PHOTOSWITCHABLE BAK PEPTIDE BOUND to BCL-XL	X	X
18242	Backbone and sidechain 1H, 15N and 13C assignments of NLRP10 (PYNOD) pyrin domain	X	X
18244	Structure of the complex of the central activation doamin of Gcn4 bound to the mediator co-activator domain 1 of Gal11/med15	X	X
18249	1H, 13C and 15N backbone and side-chain resonance assignments of reduced CcmG from Escherichia coli	X	X
18250	NMR STRUCTURE of Bcl-XL	X	X
18251	Cdc42Hs-GMPPCP Complex	X	X
18252	Cdc42Hs-GMPPCP-PBD46 Complex	X	X
18253	1H, 13C and 15N NMR assignments of inactive form of P1 endolysin Lyz at pH 7.5	X	X
18255	Solution structure of a MbtH-like protein from Burkholderia pseudomallei, the etiological agent responsible for melioidosis. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target BupsA.13472.b.	X	X
18256	R state structure of monomeric phospholamban (C36A, C41F, C46A)	X	X
18257	E. coli DmsD	X	X
18260	1H, 13C and 15N resonance assignment of chicken brain alpha spectrin repeat 17	X	X
18263	Solution NMR of the specialized apo-acyl carrier protein (RPA2022) from Rhodopseudomonas palustris, Northeast Structural Genomics Consortium Target RpR324	X	X
18265	WIP C-terminal domain	X	X
18266	Backbone assignment of Dengue Virus NS2B/NS3 in complex with Aprotinin	X	X
18267	Substrate-dependent millisecond domain motions in DNA polymerase beta	X	X
18268	Unliganded (apo) C-terminal EF-hand domain from human polycystin-2	X	X
18269	Solution Structure of N-Terminal domain of human Conserved Dopamine Neurotrophic Factor (CDNF)	X	X
18276	1H, 13C and 15N chemical shifts for Salmonella Typhimurium PrgI Type three secretion system needle subunit	X	X
18277	Solution structures of KmAtg10	X	X
18278	Solution Structure of FKBP12 from Aedes aegypti	X	X
18281	Solution Structure of Strawberry Allergen Fra a 1e	X	X
18284	Solution structure of de novo designed antifreeze peptide 1m	X	X
18285	Backbone amide assignments of HLA-DR1/CLIP complexes	X	X
18286	Solution structure of de novo designed antifreeze peptide 3	X	X
18287	Backbone and sidechain 1H chemical shifts for PAP248-286 (SEVI) in solution at pH 6	X	X
18288	1H, 13C and 15N chemical shift assignments of Ninjurin1 ENT domain	X	X
18289	Solution structure of de novo designed peptide 4m	X	X
18290	Solution NMR Structure of syc0711_d from Synechococcus sp., Northeast Structural Genomics Consortium (NESG) Target SnR212	X	X
18296	Solution structure of BRD1 PHD2 finger	X	X
18297	E2 binding surface on Uba3 beta-grasp domain undergoes a conformational transition	X	X
18298	Domain interaction in Thermotoga maritima NusG	X	X
18299	Solution structure of the K60A mutant of Atox1	X	X
18300	Solution NMR structure of asteropusin A from marine sponge Asteropus sp.	X	X
18301	Metal binding repeat 2 of the Wilson disease protein (ATP7B)	X	X
18302	Solution structure of the calcium-bound CaM N-terminal domain in a complex.	X	X
18304	Order parameters for HEWL	X	X
18305	Order parameters for HEWL-chitotriose	X	X
18306	Human APOBEC2 chemical shifts, RDC, NOE, and T1/T2 data	X	X
18307	Human APOBEC2 chemical shifts	X	X
18308	Backbone amide assignments of HLA-DR1/CLIP complexes	X	X
18309	Chemical Shift 1H, 13C, 15N Assignments of N-terminal domain of Thermotoga Maritima flagellar motor protein FliG	X	X
18310	Chemical Shift 1H, 13C, 15N Assignments of N-terminal domain of Thermotoga Maritima flagellar motor protein FliG bound to unlabeled FliF C-terminal peptide	X	X
18312	1H, 13C and 15N assignments of Cyclophilin A from Piriformospora indica, a plant root-colonizing basidiomycete fungus	X	X
18313	Solution Structure of the A domain of talin	X	X
18314	NMR structure of FOXO3a transactivation domains (CR2C-CR3) in complex with CBP KIX domain (2b3l conformation)	X	X
18315	NMR structure of FOXO3a transactivation domains (CR2C-CR3) in complex with CBP KIX domain (2l3b conformation)	X	X
18317	Chemical shift assignments of the canecystatin-1 from Saccharum officinarum	X	X
18319	1H, 13C and 15N full assignment of transmembrane domain TM12 from human Y4 receptor	X	X
18322	Mrx1 reduced	X	X
18323	Solution structure of the calcium-bound CaM C-terminal domain in a complex	X	X
18325	Mrx1 oxidized	X	X
18326	1H, 13C, and 15N resonance assignments of Ni(II)-NmtR	X	X
18327	Solution structure of the atypical SH3 domain of DOCK180	X	X
18329	Structure of decorbin-binding protein A from Borrelia burgdorferi	X	X
18331	1H, 13C and 15N assignments of the holo-acyl carrier protein of Pseudomonas aeruginosa	X	X
18332	E. coli Protein	X	X
18335	Structure and orientation of the gH625-644 membrane interacting region of herpes simplex virus type 1 in a membrane mimetic system.	X	X
18336	Structure of the RNA claw of the DNA packaging motor of bacteriophage 29	X			X
18337	SOLUTION NMR STRUCTURE OF DE NOVO DESIGNED PROTEIN, P-LOOP NTPASE FOLD, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET OR136	X	X
18338	C-terminal propeptide (PPc) region of vibrio extracellular metalloprotease	X	X
18340	Structural Mechanism for Bax Inhibition by Cytomegalovirus Protein vMIA	X	X
18341	Sgt2_NT	X	X
18342	Backbone and sidechain assignments for Get5_UBL domain	X	X
18344	Gal-GalNac-Interferon Alpha-2a	X	X
18345	Solution structure of the anti-fungal defensin DEF4 (MTR_8g070770) from Medicago truncatula (barrel clover)	X	X
18346	NMR structure of the protein NP_390037.1 from Bacillus subtilis.	X	X
18347	1H chemical shift assignments for micasin	X	X
18348	Backbone 1H, 13C, and 15N Chemical Shift Assignments for EB1 CH domain	X	X
18349	NMR structure of a LINE-1 type transposase domain-containing protein 1 (L1TD1) from HOMO SAPINES	X	X
18350	cathelicidin-PY	X	X
18351	Solution structure of the Class II hydrophobin NC2	X	X
18352	Solution NMR Structure of CASP8-associated protein 2 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR8150A	X	X
18353	1H, 15N and 13C backbone resonance assignments of the Kelch domain of mouse Keap1	X	X
18355	NMR Structure of Signal Sequence Deleted (SSD) Rv0603 Protein from Mycobacterium tuberculosis without N-terminal His-tag	X	X
18356	Solution Structure of ADF like UNC-60A Protein of Caenorhabditis elegans	X	X
18359	The chemical shifts and T1, T2, and 1H-15N NOE data for apo-IscU(D39V)	X	X
18360	The chemical shifts and T1, T2, and 1H-15N NOE data for apo-IscU(E111A)	X	X
18361	The chemical shifts and T1, T2, and 1H-15N NOE data for apo-IscU(N90A)	X	X
18362	The chemical shifts and T1, T2, and 1H-15N NOE data for apo-IscU(S107A)	X	X
18363	'Backbone Chemical Shift Assignments for Scylla Serrata anti lipopolysaccharide Factor-24 (SsALF-24) peptide'	X	X
18364	NMR structure of the protein YP_001300941.1 from Bacteroides vulgatus	X	X
18365	Backbone and side chain 1H, 13C, and 15N Chemical Shift Assignments for Hen Egg White Lysozyme mutant WT-ALA	X	X
18366	Backbone 1H and 15N Chemical Shift Assignments for Hen Egg White Lysozyme mutant W28G.	X	X
18367	Backbone 1H and 15N Chemical Shift Assignments for Hen Egg White Lysozyme mutant W62G.	X	X
18368	Backbone 1H and 15N Chemical Shift Assignments for Hen Egg White Lysozyme mutant W108G.	X	X
18369	Backbone 1H and 15N Chemical Shift Assignments for Hen Egg White Lysozyme mutant W111G.	X	X
18370	Backbone 1H and 15N Chemical Shift Assignments for Hen Egg White Lysozyme mutant W123G.	X	X
18371	Backbone 1H, 13C, and 15N Chemical Shift Assignments for EB1 C-terminal domain	X	X
18372	SOLUTION NMR STRUCTURE OF DE NOVO DESIGNED PROTEIN, P-LOOP NTPASE FOLD, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET OR137	X	X
18373	bLac - Oceanobacillus iheyensis	X	X
18374	NMR structure of the second PHD finger of AIRE (AIRE-PHD2)	X	X
18375	NMR solution structure of staphyloxanthin biosynthesis protein	X	X
18380	Backbone 1H, 13C, and 15N Chemical Shift Assignments and Complete 15N Relaxation Analysis of the Soluble C-terminal Domain of CcmE Heme Chaperone from Desulfovibrio vulgaris, dvCcmE(44-137). Northeast Structural Genomics Target DvR115.	X	X
18381	The backbone chemical shifts of IscU complexed with HscA	X	X
18385	Characterization of the chromoshadow domain-mediated binding of heterochromatin protein 1 alpha (HP1 alpha) to histone H3: Backbone 1H, 15N chemical shift assignments for histone H3 (1-59)	X	X
18386	Characterization of the chromoshadow domain-mediated binding of heterochromatin protein 1 alpha (HP1 alpha) to histone H3: Backbone 1H, 15N chemical shift assignments for HP1 CSDalpha(109-185)	X	X
18387	Solution structure of a thiol:disulfide interchange protein from Bacteroides sp.	X	X
18388	Solution structure, dynamics and binding studies of CtCBM11	X	X
18389	Solution structure, dynamics and binding studies of CtCBM11	X	X
18390	Chemical Shift Assignment and Solution Structure of ChR145 from Drosophila melanogaster. Northeast Structural Genomics Consortium Target Fr822A	X	X
18392	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the C-terminal Domain of E. coli Enzyme I	X	X
18394	Solution structure of the uncharacterized thioredoxin-like protein BVU_1432 from Bacteroides vulgatus	X	X
18396	nanocrystalline DsbA 1H, 13C, 15N chemical shifts	X	X
18398	Solution Structure of the WNK1 Autoinhibitory Domain	X	X
18399	Solution structure of a ubiquitin-like protein from Trypanosoma brucei	X	X
18403	1H,13C and 15N resonance assignment of the UIM-SH3 construct of the STAM2 protein	X	X
18404	Solution Structure of the Target Recognition Domain of Zoocin A	X	X
18411	Solution structure of a putative protein disulfide isomerase from Bacteroides thetaiotaomicron	X	X
18412	High Definition Solution Structure of PED/PEA-15 Death Effector Domain	X	X
18413	Apo-AdcR	X	X
18414	Zn(II)-AdcR	X	X
18415	Solution structure of human C-type lectin domain family 4 member D	X	X
18416	1H,15N and 13C backbone and side chain chemical shifts of the ubiquitin homology domain of mouse BAG-1	X	X
18417	1H, 13C and 15N resonance assignments of human BASP1	X	X
18419	B2 domain of Neisseria meningitidis Pilus assembly protein PilQ	X	X
18421	Capsid protein from Equine Infectious Anemia Virus	X	X
18425	Resonance Assignments of Ca2+-bound human S100A11	X	X
18426	Solution-state NMR structure of the human prion protein	X	X
18427	Solution structure of 2'F-ANA and ANA self-complementary duplex	X		X
18428	N0N1 domains of Neisseria meningitidis Pilus assembly protein PilQ	X	X
18429	Solution NMR Structure of De Novo Designed Four Helix Bundle Protein, Northeast Structural Genomics Consortium (NESG) Target OR188	X	X
18431	Solution structure of the mouse Rev1 C-terminal domain	X	X
18433	Solution structure of the mouse Rev1 CTD in complex with the Rev1-interacting Region (RIR)of Pol Kappa	X	X
18434	C-terminal domain of human REV1 in complex with DNA-polymerase H (eta)	X	X
18435	Solution structure of the C-terminal domain of Tetrahymena telomerase protein p65	X	X
18437	Solution structure of gpFI C-terminal domain	X	X
18438	Solution NMR Structure of the Globular Domain of Human Histone H1x, Northeast Structural Genomics Consortium (NESG) Target HR7057A	X	X
18440	Analog of the fragment 197-221 of 1- adrenoreceptor	X	X
18442	Solution structure of the R. rickettsii cold shock-like protein	X	X
18443	Solution structure of a thioredoxin from Thermus thermophilus	X	X
18446	Sequence specific 1H, 13C and 15N resonance assignments of an intrinsically unstructured -Crystallin from Hahella chejuensis	X	X
18448	Chemical Shift Assignment of the NIPP1 FHA Domain	X	X
18449	Structure, sulfatide-binding properties, and inhibition of platelet aggregation by a Disabled-2-derived peptide	X	X
18452	Solution structure of a mini i-motif	X	X	X
18455	Structure of the C-terminal domain from human REV1	X	X
18458	1H, 13C, 15N Chemical shift assignment of HIRAN domain of human HLTF	X	X
18459	N0 domain of Neisseria meningitidis Pilus assembly protein PilQ	X	X
18462	Solution NMR structure of Kaiso zinc finger DNA binding domain in complex with Kaiso binding site DNA	X	X	X
18463	Eurocin solution structure	X	X
18464	The solution structure of Ca2+ binding domain 2B of the third isoform of the Na+/Ca2+ exchanger	X	X
18465	SOLUTION NMR STRUCTURE OF DE NOVO DESIGNED PROTEIN, ROSSMANN 3x1 FOLD, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET OR157	X	X
18466	Wild-type FAS1-4	X	X
18467	FAS1-4, R555W	X	X
18469	Solution NMR Structure of apo YdbC from Lactococcus lactis, Northeast Structural Genomics Consortium (NESG) Target KR150	X	X
18470	Cu(I) form gt CsoR	X	X
18471	Backbone 1H, 13C, and 15N Chemical Shift Assignments for PWWP domain from Trypanosoma brucei	X	X
18472	Apo form gt CsoR	X	X
18473	1H, 13C, and 15N resonance assignment of mouse lipocalin-type prostaglandin D synthase/substrate analog complex.	X	X
18474	the pwwp domain of TFIIS2-1 from Trypanosoma brucei	X	X
18475	The solution structure of Phage P2 gpX	X	X
18477	NMR dynamics in the C-terminal globular domain of oligosaccharyltransferase	X	X
18478	P75/LEDGF PWWP Domain	X	X
18479	HRas166*GDP backbone chemical shift assignments	X	X
18484	Conformational analysis of StrH, the surface-attached exo- -D-N-acetylglucosaminidase from Streptococcus pneumoniae.	X	X
18485	Solution structure of a monomeric truncated mutant of Trypanosoma brucei 1-C-Grx1	X	X
18487	Solution NMR Structure of NifU-like protein from Saccharomyces cerevisiae, Northeast Structural Genomics Consortium (NESG) Target YR313A	X	X
18489	Solution NMR Structure of NFU1 Iron-Sulfur Cluster Scaffold Homolog from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR2876B	X	X
18492	Solution structure of the SANT2 domain of the human nuclear receptor corepressor 2 (NCoR2), Northeast Structural Genomics Consortium (NESG) target ID HR4636E.	X	X
18494	Assignment of the -Helical Membrane Protein TM0026 from Thermotoga maritima.	X	X
18496	Solution NMR Structure of YdbC:dT19G1 complex. Northeast Structural Genomics Consortium (NESG) Target KR150	X	X	X
18497	Solution Structure of autoinhibitory domain of human AMP-activated protein kinase catalytic subunit	X	X
18498	YAP WW2 in complex with a Smad7 derived peptide.	X	X
18499	YAP WW1 in complex with a Smad7 derived peptide.	X	X
18500	Smurf1 WW2 domain in complex with a Smad7 derived peptide.	X	X
18501	NEDD4L WW2 domain in complex with a Smad7 derived peptide.	X	X
18502	Smurf2 WW3 domain in complex with a Smad7 derived peptide.	X	X
18503	NMR solution structure of the kappa-zeta region of S.cerevisiae group II intron ai5(gamma)	X			X
18504	pfsub2 solution NMR structure	X	X
18505	Backbone and side chain assignments of MHV N protein NTD (aa60-197)	X	X
18507	Solution NMR structure of the apo-form of the beta2 carbohydrate module of AMP-activated protein kinase	X	X
18508	Solution NMR structure of the beta2 carbohydrate module of AMP-activated protein kinase bound to glucosyl-cyclodextrin	X	X
18511	Solution NMR Structure of Ig like domain (1277-1357) of Obscurin-like protein 1 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR8578D	X	X
18513	RECOMBINANT TAMAPIN NMR solution structure.	X	X
18514	Solution structure of CXC domain of MSL2	X	X
18515	high resolution NMR solution structure of helix H1 of the human HAR1 RNA	X			X
18517	Solution structure of EDK-delta-Bd37 from Babesia divergens	X	X
18518	LC3B OPTN-LIR Ptot complex structure	X	X
18520	Chemical shift assignments of a S72-S107 peptide of 18.5kDa murine myelin basic protein (MBP) in association with dodecylphosphocholine micelles	X	X
18521	The NMR structure of the Vta1-Vps60 complex	X	X
18522	Chemical Shift Assignments for the PICK1 PDZ domain fused to the C10 DAT ligand	X	X
18524	Solution structure of a parallel-stranded oligoisoguanine DNA pentaplex formed by d(T(iG)4T) in the presence of Cs ions	X		X
18526	Solution NMR Structure of PH Domain of Tyrosine-protein kinase Tec from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR3504C	X	X
18529	1H, 13C and 15N resonance assignment for the human K-Ras at physiological pH	X	X
18531	Three-State Ensemble obtained from eNOEs of the Third Immunoglobulin Binding Domain of Protein G (GB3)	X	X
18533	NMR solution structure of apo-MptpA	X	X
18534	RDC REFINED SOLUTION STRUCTURE OF DOUBLE-STRANDED RNA BINDING DOMAIN OF S. CEREVISIAE RNASE III (RNT1P) IN COMPLEX WITH THE TERMINAL RNA HAIRPIN OF SNR47 PRECURSOR	X	X		X
18535	SOLUTION STRUCTURE OF DOUBLE-STRANDED RNA BINDING DOMAIN OF S.CEREVISIAE RNASE III (RNT1P)	X	X
18537	1H and 13C chemical shifts for collagelin	X	X
18538	1H and 13C NMR of GPVI mimetic	X	X
18542	Structure and Binding Interface of the Cytosolic Tails of aXb2 Integrin	X	X
18543	Chemical shift assignments of DsbA(C33S) by solid-state NMR	X	X
18544	Chemical shift assignments of DsbA(C33S)/DsbB by solid-state NMR	X	X
18545	Calcium saturated form of human C85M S100A1 mutant	X	X
18547	Solution NMR Structure of CalU16 from Micromonospora echinospora, Northeast Structural Genomics Consortium (NESG) Target MiR12	X	X
18548	1H, 13C, and 15N resonance assignments of the monomeric human Fam96a	X	X
18550	Solution-state NMR of prion protein mutant V210I at pH 7	X	X
18551	Solution NMR structure of C2H2-type Zinc-fingers 4 and 5 from human Insulinoma-associated protein 1 (fragment 424-497), Northeast Structural Genomics Consortium Target HR7614B.	X	X
18555	NMR solution structure of PA1075 from Pseudomonas Aeruginosa	X	X
18557	Solution structure of Ca2+-bound CaBP7 N-terminal doman	X	X
18558	Solution NMR Structure de novo designed rossmann 2x2 fold protein, Northeast Structural Genomics Consortium (NESG) Target OR16	X	X
18559	Solution NMR structure of the PHD domain of human MLL5. Northeast structural genomics consortium target HR6512A.	X	X
18560	NMR solution structure of the N-terminal domain of human USP28. Northeast structural genomics consortium target HT8470A	X	X
18561	Solution NMR Structure DE NOVO DESIGNED PFK fold PROTEIN, Northeast Structural Genomics Consortium (NESG) Target OR250	X	X
18562	Backbone and side-chain assignments of an effector membrane localization domain from Vibrio vulnificus MARTX toxin	X	X
18563	Solution NMR Structure of Ig like domain (805-892) of Obscurin-like protein 1 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR8578K	X	X
18565	Backbone and side-chain resonance assignments of the membrane localization domain from Pasteurella multocida toxin	X	X
18566	Telokin-like domain (TL-domain) from P22 coat protein	X	X
18567	Overexpression, purification and structural characterization of S114A mutant of UVI31+ from chlamydomonas reinhardtii	X	X
18568	ns4b40	X	X
18569	13C, 15N and 1H backbone and sidechain assignments of the ENA-VASP homology 1 (EVH1) domain of the human vasodilator-stimulated phosphoprotein (VASP)	X	X
18570	Solution structure of the zinc finger AFV1p06 protein from the hyperthermophilic archaeal virus AFV1	X	X
18571	Solution structure of apo-Phl p 7	X	X
18572	solution structure of hemi-Mg-bound Phl p 7	X	X
18573	Solution structure of Ca-bound Phl p 7	X	X
18574	1H,13C,15N resonance assignment of wild-type Lipase A from Bacillus subtilis	X	X
18575	1H, 13C and 15N resonance assignments of Bacillus subtilis Lipase A mutant evolved towards thermostability	X	X
18579	Methylated Histone Complex	X	X
18580	1H, 13C, and 15N backbone and side chain resonance assignments of the C-terminal DNA binding and dimerization domain of v-Myc	X	X
18587	MHV nsp3a	X	X
18588	Backbone 1H, 15N, 13C Assignments of the N-terminal Part of Tyrosine tRNA Synthase from Bacillus stearothermophilus	X	X
18589	NMR solution structure of Cbp2	X	X
18591	Solution NMR studies of the dimeric regulatory subunit IlvN of the E.coli Acetohydroxyacid synthase I (AHAS I)	X	X
18592	MRH domain of the Glucosidase II beta subunit from S. pombe	X	X
18595	Solid-state NMR 13C and 15N resonance assignments of a seven-transmembrane helical protein Anabaena Sensory Rhodopsin	X	X
18598	Backbone resonance assignments for AgrA LytTR domain	X	X
18599	Solution structure of CCP modules 11-12 of complement factor H	X	X
18600	S67	X	X
18602	Solution structure of the soluble domain of MmpS4 from Mycobacterium tuberculosis	X	X
18604	Solution structure of CCP modules 10-11 of complement factor H	X	X
18605	Solution NMR Structure of Human Transcription Elongation Factor A protein 2, Central Domain, Northeast Structural Genomics Consortium (NESG) Target HR8682B	X	X
18606	Solution structure of anti-CRISPR protein Acr30-35 from Pseudomonas aeruginosa Phage JBD30	X	X
18607	Solution structure of an avirulence protein AvrPzi-t from pathogen Magnaportheoryzae	X	X
18608	Backbone resonance assignment of ASC pyrin domain	X	X
18615	1H, 13C and 15N chemical shift assignments of human parvulin 17	X	X
18616	Relaxation rates for accurate spectral density mapping for unbiased analysis of nucleic acid motions probed by carbon-13 NMR relaxation	X			X
18617	Conformational ensemble for the G8A mutant of the influenza hemagglutinin fusion peptide	X	X
18620	NMR Chemical Shift Assignments of N terminal RRM domain of La protein	X	X
18621	NMR Chemical Shift Assignments of N terminal La motif domain of La protein	X	X
18622	Solution structure of second CARD of human RIG-I.	X	X
18623	Solution structure of mutant (T170E) second CARD of human RIG-I	X	X
18624	Structure of N-terminal domain of a plant Grx	X	X
18627	1H, 13C, and 15N Chemical Shift Assignments for Calcium free, Myristoylated Visinin-like protein 3	X	X
18630	Backbone Chemical Shifts for N-terminal domain of sulfhydryl oxidase ALR	X	X
18631	N-terminal of Sulfydryl Oxidase of ALR reduced	X	X
18634	Structural basis for the interaction of human -defensins 1 and 6 and its receptors CCR2 corresponding peptide and breast cancer cells	X	X
18635	Backbone resonance assignments of human beta-defensin 1	X	X
18638	Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion	X		X
18639	Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion	X		X
18640	Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion	X		X
18641	NMR solution structure of PawS derived peptide 11 (PDP-11)	X	X
18642	Protein structure	X	X
18643	NMR solution structure of PawS Derived Peptide 4 (PDP-4)	X	X
18644	NMR solution structure of PawS Derived Peptide 5 (PDP-5)	X	X
18645	NMR solution structure of PawS Derived Peptide 7 (PDP-7)	X	X
18648	APPTM V44M	X	X
18649	Transmembrane domain of Amyloid precursor protein WT	X	X
18650	NMR structure of RelA-TAD/CBP-TAZ1 complex	X	X
18651	13C and 15N chemical shifts for Shigella Flexneri MxiH Type three secretion system needle subunit	X	X
18652	Backbone assignment of Bt-Lon alpha sub-domain from Brevibacillus thermoruber	X	X
18654	NMR Structures of Single-chain Insulin	X	X
18655	Arced helix (ArcH) NMR structure of the reovirus p14 fusion-associated small transmembrane (FAST) protein transmembrane domain (TMD) in dodecyl phosphocholine (DPC) micelles	X	X
18657	1H,13C,15N assignments for an isoform of the type III antifreeze protein from notched-fin eelpout	X	X
18658	NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase	X	X
18659	NMR solution structure of peptide epsilon(103-120) from Mycobacterium tuberculosis F-ATPsynthase	X	X
18661	STRUCTURE OF LASSO PEPTIDE CAULOSEGNIN I	X	X
18667	Solution structure of eIF4E3 in complex with m7GDP	X	X
18668	Solution Structure of Escherichia coli Ferrous Iron transport protein A (FeoA)	X	X
18672	S4WYILD	X	X
18673	Solution NMR structure of a potential acylphosphatase from Giardia lamblia, Seattle Structural Genomics Center for Infectious Disease target GilaA.01396.a	X	X
18677	1H, 13C and 15N Assignments of the RING domain in ubiquitin ligase gp78	X	X
18678	NMR structure of the N-terminal RNA Binding domain 1 (RRM1) of the protein RBM10 from Homo sapiens	X	X
18679	Backbone 1H, 13C, and 15N Chemical Shift Assignments for cold shock protein, LmCsp with dT7	X	X
18680	Backbone 1H, 13C, and 15N Chemical Shift Assignments for cold shock protein, LmCsp	X	X
18681	LIP5(MIT)2	X	X
18682	LIP5-CHMP5	X	X
18685	Hydogen exchange rate of Adenylate kinase Leu58 amide proton, in complex with Ap5A	X	X
18688	Backbone amide chemical shifts of gp78 RING bound to Ube2g2:G2BR	X	X
18689	Backbone 1H, 13C, and 15N backbone resonance assignments of the TPR2A domain of mouse STI1	X	X
18691	Backbone 1H, 13C, and 15N backbone resonance assignments of the TPR1 domain of mouse STI1	X	X
18692	Solution structure of HP1264 from Helicobacter pylori	X	X
18693	1H, 13C, and 15N resonance assignments of mouse peptide ESP4	X	X
18694	Allosteric communication in the KIX domain proceeds through dynamic re-packing of the hydrophobic core	X	X
18695	Allosteric communication in the KIX domain proceeds through dynamic re-packing of the hydrophobic core	X	X
18696	1H, 13C and 15N resonance assignment of the N-terminal domain of human lysyl aminoacyl tRNA synthetase	X	X
18697	1H, 13C and 15N resonance assignment of the N-terminal domain of human lysyl aminoacyl tRNA synthetase complexed with anticodon stem-loop of tRNALys,3	X	X
18698	Solution NMR Structure of the eukaryotic RNA recognition motif, RRM1, from the heterogeneous nuclear ribonucleoprotein H from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR8614A	X	X
18701	Solution struture of cofilin like UNC-60B protein from Caenorhabditis elegans	X	X
18703	Backbone, sidechain and ligand chemical shift assignments for 2-mercaptophenol-alpha3C	X	X
18704	human Siglec5 Carbohydrate Recognition Domain Chemical Shifts	X	X
18705	Solution Structure of the Antimicrobial Peptide Human Defensin 5	X	X
18707	Solution structure of TamA POTRA domain I	X	X
18709	HMGB1-facilitated p53 DNA binding occurs via HMG-box/p53 transactivation domain interaction and is regulated by the acidic tail	X	X
18711	TBA	X	X
18714	Solution NMR Structure of Homeobox 2 Domain from Human ZHX1 repressor, Northeast Structural Genomics Consortium (NESG) Target HR7907F	X	X
18715	Structure of HIV-1 myr(-) matrix protein in complex with 1,2-dioctanoyl-sn-phosphatidylcholine	X	X
18716	Structure of HIV-1 myr(-) matrix protein in complex with 1,2-dioctanoyl-sn-phosphatidyl-L-serine	X	X
18717	Structure of C-terminal domain of Ska1	X	X
18718	Alpha4 Integrin Cytoplasmic Tail 1H and 15N Chemical Shift	X	X
18719	Beta2 Integrin Cytoplasmic Tail 1H and 15N Chemical Shift	X	X
18720	The solution structure of the Dm DCP1 EVH1 domain in complex with the XRN1 DBM peptide	X	X
18724	FUC_TBA	X		X
18725	Structure of Faap24 residues 141-215	X	X
18728	SOLUTION STRUCTURE	X	X
18729	S64	X	X
18730	Chemical shift assignment of West Nile Virus NS2B-NS3 protease in a complex with 4-phenyl-phenyl-KKR-aldehyde.	X	X
18732	NMR structure of the protein NP_390345.1 from Bacilus subtilis	X	X
18733	NMR structure of the protein NB7890A from Shewanella sp	X	X
18734	NMR structure of the hypothetical protein ZP_02034617.1 from Bacteroides capillosus ATCC 29799	X	X
18735	Solution NMR Structure of the DNA-Binding Domain of Human NF-E2-Related Factor 2, Northeast Structural Genomics Consortium (NESG) Target HR3520O	X	X
18736	Solution structure of a Novel Alpha-Conotoxin TxIB	X	X
18738	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the HEAT1 domain of the human translation initiation factor 4G, isoform I (eIF4GI-HEAT1)	X	X
18740	LMPG micelle-bound KSR1 CC-SAM	X	X
18749	Ligase 10C	X	X
18753	Structure of the biofilm matrix promoter AbbA from B. subtilis	X	X
18756	Backbone 15N, 1H, and CA Chemical Shift Assignments for WT IkappaBalpha (67-287)	X	X
18758	Refined solution structure and dynamics of First Catalytic Cysteine Half-domain from mouse E1 enzyme	X	X
18759	Backbone 15N, 1H, and CA Chemical Shift Assignments for C186P/A220P IkappaBalpha (67-287)	X	X
18760	Backbone 15N, 1H, and CA Chemical Shift Assignments for Y254L/T257A IkappaBalpha (67-287)	X	X
18762	NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing	X		X
18763	FGFR3tm	X	X
18765	Backbone and side-chain assignments of 1H, 15N and 13C chemical shifts of RNA recognition motif 1 (RRM1) of TAR DNA-binding protein (TDP-43)	X	X
18766	Spatial stucture of PI-AnmTX Ugr 9a-1	X	X
18767	Hug1: an intrinsically disordered protein involved in the DNA damage response.	X	X
18768	Structural study of NS2(2-32) GBVB protein	X	X
18769	Structural study of NS2(32-57) GBVB protein	X	X
18770	TatA T22P	X	X
18771	TatA oligomer	X	X
18772	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Staphylococcal Complement Inhibitor SCIN-A	X	X
18773	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Staphylococcal Complement Inhibitor SCIN-B	X	X
18774	Backbone 1H-13C-15N NMR assignments of yeast OMP synthase	X	X
18775	Backbone 1H-13C-15N NMR assignments of yeast OMP synthase in complex with orotidine 5 -monophosphate	X	X
18778	Solution structure of LIMD2	X	X
18779	Backbone resonance assignments of FrpD from Neisseria meningitidis	X	X
18780	DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link	X		X
18781	DNA duplex containing mispair-aligned O6G-heptylene-O6G interstrand cross-link	X		X
18783	SOLUTION NMR STRUCTURE OF ASTEROPSIN B FROM A MARINE SPONGE ASTEROPUS SP.	X	X
18784	SOLUTION NMR STRUCTURE OF ASTEROPSIN C FROM A MARINE SPONGE ASTEROPUS SP.	X	X
18785	Erbin PDZ Domain (Wild Type)	X	X
18786	Erbin PDZ Domain (S47 Designed Mutant)	X	X
18788	Solution structure of staphylococcal nuclease E43S mutant in the presence of ssDNA and Cd2+	X	X
18789	Solution structure of Kunitz-type neurotoxin LmKKT-1a from scorpion venom	X	X
18795	NMR assignments of Amylin in DMSO	X	X
18796	NMR structure of OmpX in phopspholipid nanodiscs	X	X
18797	NMR structure of OmpX in DPC micelles	X	X
18798	Backbone assignments of the apo and Zn(II) protoporphyrin IX-bound states of the soluble form of rat heme oxygenase-1	X	X
18799	Backbone assignments of the apo and Zn(II) protoporphyrin IX-bound states of the soluble form of rat heme oxygenase-1	X	X
18800	Backbone assignments of the apo and Zn(II) protoporphyrin IX-bound states of the soluble form of rat heme oxygenase-1	X	X
18801	The solution structure of NmPin, the parvuline of Nitrosopumilus maritimus	X	X
18802	Structure, phosphorylation and U2AF65 binding of the Nterminal domain of splicing factor 1 during 3 splice site recognition	X	X
18803	SR-linker peptide	X	X
18804	Homodimeric transmembrane domain of the human receptor tyrosine kinase ErbB1 (EGFR, HER1) in micelles	X	X
18805	Solution NMR Structure of Homeobox Domain of Human ALX4, Northeast Structural Genomics Consortium (NESG) Target HR4490C	X	X
18806	Solution Structure of Miz-1 zinc fingers 5 to 7	X	X
18807	Chemical shifts for the N-terminal head group of ceSAS-6	X	X
18808	Structure, phosphorylation and U2AF65 binding of the Nterminal domain of splicing factor 1 during 3 splice site recognition	X	X
18812	Solution structure of a DUF3349 annotated protein from Mycobacterium abscessus, MAB_3403c. Seattle Structural Genomics Center for Infectious Disease target Myab.17112.a	X	X
18813	The solution structure of human PHF1 in complex with H3K36me3	X	X
18814	13C and 15N NMR chemical shifts of E. coli full-length H-NS protein	X	X
18815	N-histidine-tagged EIAV-CA	X	X
18816	Solution structure of the tenth complement type repeat of human megalin	X	X
18817	Solution NMR analysis of intact KCNE2 in detergent micelles demonstrate a straight transmembrane helix	X	X
18818	Solution structure and dynamics of human S100A14	X	X
18819	1H, 13C and 15N assignments of the Apo-acyl carrier protein-3 of Pseudomonas aeruginosa.	X	X
18820	1H, 13C and 15N assignments of the Apo-acyl carrier protein-1 of Pseudomonas aeruginosa.	X	X
18821	1H, 13C and 15N assignments of Apo-acyl carrier protein of Pseudomonas aeruginosa.	X	X
18823	1H, 13C and 15N resonance assignments of the C-terminal domain of PpdD	X	X
18824	Structural characterization of the extended PDZ1 domain from NHERF1.	X	X
18825	Complex structure of C-terminal CFTR peptide and extended PDZ1 domain from NHERF1.	X	X
18826	Complex structure of C-terminal CFTR peptide and extended PDZ2 domain from NHERF1.	X	X
18827	Sequence-specific 1H,13C, and 15N resonance assignment of GATE-16	X	X
18828	NMR Assignment of Arabidopsis thaliana cytochrome c in its reduced state	X	X
18829	NMR restraints for the C-terminal RRM domain (RRM3) of TIA-1 protein.	X	X
18830	Solution structure of ALPS-23 peptide in SDS micelles	X	X
18832	Solution structure of the SH3 domain of DOCK180	X	X
18837	15N, 13C and 1H Resonance Assignments and Secondary Structure Determination of a Variable Heavy Chain Antibody	X	X
18838	Solution structure of the ID3 stem loop of domain 1 in the ai5gamma group II intron	X			X
18839	Chemical shift assignments of the monomeric canecystatin-1 from Saccharum officinarum	X	X
18840	The ZZ domain of cytoplasmic polyadenylation element binding protein 1 (CPEB1)	X	X
18841	E. coli O157 ParE2-associated antitoxin 2 (PaaA2)	X	X
18842	NMR structure of the complex between the PH domain of the Tfb1 subunit from TFIIH and Rad4	X	X
18844	ubiquitin-like domain-containing C-terminal domain phosphatase (UBLCP1)	X	X
18847	Structure of stacked G-quadruplex formed by human TERRA sequence in potassium solution	X			X
18851	HIV-1 Rev ARM peptide (residues T34-R50)	X	X
18852	HIV-1 Rev ARM peptide (residues T34-R50)	X	X
18853	Backbone and side-chain 1H, 13C, 15N NMR assignment of the N-terminal domain of Escherichia coli LpoA	X	X
18856	HADDOCK structure of GtYybT PAS Homodimer	X	X
18857	Backbone 1H, 13C,and 15N chemical shift assignments for alpha-synuclein at different pH and temperature	X	X
18858	Biosynthetic engineered B28K-B29P human insulin monomer structure in in water/acetonitrile solutions.	X	X
18859	Biosynthetic engineered B28K-B29P human insulin monomer structure in in water solutions.	X	X
18860	solid-state NMR assignment of a-synuclein fibrils	X	X
18861	NMR Structure of Antiamoebin I (peptaibol antibiotic) bound to DMPC/DHPC bicelles	X	X
18862	Parallel human telomeric quadruplex containing 2'F-ANA substitutions	X		X
18863	The Solution Structure of Monomeric Hepatitis C Virus p7 Yields Potent Inhibitors of Virion Release	X	X
18864	High resolution structure and dynamics of CsPinA parvulin at physiological temperature	X	X
18865	Ovine Doppel Signal peptide (1-30)	X	X
18870	Solution structure of the dimerization domain of Aux/IAA transcription factor Ps-IAA4 from pea (Pisum sativum)	X	X
18871	Solution structure of a chaperone in type III secretion system	X	X
18872	ID3 stem	X			X
18873	Chemical shift assignment for Lewisx with a (CH2)3NH2 spacer	X				X
18874	PHD domain of ING4 N214D mutant	X	X
18875	[Aba5,14]BTD-2	X	X
18877	1H,13C,15N chemical shift assignment of Ca2+_bound CaBP4	X	X
18881	NMR solution structure of the d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid	X		X	X
18882	TICAM-2 TIR domain	X	X
18883	TICAM-1 TIR domain structure	X	X
18885	S. cerevisiae proteasome regulatory particle ATPase Rpt6 C-terminal domain	X	X
18887	Solution structure of hypothetical protein lmo0427	X	X
18888	EGFR transmembrane - juxtamembrane (TM-JM) segment in bicelles: MD guided NMR refined structure.	X	X
18891	Solution structure of the Tetrahymena telomerase RNA stem IV terminal loop	X			X
18892	Solution structure of the helix II template boundary element from Tetrahymena telomerase RNA	X			X
18893	NMR solution structure of the d3'-hairpin of the group II intron Sc.ai5gamma including EBS1 bound to IBS1	X			X
18894	NMR solution structure of the d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5gamma	X			X
18895	Backbone and partial sidechain assignment of the microtubule binding domain of the MAP1B light chain	X	X
18896	NMR STRUCTURE OF A BI-FUNCTIONAL LYSOZYME-PROTEASE INHIBITOR FROM THE DEFENSE GLAND OF COPTOTERMES FORMOSANUS SHIRAKI SOLDIERS	X	X
18897	NMR structure of the glycosylated conotoxin CcTx from Conus consors	X	X			X
18899	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the bacterial toxin Doc	X	X
18901	NMR structure of the C-terminal domain of the protein HCFC1 from MUS MUSCULUS	X	X
18903	Relaxation study of Delta subunit of RNA polymerase from Bacillus subtilis	X	X
18904	NMR solution structure of the two domain PPIase SlpA from Escherichia coli	X	X
18905	NMR structure of the RRM2 domain of the protein RBM10 from homo sapiens	X	X
18906	1H, 13C and 15N resonance assignments of an N-terminal domain of CHD4	X	X
18907	Solution structure of Duplex DNA	X		X
18908	Human programmed cell death 1 receptor	X	X
18909	Solution NMR structure of the SANT domain of human DNAJC2; Notrheast structural genomics consortium target HR8254a	X	X
18913	[Aba3,16]BTD-2	X	X
18914	[Aba3,7,12,16]BTD-2	X	X
18917	Solution NMR structure of the N-terminal domain of STM1478 from Salmonella typhimurium LT2: Target STR147A of the Northeast Structural Genomics consortium (NESG), and APC101565 of the Midwest Center for Structural Genomics (MCSG).	X	X
18919	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Full-Length Rabbit Cytochrome b5	X	X
18921	Structure of [L-HisB24] insulin analogue at pH 1.9	X	X
18923	Structure of [L-HisB24] insulin analogue at pH 8.0	X	X
18924	Structure of [D-HisB24] insulin analogue at pH 1.9	X	X
18925	Structure of [D-HisB24] insulin analogue at pH 8.0	X	X
18927	Solution NMR assignments of V5 domain from Protein Kinase C alpha	X	X
18928	Solution NMR assignments of the phosphorylation-mimicking mutant of V5 domain from Protein Kinase C alpha	X	X
18929	Solution NMR assignments of V5 domain from Protein Kinase C alpha, in complex with DPC micelles	X	X
18930	Solution NMR assignments of the phosphorylation-mimicking mutant of V5 domain from Protein Kinase C alpha, in complex with DPC micelles	X	X
18931	[Aba5,7,12,14]BTD-2	X	X
18933	ASFV Pol X structure	X	X
18934	Binary complex of African Swine Fever Virus Pol X with MgdGTP	X	X
18935	African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNA	X	X	X
18937	[Aba3,5,7,12,14,16]BTD-2	X	X
18938	BTD-2[3,4]	X	X
18939	Solution Structure of C-terminal AbrB	X	X
18941	Backbone 1H, 13C, and 15N chemical shift assignments for the LFA-1 wild type I-domain	X	X
18942	alpha-1 integrin I-domain in complex with GLOGEN triple helical peptide	X	X
18944	NMR Structure of the homeodomain transcription factor Gbx1 from Homo sapiens	X	X
18947	SpnDE1	X	X
18948	STRUCTURE OF LASSO PEPTIDE ASTEXIN-1(19)	X	X
18950	THE SOLUTION STRUCTURE OF 3',5'-LINKED 2'-O-(2-METHOXYETHYL)-RNA DUPLEX	X			X
18951	NMR solution structure of a MYB-like DNA binding domain of KNL-2 from C. Elegans	X	X
18953	Solution Structure of gammaM7-Crystallin	X	X
18955	STRUCTURE OF NAB2P TANDEM ZINC FINGER 12	X	X
18956	STRUCTURE OF NAB2P TANDEM ZINC FINGER 34	X	X
18958	The Integrin L Transmembrane Domain in Bicelles: Structure and Interaction with Integrin 2	X	X
18959	NMR structure of Rsa1p238-259 from S. Cerevisiae	X	X
18963	1H, 13C, 15N chemical shift assignments of Dido PHD domain	X	X
18964	Characterization of a Novel Alpha4/6-Conotoxin TxIC from Conus textile that Potently Blocks alpha3beta4 Nicotinic Acetylcholine Receptors	X	X
18965	Solution Structure of Marine Sponge-Derived Asteropsin E Which is Highly Resistant to Gastrointestinal Proteases	X	X
18966	Global folded of the type IV pilin ComP from Neisseria meningitidis	X	X
18967	Solution structure of the C-terminal zinc-binding domain of HPV51 oncoprotein E6	X	X
18969	1H, 13C and 15N resonance assignments of S55A mutant of UVI31+ from Chlamydomonas reinhardtii	X	X
18976	CALMODULIN, I85L, F92E, H107I, L107I, A128T, M144R MUTANT	X	X
18977	Assignment of Tyrosine Phosphatase Related to Biofilm formation A (TpbA) from Pseudomonas Aeruginosa bound to phosphate	X	X
18980	NMR solution structure of HIV-1 nucleocapsid protein in complex with an inhibitor displaying a 2 inhibitors:1 NC stoichiometry	X	X
18986	1H, 13C, and 15N Chemical Shift Assignments for the C-terminus of the minichromosome maintenance protein MCM from Sulfolobus solfataricus	X	X
18987	Solution NMR structure of SACOL0876 from Staphylococcus aureus COL, NESG target ZR353 and CSGID target IDP00841	X	X
18988	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Pseudomonas Aeruginosa heme oxyengase apo and in presence of selected compounds	X	X
18989	Solution NMR structure of the Polyketide_cyc-like protein Cgl2372 from Corynebacterium glutamicum, Northeast Structural Genomics Consortium Target CgR160.	X	X
18990	protein structure	X	X
18991	Backbone resonance assignment of [2Fe-2S]-ferredoxin in its oxidized state	X	X
18992	Backbone resonance assignment of [2Fe-2S]-ferredoxin in its reduced state	X	X
18993	Backbone resonance assignment of Alt a 1, the major allergen of Alternaria alternata	X	X
18994	1H, 13C and 15N chemical shift assignments for the N-terminal domain of the KCNH channel from Zebrafish	X	X
18998	Allatide O4 conformation 2	X	X
18999	solution structure of allatide O4 in solution	X	X
19000	Solution NMR structure of VV2_0175 from Vibrio vulnificus, NESG target VnR1 and CSGID target IDP91333	X	X
19004	1H, 13C, and 15N backbone chemical shift assignments of the low-spin CN-bound yeast cytochrome c peroxidase with the C-terminal His-tag	X	X
19005	1H, 13C, and 15N backbone chemical shift assignments of the low-spin CN-bound yeast cytochrome c peroxidase with the N-terminal His-tag	X	X
19006	1H, 13C and 15N backbone and side chain resonance assignment of the phosphorelay protein VanU from Vibrio anguillarum	X	X
19007	Solution structure of Bacillus subtilis MinC N-terminal domain	X	X
19008	Chemical Shift Assignments for SinR from Bacillus subtilis	X	X
19010	1H, 15N and 13C backbone chemical shift assignment of the titin A59-A60 domain tandem	X	X
19011	1H, 15N and 13C backbone chemical shift assignment of the titin A60 domain	X	X
19013	Solution structure of the RRM domain of the hypothetical protein CAGL0M09691g from Candida glabrata	X	X
19014	Solution structure of the putative Ras interaction domain of AFD-1, isoform a from Caenorhabditis elegans	X	X
19017	Solution structure of an intramolecular propeller-type G-quadruplex containing a single bulge	X		X
19023	Solution structure and sigma factor interactions of Mycobacterium tuberculosis RNA polymerase binding protein A	X	X
19024	single G-bulge in a conserved regulatory region of the HEV genome	X			X
19025	Solid-state Chemical Shift Assignments for CAP-Gly Domain of Mammalian at 19.9 T	X	X
19027	Backbone 1H, 13C, and 15N Chemical Shift Assignments for rubredoxin type protein from Mycobacterium ulcerans	X	X
19028	Flexible anchoring of archaeal MBF1 on ribosomes suggests role as recruitment factor	X	X
19029	1H, 13C and 15N resonance assignments of K2A1: N-terminal repeat of the K2A domain of Plasmodium falciparum knob - associated histidine rich protein (KAHRP).	X	X
19031	Solid-state Chemical Shift Assignments for p150Glued CAP-Gly Domain in complex with EB1 at 19.9 T	X	X
19035	G-rich VEGF aptamer with LNA modifications	X		X
19037	1H, 13C, and 15N Chemical Shift Assignments of h-prune C-terminal domain	X	X
19039	NMR solution structure of domain 5 from Azotobacter vinelandii Intron 5 at pH 7.8	X			X
19040	structure of 2'-5' AG1 lariat forming ribozyme in its inactive state	X			X
19041	Spatial structure of dimeric VEGFR2 membrane domain in DPC micelles	X	X
19042	Complete 1H, 13C, and 15N Chemical Shift Assignments for Burkholderia pseudomallei Frataxin like protein	X	X
19043	Protein A binding by an engineered Affibody molecule	X	X
19044	Backbone and Side Chain 1H, 13C and 15N Chemical Shift Assignments for Domain 4 of Phosphomannomutase/Phosphoglucomutase from Pseudomonas aeruginosa	X	X
19046	Sequence-specific backbone 1H, 13C and 15N assignments of the 34 kDa catalytic domain of PTPN5	X	X
19047	Solution Structure of the Bacillus cereus Metallo-Beta-Lactamase BcII	X	X
19048	Solution Structure of the Bacillus cereus Metallo-Beta-Lactamase BcII in Complex with R-Thiomandelic Acid	X	X
19051	1H, 13C, 15N assignment of Voltage-gated calcium channel beta 4 subunit core domains	X	X
19052	NMR Structure of the Complete Internal Fusion Loop mutant L529A/I544A from Ebolavirus GP2 at pH 5.5	X	X
19056	1H, 13C, 15N backbone and side chain NMR resonance assignments of the N-terminal NEAr iron Transporter (NEAT 1) domain of the IsdB hemoglobin receptor of Staphylococcus aureus	X	X
19058	Atomic-resolution structure of a doublet cross-beta amyloid fibril	X	X
19060	Atomic-resolution structure of a triplet cross-beta amyloid fibril	X	X
19061	1H,13C and 15N resonance assignments of Ca2+ - bound human S100A15	X	X
19062	Atomic-resolution structure of a cross-beta protofilament	X	X
19063	TIAR RRM2 chemical shifts in the apo state	X	X
19064	TIAR RRM2 chemical shifts in bound to RNA 5'-UUAUUU-3'	X	X		X
19065	ADAPT-NMR automated assignments and manual assignments of RNaseA	X	X
19067	Solution structure of latherin	X	X
19068	Solution NMR Structure CTD domain of NFU1 Iron-Sulfur Cluster Scaffold Homolog from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR2876C	X	X
19069	1H,13C,15N Assignement of EFGP fluorescent protein	X	X
19072	Backbone 1H, 13C, and 15N Chemical Shift Assignment for inactive HIV-1 protease Bmut5	X	X
19074	1H, 13C, 15N chemical shift assignments of Dido PHD domain in complex with peptide H3K4me3	X	X
19075	1H, 13C, and 15N backbone chemical shift assignments of the iron-free protoporphyrin IX yeast cytochrome c peroxidase with the C-terminal His-tag	X	X
19076	1H, 13C, and 15N backbone chemical shift assignments of the resting-state yeast cytochrome c peroxidase with the N-terminal His-tag	X	X
19078	Human fibrillin1 EGF2-EGF3-hybrid1-cbEGF1	X	X
19080	Backbone assignment of an unlinked NS2B and NS3 protease complex of dengue virus 2	X	X
19081	NMR structure of the P4 hairpin of the CPEB3 ribozyme	X			X
19082	Backbone and ILV methyl resonance assignments of E. coli thymidylate synthase bound to cofactor and a nucleotide analogue	X	X
19083	Backbone 1H, 13C, and 15N; and VL 13CH3 Side-chain Chemical Shift Assignments for Mutant SENP1 C603S Catalytic Domain	X	X
19085	Novel method of protein purification for structural research. Example of ultra high resolution structure of SPI-2 inhibitor by X-ray and NMR spectroscopy.	X	X
19086	Solution structure of human ribosomal protein P1.P2 heterodimer	X	X
19087	The NMR chemical shift assignments for backbone 1H, 13C, and 15N of VirR (Rv0431)	X	X
19088	Backbone chemical shift assignment of Rv2140c, a phosphatidylethanolamine binding protein from Mycobacterium tuberculosis	X	X
19089	Backbone 1H, 15N Chemical Shift Assignments for wild-type Escherichia coli Adenylate Kinase with 20mM ADP at 293, 298, 303, and 313K	X	X
19090	Backbone 1H, 15N Chemical Shift Assignments for wild-type Escherichia coli Adenylate Kinase with 20mM ADP and Calcium at 298K	X	X
19091	Backbone 1H, 15N Chemical Shift Assignments for wild-type Escherichia coli Adenylate Kinase with 20mM ADP and Magnesium at 298K	X	X
19092	Backbone 1H, 15N Chemical Shift Assignments for R156K mutant Escherichia coli Adenylate Kinase with 20mM ADP at 293K	X	X
19093	Backbone 1H, 15N Chemical Shift Assignments for R156K mutant Escherichia coli Adenylate Kinase with 20mM ADP and magnesium at 293K	X	X
19094	Enterocin 7A	X	X
19095	Backbone and side-chain 1H, 13C and 15N resonance assignments of the OB domain of the single-stranded DNA binding protein from Sulfolobus Solfataricus	X	X
19098	Sidechain and backbone NMR resonance assignment for the RNA binding and C-terminal domain of the ribosome assembly factor Nop6 from S. cerevisiae	X	X
19099	1H, 13C and 15N chemical shifts of human beta-2-microglobulin in solution	X	X
19101	Enterocin 7B	X	X
19106	The protease-resistant N-terminal domain of TIR-domain containing adaptor molecule-1, TICAM-1	X	X
19108	NMR structure of human restriction factor APOBEC3A	X	X
19112	Structural characterization by NMR of a double phosphorylated chimeric peptide vaccine for treatment of Alzheimer's disease	X	X
19113	Chemical shifts of human beta-2 microglobulin bound to HLA-B2709 complexed with the nonamer peptide pVIPR (RRKWRRWHL)	X	X
19116	Chemical shifts of human beta-2 microglobulin bound to HLA-B2709 complexed with the nonamer peptide TIS (RRLPIFSRL)	X	X
19117	NMR solution structure ensemble of 3-4D mutant domain 11 IGF2R in complex with IGF2 (domain 11 structure only)	X	X
19118	Chemical shifts of human beta-2 microglobulin bound to HLA-B2709 complexed with the nonamer peptide pLMP2 (RRRWRRLTV)	X	X
19119	Chemical shifts of human beta-2 microglobulin bound to HLA-B2709 complexed with the nonamer peptide pGR (RRRWHRWRL)	X	X
19120	Chemical shifts of human beta-2 microglobulin bound to HLA-B2705 complexed with the nonamer peptide pVIPR (RRKWRRWHL)	X	X
19121	Chemical shifts of human beta-2 microglobulin bound to HLA-B2705 complexed with the nonamer peptide TIS (RRLPIFSRL)	X	X
19122	Chemical shifts of human beta-2 microglobulin bound to HLA-B2705 complexed with the nonamer peptide pLMP2 (RRRWRRLTV)	X	X
19123	Chemical shifts of human beta-2 microglobulin bound to HLA-B2705 complexed with the nonamer peptide pGR (RRRWHRWRL)	X	X
19124	NMR spatial structure of the antimicrobial peptide Tk-Amp-X2	X	X
19126	Structure of full-length transmembrane domains of human glycine receptor 1 monomer subunit	X	X
19127	The Dynamics of Lysozyme from Bacteriophage Lambda in Solution probed by NMR and MD simulations	X	X
19128	cIn936W	X	X
19129	NMR SOLUTION STRUCTURE OF trans (MAJOR) FORM OF In936	X	X
19130	NMR SOLUTION STRUCTURE OF cis (MINOR) FORM OF In936 in Methanol	X	X
19131	SOLUTION NMR STRUCTURE OF trans (MAJOR) FORM OF In937 in Methanol	X	X
19132	SOLUTION STRUCTURE OF cis(C2-P3) trans (D5-P6) FORM OF lO959 IN WATER	X	X
19133	SOLUTION STRUCTURE OF trans(C2-P3) trans (D5-P6) of LO959 IN METHANOL	X	X
19135	Efficient Protocol for Assignment of Large, Intrinsically Disordered Proteins. 49.2kDa MAP2c, a case study	X	X
19137	ERGi Backbone Chemical Shifts	X	X
19138	ERG DNA Complex	X	X	X
19139	Backbone chemical shift assignments of the talin rod domain, R7 (residues 1357-1653 (delta1454-1586))	X	X
19142	Structure of a vertebrate toxin from the badge huntsman spider	X	X
19143	Solution structure of the Escherichia coli apo ferric enterobactin binding protein	X	X
19144	A structural model of CAP mutant (T127L and S128I) in the apo state	X	X
19145	A STRUCTURAL MODEL OF CAP MUTANT (T127L AND S128I) IN CGMP- BOUND STATE	X	X
19146	Solution structure of RING domain of E3 ubiquitin ligase Doa10	X	X
19147	ZINC Binding Domain	X	X
19153	NMR solution structure ensemble of 3-4D mutant domain 11 IGF2R	X	X
19154	Sungsanpin	X	X
19155	NMR Structure of CbpAN from Streptococcus pneumoniae	X	X
19156	1H, 13C, and 15N NMR Assignments of a Hedgehog Autoprocessing Domain	X	X
19163	The solution structure of the J-domain of human DnaJA1	X	X
19165	Backbone and side chain chemical shift assignments of bacterial acid-stress chaperone HdeA at pH 6	X	X
19167	Structural determination of the Citrus sinensis Poly(A)-Binding Protein CsPABP1	X	X
19168	Solution structure of the a C-terminal domain of translation initiation factor IF-3 from Campylobacter jejuni	X	X
19169	Solution structure of uncharacterized thioredoxin-like protein PG_2175 from Porphyromonas gingivalis	X	X
19170	solution structure of the calmodulin-binding domain of plant calcium-ATPase ACA8	X	X
19171	transcriptional repressor domain of methylated DNA binding domain protein 1	X	X
19172	PTPN11 C-SH2 domain free form	X	X
19173	PTPN11 C-SH2 domain bound form	X	X
19175	[Asp2]RTD-1	X	X
19176	[Asp11]RTD-1	X	X
19177	[Asp2,11]RTD-1	X	X
19178	Enteropathogenic Escherichia coli 0111:H- str. 11128 ORF EC0111_1119 similar to bacteriophage lambda ea8.5	X	X
19179	ORF PP_3909 from Pseudomonas putida KT2440 encoding a protein similar to bacteriophage lambda ea8.5	X	X
19180	Trp-cage Circular Permutant	X	X
19182	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the catalytic domain of human Aprataxin	X	X
19183	Trp-cage 16b P12W: a Hyperstable Miniprotein	X	X
19184	solution structure of the calmodulin-binding domain of plant calcium-ATPase ACA2	X	X
19185	Structure of the Type IVa Major Pilin from the Electrically Conductive Bacterial Nanowires of Geobacter sulfurreducens	X	X
19186	Chemical shift assignments of a S72-S107 peptide of 18.5kDa murine myelin basic protein (MBP)	X	X
19187	1H, 13C, and 15N Chemical Shift Assignments for the C-terminus of the minichromosome maintenance protein MCM from Methanothermobacter thermautotrophicus	X	X
19193	NMR solution structure of N-terminal domain of (Y81F)-EhCaBP1	X	X
19196	N-terminal domain of (Y81F)-EhCaBP1 structure	X	X
19197	C-terminal structure of (Y81F)-EhCaBP1	X	X
19198	NMR Structure of the protein NP_346341.1 from Streptococcus pneumoniae	X	X
19200	RXFP1 utilises hydrophobic moieties on a signalling surface of the LDLa module to mediate receptor activation	X	X
19201	TAX1BP1 UBZ1+2	X	X
19202	NMDA RECEPTOR ANTAGONIST, CONANTOKIN BK-B, NMR, 20 STRUCTURE	X	X
19203	NMR structure of RNA recognition motif 2 (RRM2) of Homo sapiens splicing factor, arginine/serine-rich 1	X	X
19204	Backbone 1H, 13C, and 15N Chemical Shift Assignments for BAF155 SWIRM	X	X
19205	Solution NMR Structure of Engineered Cystine Knot Protein 2.5D	X	X
19206	1H, 13C and 15N backbone and side-chain resonance assignments of a family 36 carbohydrate binding module of Xylanase from Paenibacillus campinasensis	X	X
19208	Backbone resonance assignments of the 42 kDa enzyme arginine kinase in the transition state analogue form	X	X
19213	Blue Light-Absorbing State of TePixJ, an Active Cyanobacteriochrome Domain	X	X
19214	Green Light-Absorbing State of TePixJ, an Active Cyanobacteriochrome Domain	X	X
19215	Independently verified structure of gp41-M-MAT, a membrane associated MPER trimer from HIV-1 gp41	X	X
19218	Solution structure of yeast dithiol glutaredoxin Grx8	X	X
19219	1H, 13C, and 15N Chemical Shift Assignments for a proteasome related subunit	X	X
19220	solution structure of a proteasome related subunit N terminal domain	X	X
19221	solution structure of a proteasome related subunit C terminal domain	X	X
19223	Sequence specific backbone assignment of the catalytic domain of protein phosphatase 1B (PTP1B) in the ligand-free state	X	X
19224	Sequence specific backbone assignment of protein phosphatase 1B (PTP1B) residues 1-393	X	X
19225	Solution structure of the carbohydrate binding module of the muscle glycogen-targeting subunit of Protein Phosphatase-1	X	X
19226	Structure of 2'F-RNA/2'F-ANA chimeric duplex	X				X
19231	Structural Basis of DNA Recognition by the Effector Domain of Klebsiella pneumoniae PmrA	X	X
19235	Solution structure of the Aha1 dimer from Colwellia psychrerythraea	X	X
19238	Backbone 1H, 13C, 15N resonance assignments of calcium-bound calmodulin in complex with PSD95 N-terminal peptide	X	X
19239	2C TCR	X	X
19240	Human FKBP12-Major Form	X	X
19241	Human FKBP12-Minor Form	X	X
19242	The solution NMR structure of E. coli apo-HisJ	X	X
19243	Backbone chemical shifts of isolated Domain 1 from E. coli HisJ	X	X
19244	Backbone chemical shifts of isolated Domain 2 from E. coli HisJ	X	X
19245	Backbone chemical shifts from E. coli HisJ complexed with Histidine	X	X
19246	1H, 13C and 15N resonance assignments of human GAP-43	X	X
19249	NMR structure of the PAI subdomain of Sleeping Beauty transposase	X	X
19251	Structure, function, and tethering of DNA-binding domains in 54 transcriptional activators	X	X
19253	Backbone and Cbeta assignments for tau K18 in free and SDS micelle-bound states	X	X
19257	1H, 13C, and 15N chemical shift assignments for alpha-synuclein in living E. coli cells	X	X
19258	Pin1 WW domain	X	X
19260	A pyrimidine motif triple helix in the Kluyveromyces lactis telomerase RNA pseudoknot is essential for function in vivo	X			X
19262	NMR assignment and structure of a peptide derived from the membrane proximal external region of HIV-1 gp41 in the presence of hexafluoroisopropanol	X	X
19263	NMR assignment and structure of a peptide derived from the membrane proximal external region of HIV-1 gp41 in DPC	X	X
19266	Pre-Fusion Solution NMR Structure of Neuronal SNARE Syntaxin 1A	X	X
19268	SOLUTION NMR STRUCTURE OF THE V209M VARIANT OF THE HUMAN PRION PROTEIN (RESIDUES 90-231)	X	X
19269	1H and 13C chemical shift assignment of the N-terminal intrinsically disordered domain of the oncoportein E7 from the Human Papilloma Virus	X	X
19271	Backbone 1H, 13C, and 15N Chemical Shift Assignments for CRABPI	X	X
19275	Solution Structure and Activity Study of Bovicin HJ50, a Particular Type AII Lantibiotic	X	X
19276	Structure of d[CGCGAAGCATTCGCG] hairpin	X		X
19277	Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid	X		X
19278	Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid	X		X
19279	Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid	X		X
19280	Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid	X		X
19281	Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid	X		X
19282	NMR structure of the lymphocyte receptor NKR-P1A	X	X
19283	Solution NMR structure of the RXFP2 LDLa module	X	X
19284	Relaxation data of the delta subunit of RNA polymerase from Bacillus subtilis	X	X
19285	Optimized Ratiometric Calcium Sensors For Functional In Vivo Imaging of Neurons and T-Lymphocytes	X	X
19286	NMR Structure of BeF3 Activated Sma0114	X	X
19287	Solution structure of a chymotrypsin inhibitor from the Taiwan cobra	X	X
19288	Solution NMR Structure of E3 ubiquitin-protein ligase ZFP91 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR7784A	X	X
19291	NMR solution structure of Pin1 WW domain mutant 5-1	X	X
19292	NMR solution structure of Pin1 WW domain mutant 5-1g	X	X
19293	Solution structure of calcium-bound human S100A12	X	X
19294	DNA-binding domain of T. brucei telomeric protein tbTRF	X	X
19295	NMR solution structure of Pin1 WW domain variant 6-1	X	X
19296	NMR solution structure of Pin1 WW domain mutant 6-1g	X	X
19299	Analysis of target DNA binding sites through NMR structural analysis of the MLV IN CTD and homology modeling of the CCD domains.	X	X
19301	Redox-linked domain movements in the catalytic cycle of cytochrome P450 reductase	X	X
19302	Solution Structure of ERCC4 domain of human FAAP24	X	X
19303	Solution Structure of (HhH)2 domain of human FAAP24	X	X
19304	Solution structure of kalata B7	X	X
19305	NMR structure of an inhibitor bound dengue NS3 protease	X	X
19306	NMR structure of an inhibitor bound dengue NS3 protease	X	X
19307	Magnesium bound form of UVI31+ from C. reinhardtii	X	X
19308	Biochemical effect of S-67 phosphorylation on UVI31+ from C. reinhardtii	X	X
19311	Chemical shifts and structural restraints for Saccharomyces cerevisiae Est3 protein	X	X
19312	Solution NMR Structure of Transcription Factor GATA-4 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR4783B	X	X
19314	Solution NMR Structure of Microtubule-associated serine/threonine-protein kinase 1 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR9151A	X	X
19315	Solution Structure of the Catalytic Domain of HHARI	X	X
19317	Solution structure of HRDC1 domain of RecQ helicase from Deinococcus radiodurans	X	X
19318	Chemical shifts of the CPAP-interacting epitope of Danio rerio STIL	X	X
19319	Solution structure of RasGRP2 EF hands bound to calcium	X	X
19320	1H, 13C and 15N NMR assignments of RNA recognition motif of human Taf15	X	X
19321	1H,15N,13C resonance assignments of cerato populin, a fungal PAMP from Ceratocystis populicola	X	X
19322	LTBP1 cbEGF14-TB3-EGF3	X	X
19323	Human FKBP12.6-Major Form	X	X
19324	Human FKBP12.6-Minor Form	X	X
19325	1H, 13C, and 15N Chemical Shift Assignments for a proteasome related subunit	X	X
19327	Solution NMR Structure of yahO protein from Salmonella typhimurium, Northeast Structural Genomics Consortium (NESG) Target StR106	X	X
19328	Solution NMR structure of PHD type Zinc finger domain of Lysine-specific demethylase 5B (PLU-1/JARID1B) from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR7375C	X	X
19329	Solution NMR Structure of the RING finger domain from the Kip1 ubiquitination-promoting E3 complex protein 1 (KPC1/RNF123) from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR8700A	X	X
19330	Sequence Specific Backbone 1H, 15N and 13C assignments of the MAPK binding domain of DUSP 16	X	X
19331	Solution NMR Structure of Zinc finger protein Eos from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR7992A	X	X
19332	Backbone 1H, 13C, and 15N Chemical Shift Assignments for p15(PAF)	X	X
19334	NMR structure of Temporin-1 Ta in lipopolysaccharide micelles: Mechanistic insight into inactivation by outer memebrane	X	X
19337	alpha synuclein in PBS	X	X
19338	alpha synuclein mutant A53T in PBS	X	X
19339	Backbone assignment of the R8 domain of talin.	X	X
19344	alpha synuclein mutant S87N in PBS - human/mouse chimera	X	X
19345	alpha synuclein mutant A53T & S87N in PBS - human/mouse chimera	X	X
19346	mouse alpha synuclein	X	X
19347	mouse alpha synuclein T53A mutant- mouse/human chimera	X	X
19348	mouse alpha synuclein N87S mutant- mouse/human chimera	X	X
19349	mouse alpha synuclein T53A & N87S mutant- mouse/human chimera	X	X
19350	Acetylated alpha synuclein in PBS	X	X
19351	Acetylated alpha synuclein A53T familiar mutant in PBS	X	X
19353	Structure of alpha-synuclein in complex with an engineered binding protein	X	X
19355	Lassomycin	X	X
19357	Backbone 1H, 13C, 15N chemical shift assignments for the Met66 prodomain region of BDNF	X	X
19358	Backbone 1H, 13C, 15N chemical shift assignments for the Val66 prodomain region of BDNF	X	X
19361	The Apo-structure of the Low Molecular Weight Protein-tyrosine Phosphatase A (MptpA) from Mycobacterium tuberculosis Allows for Better Target-specific Drug Development	X	X
19362	Solution Structure of the STIM1 CC1-CC2 homodimer.	X	X
19363	Solution structure of the STIM1 CC1-CC2 homodimer in complex with two Orai1 C-terminal domains.	X	X
19366	NMR structure of region 2 of E. coli sigmaE	X	X
19368	Structure of Pex14 in complex with Pex5 LVxEF motif	X	X
19369	calbindin D9k(P47M+C80) Apo form	X	X
19370	calbindin D9k(P47M+C80) calcium bound form	X	X
19371	calbindin D9k(P47M+C80) Magnesium bound form	X	X
19372	Solution structure of Ani s 5 Anisakis simplex allergen	X	X
19374	Solution structure of alpha-amylase inhibitor wrightide R1 (wR1) peptide from Wrightia religiosa	X	X
19376	Calmodulin, C-terminal domain, M144H mutant	X	X
19377	1H, 15N, 13C Backbone and 13Cbeta Chemical Shift Assignment of mouse Interleukin-10	X	X
19379	NMR structures of the alpha7 nAChR transmembrane domain.	X	X
19380	NMR structure of the RNA polymerase alpha subunit C-terminal domain from Helicobacter pylori	X	X
19381	Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes	X		X
19383	NMR Structure of the Complete Internal Fusion Loop mutant I544A from Ebolavirus GP2 at pH 5.5	X	X
19384	mu-PIIIA-1	X	X
19385	mu-PIIIA-2	X	X
19386	parallel-stranded G-quadruplex in DNA poly-G stretches	X		X
19388	The Apo-structure of the Low Molecular Weight Protein-tyrosine Phosphatase A (MptpA) from Mycobacterium tuberculosis Allows for Better Target-specific Drug Development	X	X
19389	Solution structure of a stacked dimeric G-quadruplex formed by a segment of the human CEB1 minisatellite	X		X
19391	Solution structure of MBD3 methylcytosine binding domain while bound to hydroxymethylated DNA	X	X	X
19392	Human Bcl10 CARD	X	X
19393	Solid-state NMR sequential assignment of Osaka-Mutant Amyloid-beta (A 1-40 E22 ) fibrils	X	X
19394	Solution Structure of the human Polymerase iota UBM1-Ubiquitin Complex	X	X
19396	Lasiocepsin	X	X
19398	Solution structure of the forkhead domain of Brugia malayi DAF-16a	X	X
19399	NMR structure of EKLF(22-40)/Ubiquitin Complex	X	X
19402	Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution)	X		X
19404	Solution NMR Structure of DE NOVO DESIGNED Top7 Fold Protein Top7m13, Northeast Structural Genomics Consortium (NESG) Target OR33	X	X
19407	Conformation and dynamics of the periplasmic membrane-protein chaperone complexes OmpX Skp and tOmpA Skp	X	X
19408	Conformation and dynamics of the periplasmic membrane-protein chaperone complexes OmpX Skp and tOmpA Skp	X	X
19409	Conformation and dynamics of the periplasmic membrane-protein chaperone complexes OmpX Skp and tOmpA Skp	X	X
19410	Conformation and dynamics of the periplasmic membrane-protein chaperone complexes OmpX Skp and tOmpA Skp	X	X
19411	Conformation and dynamics of the periplasmic membrane-protein chaperone complexes OmpX Skp and tOmpA Skp	X	X
19413	KpDsbA	X	X
19414	PaDsbA	X	X
19415	LMO4-LIM2 in complex with DEAF-1 (404-418)	X	X
19416	NMR Structure of Rrp7 C-terminal Domain	X	X
19417	NMR solution structure of oxidised PaDsbA	X	X
19418	Backbone chemical shifts of the PICK1 PDZ domain with the GluA2 C-terminal	X	X
19424	Backbone chemical shift assignments of delta exon 3 mouse RyR2 domain A	X	X
19425	X-ray crystallography-solution NMR hybrid structure of mouse RyR2 domain A.	X	X
19426	1H, 13C, and 15N Chemical Shift Assignments for a peptide encompassing the first 61 residues of the Kv1.4 channel	X	X
19427	The solution structure of the C-terminal domain of BldD from Streptomyces coelicolor	X	X
19430	Structure of Salmonella MgtR	X	X
19432	Cat r 1	X	X
19433	NMR structure of the protein YP_002937094.1 from Eubacterium rectale	X	X
19435	Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence	X		X
19436	Backbone 1H, 13C, and 15N Chemical Shift Assignments for murine norovirus NS1/2 D94E mutant	X	X
19438	tgam	X	X
19439	Backbone 1H, 13C, and 15N Chemical Shift Assignments for murine norovirus NS1/2 CW3 WT	X	X
19442	Backbone 1H, 13C, and 15N Chemical Shift Assignments for E7 protein from human Papillomavirus 16	X	X
19443	1H, 13C and 15N Backbone Assignment of the EC-1 Domain of Human E-Cadherin	X	X
19444	Backbone 1H, 13C, and 15N Chemical Shift Assignments for murine norovirus CR6 NS1/2 protein	X	X
19446	Single-stranded DNA binding protein from E. coli (SSB)	X	X
19448	Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence	X		X
19449	NMR structure of a BolA-like hypothetical protein RP812 from RICKETTSIA PROWAZEKII, SEATTLE STRUCTURAL GENOMICS CENTER FOR INFECTIOUS DISEASE (SSGCID)	X	X
19451	Chemical Shift Assignment of the PNUTS PP1 Binding Domain	X	X
19452	Solution NMR structure of a putative thioredoxin (ECH_0218) in the reduced state from Ehrlichia chaffeensis, the etiological agent responsible for human monocytic ehrlichiosis. Seattle Structural Genomics Center for Infectious Disease target EhchA.00546.a	X	X
19453	NMR structure of the protein ZP_02042476.1 from Ruminococcus gnavus	X	X
19458	CR1-2-3	X	X
19459	CR1~1-2	X	X
19461	HlyII-C major cis form	X	X
19462	HlyII-C minor trans form	X	X
19463	p87m-BMRB	X	X
19464	NMR structure of the HicA toxin from Burkholderia pseudomallei	X	X
19466	PICK1 PDZ with 10 C-terminal ASIC1a residues	X	X
19468	Fragment based approach and binding behavior of LFampinB with Lipopolysaccharide:biophysical aspects	X	X
19469	Fragment based approach and binding behavior of LFampinB with Lipopolysaccharide: biophysical aspects	X	X
19470	Fragment based approach and binding behavior of LFampinB with Lipopolysaccharide:biophysical aspects	X	X
19471	Fragment based approach and binding behavior of LFampinB with Lipopolysaccharide: biophysical aspects	X	X
19472	1H, 13C, and 15N Chemical Shift Assignments for Sp140 PHD finger trans conformer	X	X
19473	1H, 13C, and 15N Chemical Shift Assignments for Sp140 PHD finger cis conformer	X	X
19474	Structure of uninhibited ETV6 ETS domain	X	X
19477	Backbone 1H and 15N Chemical Shift Assignments for P130 Cas substrate domain	X	X
19478	Backbone assignments for TNRC6B motif I (599-683)	X	X
19479	Solution Structure of an Active Site Mutant Pepitdyl Carrier Protein	X	X
19482	The Solution Structure of the Regulatory Domain of Tyrosine Hydroxylase	X	X
19483	Solution structure of the WW domain of HYPB	X	X
19484	NMR structure of a two-transmembrane segment TM VI-VII of NHE1	X	X
19485	Chemical Shift Assignments for SVIP (small VCP/p97-interacting protein)	X	X
19486	Solution NMR Structure of Zinc finger protein 423 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR7298F	X	X
19487	Solution structure of the PP2WW mutant (KPP2WW) of HYPB	X	X
19488	Solution structure of WW domain with polyproline stretch (PP2WW) of HYPB	X	X
19490	Human cytosolic dNT-1 nucleotidase	X	X
19491	1H, 13C, 15N chemical shift assignments of full-length apo human Galectin-3 (2-250).	X	X
19494	HuR RRM3 WT	X	X
19498	gp1.2	X	X
19499	HuR RRM3 W261E mutant	X	X
19500	HuR RRM3 S318D mutant	X	X
19502	Protein structure	X	X
19503	Circular Permutant of the WW Domain with Loop 1 Excised	X	X
19504	baa38	X	X
19505	WW Domain Strand-Swapped Dimer	X	X
19508	Solution structure of the human wild type FAPP1-PH domain	X	X
19510	NMR structure of the Paracoccus denitrificans Z-subunit determined in the presence of ADP	X	X
19511	NMR Structure of the homeodomain transcription factor Gbx1 from Homo sapiens solved in the presence of the DNA sequence CGACTAATTAGTCG	X	X	X
19512	HIV-1 gp41 clade B double alanine mutant Membrane Proximal External Region peptide in DPC micelle	X	X
19513	HIV-1 gp41 clade C Membrane Proximal External Region peptide in DPC micelle	X	X
19514	HIV-1 gp41 clade C Membrane Proximal External Region peptide in DPC micelle	X	X
19515	HIV-1 gp41 clade C Membrane Proximal External Region peptide in DPC micelle	X	X
19516	Solution NMR structure of Dot1L in complex with AF9 (Dot1L-AF9).	X	X
19519	NMR solution structure of the GS-TAMAPIN MUTATION R6A.	X	X
19524	NMR solution structure of the GS-TAMAPIN MUTATION R7A.	X	X
19527	NMR solution structure of the GS-TAMAPIN MUTATION R13A.	X	X
19528	NMR solution structure of the DOUBLE GS-TAMAPIN MUTATION R6A R7A.	X	X
19530	Resonance assignment of RQC domain of human Bloom syndrome protein	X	X
19531	NMR spatial structure of the trimeric mutant TM domain of VEGFR2 receptor.	X	X
19532	NMR spatial structure of mutant dimeric TM domain of VEGFR2 receptor	X	X
19533	Solution Structure of NusE (S10) from Thermotoga maritima	X	X
19534	Structural basis of the non-coding RNA RsmZ acting as protein sponge: Conformer L of RsmZ(1-72)/RsmE(dimer) 1to3 complex	X	X		X
19538	SOLUTION STRUCTURE OF THE IMS DOMAIN OF THE MITOCHONDRIAL IMPORT PROTEIN TIM21 FROM S. CEREVISIAE	X	X
19540	haddock model of MyT1 F4F5 - DNA complex	X	X	X
19541	Structure of the Nucleoplasmin-like N-terminal domain of Drosophila FKBP39	X	X
19544	Csr/Rsm protein-RNA recognition - A molecular affinity ruler: RsmZ(SL1)/RsmE(dimer) 2:1 complex	X	X		X
19545	The Solution Structure of a cGCUUAg RNA Pentaloop from Bovine Enterovirus Vir404/03	X			X
19546	Csr/Rsm protein-RNA recognition - A molecular affinity ruler: RsmZ(SL2)/RsmE(dimer) 2:1 complex	X	X		X
19547	Csr/Rsm protein-RNA recognition - A molecular affinity ruler: RsmZ(SL3)/RsmE(dimer) 2:1 complex	X	X		X
19548	Csr/Rsm protein-RNA recognition - A molecular affinity ruler: RsmZ(SL4)/RsmE(dimer) 2:1 complex	X	X		X
19549	Csr/Rsm protein-RNA recognition - A molecular affinity ruler: RsmZ(36-44)/RsmE(dimer) 2:1 complex	X	X		X
19550	Domain 1 of E. coli ribosomal protein S1	X	X
19551	1H, 13C, and 15N Chemical Shift Assignments for human FK506 binding Protein 25	X	X
19552	Solution structure of Blo t 19, a minor dust mite allergen from Blomia tropicalis.	X	X
19553	NMR solution structure of chitin-binding domain from dust mite group XII allergen Blo t 12.	X	X
19554	Domain 2 of E. coli ribosomal protein S1	X	X
19555	Solution structure of the C-terminally encoded peptide of the plant parasitic nematode Meloidogyne hapla - CEP11	X	X
19556	Solution structure of the C-terminally encoded peptide of the model plant host Medicago truncatula - CEP1	X	X
19557	Solution structure of the circular g-domain analog from the wheat metallothionein Ec-1	X	X
19558	Backbone and stereospecific Methyl Ile(d1), Leu and Val chemical shift assignment of Crc	X	X
19559	Backbone resonance assignments of Bcl-2/xL	X	X
19560	N-terminal and Middle domains of human Hsp90alpha	X	X
19561	1H, 13C and 15N backbone NMR assignments of human Taf15-RRM-RanBP	X	X
19563	chemical shift assignments for human dihdyrofolate reductase bound to folate	X	X
19564	chemical shift assignments and 3Jcgn & 3Jcgc' scalar couplings for human dihdyrofolate reductase bound to THF	X	X
19565	chemical shift assignments and 3Jcgn & 3Jcgc' scalar couplings for human dihdyrofolate reductase bound to NADP+ and THF	X	X
19566	chemical shift assignments and 3Jcgn & 3Jcgc' scalar couplings for human dihdyrofolate reductase bound to NADPH	X	X
19567	chemical shift assignments and 3Jcgn & 3Jcgc' scalar couplings for human dihdyrofolate reductase bound to NADP+ and folate	X	X
19568	assignment of the transmembrane domain of insulin receptor in detergent micelles	X	X
19571	Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions.	X		X
19572	Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions.	X		X
19573	STRUCTURE OF LASSO PEPTIDE XANTHOMONIN II	X	X
19575	HIV-1 capsid protein in tubular assemblies	X	X
19580	PAP262-270 in SDS micelles	X	X
19581	NMR assignment and structure of a peptide derived from the trans-membrane region of HIV-1 gp41 in the presence of hexafluoroisopropanol	X	X
19582	NMR assignment and structure of a peptide derived from the membrane proximal external region of HIV-1 gp41 in the presence of hexafluoroisopropanol	X	X
19583	NMR assignment and structure of a peptide derived from the membrane proximal external region of HIV-1 gp41 in the presence of dodecylphosphocholine micelles	X	X
19584	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Dvl-2 DEP domain	X	X
19585	Solution structure of a computational designed dimer based on the engrailed homeodomain structure	X	X
19586	Solution Structure of Calmodulin bound to the target peptide of Endothelial Nitrogen Oxide Synthase phosphorylated at Thr495	X	X
19590	Aliphatic 13C Chemical Shift Assignments For the Unfolded State of the Fyn SH3 Domain G48A Mutant	X	X
19591	Aliphatic 13C Chemical Shift Assignments For the Intermediate State of the FF Domain L24A Mutant	X	X
19594	Solution structure of a G-quadruplex bound to the bisquinolinium compound Phen-DC3	X		X
19595	NMR solution structure of oxytocin	X	X
19596	C-terminal disordered region of the pancreatic duodenal homeobox protein 1	X	X
19598	1H, 13C, and 15N Chemical Shift Assignments for human EPRS WHEP domains	X	X
19599	Human EPRS R12 Repeats	X	X
19601	Solution structure of CXCL5	X	X
19604	1H, 13C, and 15N chemical shift assignments for the complex of calmodulin with minimal binding domain from HIV-1 matrix protein	X	X
19606	Solution Structure of the UBA Domain of Human NBR1	X	X
19608	Solution structure of the mitochondrial translocator protein (TSPO) in complex with its high-affinity ligand PK11195	X	X
19609	Solution Structure of Protein-RNA Ternary Complex	X	X		X
19611	Enzymatic cyclisation of kalata B1 using sortase A	X	X
19613	Structural insights into the DNA recognition and protein interaction domains reveal fundamental homologous DNA pairing properties of HOP2	X	X
19614	The basic-helix-loop-helix region of the transcriptional repressor HES-1 is preorganized to bind DNA	X	X
19616	Ligand-dependent dynamics of the active-site lid in bacterial dimethylarginine dimethylaminohydrolase	X	X
19617	Solution structure of the Big domain from Leptospira interrogans	X	X
19618	1H, 15N and 13C resonance assignment of a transport protein	X	X
19620	Solution structure of DNA duplex containing N3T-ethylene-N1I interstrand cross-link	X		X
19621	1H, 13C and 15N chemical shift assignments for the cyclic-nucleotide binding homology domain of the KCNH channel from Zebrafish	X	X
19622	Solution structure of oxidized [2Fe-2S] ferredoxin PetF from Chlamydomonas reinhardtii	X	X
19623	GA-79-MBP cs-rosetta structures	X	X
19625	TNPX	X	X
19626	1H,13C and 15N assignment of Rsa1p(317-352)/Hit1p((70-164)	X	X
19627	NMR strucutre of the hypothetical protein BACUNI_03114 from Bacteroides uniformis ATCC 8492	X	X
19628	NMR structure of the protein NP_419126.1 from CAULOBACTER CRESCENTUS	X	X
19632	NMR structure of protein NP_254181.1 from Pseudomonas aeruginosa PA01	X	X
19634	Solution structure of the CR4/5 domain of medaka telomerase RNA	X			X
19638	Solution structure of cytochrome c Y67H	X	X
19641	3rCWP7D, variant of Imunoglobulin light-chain of lambda 3	X	X
19642	NMR structure of the first RRM domain of the protein RBM39 from homo sapiens	X	X
19654	NMR Structure of human Mcl-1	X	X
19657	Solution Structure of Penicillium Antifungal Protein PAF	X	X
19658	The solution NMR structure of maximin-4 in SDS micelles	X	X
19660	Structure determination of the salamander courtship pheromone Plethodontid Modulating Factor	X	X
19662	NMR structure of the I-V kissing-loop interaction of the Neurospora VS ribozyme	X			X
19663	Somatostatin-14 solution structure in 5% D-mannitol	X	X
19664	Structure of EcDsbA-sulfonamide complex	X	X
19667	Solution structure of the carboxyterminal domain of NusG from Mycobacterium tuberculosis	X	X
19668	NMR structure and chemical shift assignments for a3Y	X	X
19669	Backbone 1H, 15N, and 13C resonance assignments of the N-terminal carbohydrate-binding domain of beta-glucan recognition protein 2 from Manduca sexta	X	X
19670	Solution structure of lysine-free (K0) ubiquitin	X	X
19672	NMR Characterization of the Near Native and Unfolded States of the PTB Domain of Dok1: Alternate Conformations and Residual Clusters	X	X
19674	Solution structure of the CLAVATA encoded peptide of Arabidopsis thaliana - AtCLE10	X	X
19675	Solution structure of the CLAVATA encoded peptide of Arabidopsis thaliana - AtCLE44	X	X
19677	Solution structure of the CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE4	X	X
19678	Solution structure of the CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE5	X	X
19679	Solution structure of the CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE6/7	X	X
19681	NMR structure of E. coli LpoB	X	X
19682	Solution NMR Structure of PHD Type 1 Zinc Finger Domain 1 of Lysine-specific Demethylase Lid from Drosophila melanogaster, Northeast Structural Genomics Consortium (NESG) Target FR824J	X	X
19683	NMR structure of the S-linked glycopeptide sublancin 168	X	X
19684	Solution NMR Structure of SH3 Domain 1 of Rho GTPase-activating Protein 10 from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target: HR9129A	X	X
19685	RRM3 intermediate state	X	X
19687	immune signalling subunit	X	X
19688	1H, 15N and 13C resonance assignments of the yeast Pih1 and Tah1 C-terminal domains complex	X	X
19689	Resonance assignments of a phytocystatin from Sesamum indicum L.	X	X
19692	NMR Localization of Divalent Cations at the Active Site of the Neurospora VS Ribozyme Provides Insights Into RNA-Metal Ion Interactions	X			X
19693	Solution structure of oxidized dimeric form of human defensin 5	X	X
19694	Structure of FHL2 LIM adaptor and its Interaction with Ski	X	X
19695	NMR studies of N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA: Impact of adduct stereochemistry, size, and local DNA structure on solution conformations	X		X
19696	Nuclear magnetic resonance studies of N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA: Impact of adduct stereochemistry, size, and local DNA structure on solution conformations	X		X
19697	Tv1	X	X
19698	Solution NMR structure of a preQ1 Class II riboswitch from Streptococcus pneumoniae	X			X
19700	Spatial structure of P33A mutant of non-conventional toxin WTX from Naja kaouthia	X	X
19702	Structure of the dimerization domain of the human polyoma, JC virus agnoprotein is an amphipathic alpha-helix.	X	X
19703	Backbone 1H, 13C, and 15N Chemical Shift Assignments and structure of Iron-sulfur cluster binding protein from Ehrlichia chaffeensis	X	X
19707	Solution structure of the extracellular sensor domain of DraK histidine kinase	X	X
19708	Voltage Sensor Domain of human KCNQ1 (VSD-Q1)	X	X
19709	Solution NMR structure of beta-adaptin appendage domain of human adaptor protein complex 4 subunit beta, Northeast Structural Genomics Consortium (NESG) Target HR8998C	X	X
19710	Solution structure of CDYL2 chromodomain	X	X
19711	Backbone and side chain 1H, 13C, and 15N chemical Shift assignments for native split Npu DnaE intein	X	X
19712	Designed Exendin-4 analogues	X	X
19713	Solution Structure of Domain-Swapped GLPG	X	X
19714	Transport protein A	X	X
19715	13C, 15N and 1H backbone and sidechain chemical shift assignment of receiver domain of ethylene receptor ETR1	X	X
19718	Yah1 reduced	X	X
19719	Resonance assignments of the PHIST domain of P. falciparum protein PFI1780w	X	X
19720	NMR backbone assignment of WT apo-HasAp from Pseudomonas aeruginosa	X	X
19721	NMR backbone assignment of Y75A apo-HasAp from Pseudomonas aeruginosa	X	X
19722	NMR backbone assignment of H83A apo-HasAp from Pseudomonas aeruginosa	X	X
19723	Backbone 1H, 13C, and 15N Chemical Shift Assignments of the Cytoplasmic Tail of Ig-alpha (CD79a) in a Heterodimeric Construct	X	X
19724	Backbone 1H, 13C, and 15N Chemical Shift Assignments of the Cytoplasmic Tail of Ig-beta (CD79b) in a Heterodimeric Construct	X	X
19725	Backbone 1H and 15N Chemical Shift Assignments of a Double Y to E Mutant of the Cytoplasmic Tail of Ig-alpha (CD79a) in a Heterodimeric Construct	X	X
19726	Protein-RNA structure	X	X		X
19727	HIFABP_Ketorolac_complex	X	X
19730	Structural Mapping of a Chaperone Substrate Interaction Surface	X	X
19731	Solution structure of peptidyl-tRNA hyrolase from Vibrio cholerae	X	X
19732	The solution NMR structure of the NLRC5 caspase recruitment domain (CARD)	X	X
19733	Structural Mapping of a Chaperone Substrate Interaction Surface	X	X
19735	Structure, dynamics and RNA binding of the multi-domain splicing factor TIA-1	X	X
19736	1H, 13C, and 15N Chemical Shift Assignments of a the mature form of Trypanosoma brucei 1-C-Grx1	X	X
19737	Solution structure of a C terminal fragment of the neuronal isoform of the polypyrimidine tract binding protein (nPTB)	X	X
19739	Structural Insights into Calcium Bound S100P - V Domain of the receptor for advanced glycation end products (RAGE) Complex	X	X
19741	NMR structure of p75 transmembrane domain C257A mutant in DPC micelles	X	X
19742	Ligand-dependent dynamics of the active-site lid in bacterial dimethylarginine dimethylaminohydrolase	X	X
19743	Ligand-dependent dynamics of the active-site lid in bacterial dimethylarginine dimethylaminohydrolase	X	X
19744	Ligand-dependent dynamics of the active-site lid in bacterial dimethylarginine dimethylaminohydrolase	X	X
19745	Solution NMR structure of a mismatch DNA	X		X
19746	Solution structure of synthetic Mamba-1 peptide	X	X
19748	Solution structure of Lactodifucotetraose (LDFT) beta anomer	X				X
19749	Solution NMR structure of N-terminal domain (SH2 domain) of human Inositol polyphosphate phosphatase-like protein 1 (INPPL1) (fragment 20-117), Northeast Structural Genomics Consortium Target HR9134A.	X	X
19750	Solution NMR structure of gp41 ectodomain monomer on a DPC micelle	X	X
19752	Solution structure of a protein domain	X	X
19753	Solution NMR Structure plectin repeat domain 6 (4403-4606) of Plectin from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR6354E	X	X
19755	Structure determination of substrate binding domain of MecA	X	X
19757	1H, 15N and 13C resonance assignments of the two TPR domains of the human RPAP3 protein	X	X
19758	1H, 15N and 13C resonance assignments of the two TPR domains of the human RPAP3 protein	X	X
19760	PlpA plays a central role in lipid homeostasis in Gram-negative bacterial outer membranes	X	X
19765	gbvb5	X	X
19768	Resonance assignment and secondary structure determination of full length human Dickkopf 4 (hDkk4), a secreted, disulphide-rich Wnt inhibitor protein	X	X
19771	Solution structure of CPEB1 ZZ domain in the free state	X	X
19773	Backbone chemical shifts for the E81 deletion mutant from RAP80 tandem UIMs	X	X
19774	Backbone chemical shifts for the tandem UIMs of wild-type RAP80.	X	X
19779	Solution structure of the SGTA N-terminal domain	X	X
19782	Chemical shifts assignments of the RodA hydrophobin from the opportunistic pathogen Aspergillus fumigatus	X	X
19783	Solution structure of the fourth constant immunoglobulin domain of nurse shark IgNAR	X	X
19787	Human FKBP51-FK506 binding domain 1	X	X
19788	Human FKBP52-FK506 binding domain 1	X	X
19789	N domain of cardiac troponin C bound to the switch fragment of fast skeletal troponin I at pH 6	X	X
19791	Structural Characterization of a Complex Between the Acidic Transactivation Domain of EBNA2 and the Tfb1/p62 subunit of TFIIH.	X	X
19792	NMR structure of the RRM domain of RBMX from homo sapiens	X	X
19797	STRUCTURE OF THE NA,K-ATPASE REGULATORY PROTEIN FXYD2b IN MICELLES	X	X
19798	Solution Structure of 6aJL2-R24G Amyloidogenic Light Chain Protein	X	X
19799	Solution structure of LysM the peptidoglycan binding domain of autolysin AtlA from Enterococcus faecalis	X	X
19801	solution structure of a protein C-terminal domain	X	X
19803	NMR resonance assignment of the N-terminal polypeptide of the Anthrax Lethal Factor	X	X
19806	NMR structure of hypothetical protein ZP_02064002.1 from Bacteroides ovatus ATCC 8483	X	X
19807	NMR structure of hypothetical protein ZP_02069618.1 from Bacteroides uniformis ATCC 8492.	X	X
19808	Ginsentides: Characterization, Structure and Application of a New Class of Highly Stable Cystine Knot Peptides in Ginseng	X	X
19809	Solution structure of YSCUCN in a micellar complex with SDS	X	X
19810	Solution structure of BmKTX-D19K	X	X
19815	NMR Assignment of Coiled Coil Domain of Myosin Binding Subunit of Myosin Light Chain Phosphatase	X	X
19816	NMR structure of the C-domain of troponin C bound to the anchoring region of troponin I	X	X
19817	NMR structure of the dilated cardiomyopathy mutation G159D in troponin C bound to the anchoring region of troponin I	X	X
19818	Murine Neuroglobin, Fe3+ form (metNgB)	X	X
19819	Murine Neuroglobin, Fe3+ form, liganded to cyanide (cyanometNgB)	X	X
19821	Stf76 from the Sulfolobus islandicus plasmid-virus pSSVx	X	X
19822	NMR structure of B25-(alpha, beta)-dehydro-phenylalanine insulin	X	X
19823	Structure of Lasso Peptide Caulonodin V	X	X
19824	Solution structure of a TrkAIg2 domain construct for use in drug discovery	X	X
19834	New Cyt-like delta-endotoxins from Dickeya dadantii - CytC protein	X	X
19835	NMR structure of E. coli Trigger Factor in complex with unfolded PhoA220-310	X	X
19836	NMR structure of E. coli Trigger Factor in complex with unfolded PhoA1-150	X	X
19837	NMR structure of E. coli Trigger Factor in complex with unfolded PhoA365-471	X	X
19838	H, N, Calpha and Cbeta assignments of oxidized Escherichia coli DsbA at pH 6.8	X	X
19839	H, N, Calpha and Cbeta assignments of reduced Escherichia coli DsbA at pH 6.8	X	X
19840	ToxB	X	X
19841	Solution Structures of active Ptr ToxB and its Inactive Ortholog	X	X
19842	Backbone and sidechain 1H, 13C, and 15N chemical shift assignments for the HEAT2 domain of human eIF4G	X	X
19843	Solution NMR structure of the ternary complex of human ileal bile acid-binding protein with glycocholate and glycochenodeoxycholate	X	X
19845	Structure of a Conserved Golgi Complex-targeting Signal in Coronavirus Envelope Proteins	X	X
19846	solution structure of alpha-amylase inhibitor peptide aS4 from Allatide scholaris	X	X
19847	solution structure of alpha amylase inhibitor peptide aS1 from Allatide scholaris	X	X
19849	Solution structure of reduced BolA2 from Arabidopsis thaliana	X	X
19850	NMR-based docking model of GrxS14-BolA2 apo-heterodimer from Arabidopsis thaliana	X	X
19851	NMR structure of the protein YP_001712342.1 from Acinetobacter baumannii	X	X
19853	AFB1 FAPY modified AGA duplex	X		X
19859	Solution structure of the mature form, GK cecropin-like peptide from Ae. aegypti mosquito	X	X
19860	Solution structure of a ribosomal protein	X	X
19861	AFB1 FAPY modified AGT duplex	X		X
19862	E isomer of AFB1 FAPY modified AGC duplex	X		X
19863	AFB1 FAPY modified AG(7-deaza)G duplex	X		X
19864	H, N, Halpha, Calpha and Cbeta assignments of R1 peptide at pH 5 and 313 K	X	X
19865	LASSO PEPTIDE BASED INTEGRIN INHIBITOR: MICROCIN J25 VARIANT WITH RGDF SUBSTITUTION OF GLY12-ILE13-GLY14-THR15	X	X
19869	ZapA mutant dimer from B. stearothermophilus	X	X
19870	Solution Structure of 6aJL2 Amyloidogenic Light Chain Protein	X	X
19876	3D structure of YmoB. A modulator of biofilm formation.	X	X
19881	transport protein m	X	X
19884	Yeast cytochrome c peroxidase assignment	X	X
19885	Backbone 1H, 13C, and 15N; and VL 13CH3 Side-chain Chemical Shift Assignments for SENP1 Catalytic Domain	X	X
19887	oligonucleotide model of miR-21 pre-element	X			X
19893	Chemical Shift Assignments and structure of Q4D059, a hypothetical protein from Trypanosoma cruzi	X	X
19901	1H, 13C, and 15N Chemical Shift Assignments for Thymosin alpha 1	X	X
19902	Solution NMR structure of the reovirus p15 fusion-associated small transmembrane (FAST) protein fusion-inducing lipid packing sensor (FLiPS) motif in dodecyl phosphocholine (DPC) micelles	X	X
19904	Solution structure of the PPIase domain of TbPar42	X	X
19905	Phosphorylated 4E-BP2	X	X
19907	NMR resonance assignment of the archaeal ribosomal protein L7Ae	X	X
19908	NMR resonance assignment of the archaeal ribosomal protein L7Ae bound to a 25 nt RNA	X	X		X
19910	Solution structure of the P22S mutant of N-terminal CS domain of human Shq1	X	X
19915	Backbone 1H, 13C, and 15N Chemical Shift Assignments for cold shock protein, TaCsp	X	X
19916	Backbone 1H, 13C, and 15N Chemical Shift Assignments for cold shock protein, TaCsp with dT7	X	X
19921	hIFABP-oleate complex	X	X
19922	Backbone 1H, 13C, and 15N Chemical Shift Assignments of human TDP-43 RRM2	X	X
19930	Human p38 alpha ILVM methyl resonance assignments in non-phosphorylated apo state	X	X
19931	DC-SIGN	X	X
19934	Dual-phospholyrated apo Human p38 alpha ILVM methyl resonance assignments	X	X
19935	Dual-phosphorylated human p38 alpha ILVM methyl resonance assignments in ADP-bound state	X	X
19936	Dual-phosphorylated human p38 alpha ILVM methyl resonance assignments in substrate-peptide-bound state	X	X
19937	Dual-phosphorylated human p38 alpha ILVM methyl resonance assignments in ADP and substrate-peptide-bound state	X	X
19938	Solution NMR structure of a putative thioredoxin (ECH_0218) in the oxidized state from Ehrlichia chaffeensis, the etiological agent responsible for human monocytic ehrlichiosis. Seattle Structural Genomics Center for Infectious Disease target EhchA.00546.a	X	X
19940	Chemical shifts and structural constraints of outer membrane protein A	X	X
19941	Structural insights of TM domain of LAMP-2A in DPC micelles	X	X
19942	Solution structure of the terminal Ig-like domain from Leptospira interrogans LigB	X	X
19943	3D NMR structure of the cytoplasmic rhodanese domain of the inner membrane protein YgaP from Escherichia coli	X	X
19946	3D NMR structure of the cytoplasmic rhodanese domain of the full-length inner membrane protein YgaP from Escherichia coli	X	X
19947	Structure of Bitistatin_A	X	X
19948	The proline-rich region of 18.5-kDa myelin basic protein requires long-range interactions with residues upstream to interact with the SH3-domain of Fyn	X	X
19949	The proline-rich region of 18.5-kDa myelin basic protein requires long-range interactions with residues upstream to interact with the SH3-domain of Fyn	X	X
19953	Receptor for Advanced Glycation End Products (RAGE) Specifically Recognizes Methylglyoxal Derived AGEs.	X	X
19955	solution structure of tandem SH3 domain of Sorbin and SH3 domain-containing protein 1	X	X
19960	Solution structure of the human chemokine CCL19	X	X
19962	Truncated L126Z-sod1 in DPC micelle	X	X
19963	Structure of Bitistatin_B	X	X
19970	NMR structure of NKR-5-3B	X	X
19972	The proline-rich region of 18.5-kDa myelin basic protein requires long-range interactions with residues upstream to interact with the SH3-domain of Fyn	X	X
19973	Solution structure of an potent antifungal peptide Cm-p5 derived from C. muricatus	X	X
19974	NMR structure of BA42 protein from the psychrophilic bacteria Bizionia argentinensis sp. nov.	X	X
19976	1H, 13C and 15N backbone resonance assignments for beta-lactamase BlaP with proline-glycine inserted at position 197	X	X
19978	Solution structure of the [AibB8,LysB28,ProB29]-insulin analogue	X	X
19980	NMR resonance assignments of the catalytic domain of human serine/threonine phosphatase calcineurin in unligated state	X	X
19981	NMR resonance assignments of the catalytic domain of human serine/threonine phosphatase calcineurin in VIVIT-bound state	X	X
19982	NPM-N (Nucleophosmin) pentamer assignment	X	X
19986	NMR structure of Xenopus RecQ4 zinc knuckle	X	X
19989	Structural Basis of Receptor Sulfotyrosine Recognition by a CC Chemokine: the N-terminal Region of CCR3 Bound to CCL11/Eotaxin-1	X	X
19990	ShK toxin at pH 5.4 and 7.0	X	X
19993	Lysyl t-RNA synthetase 1-72	X	X
19994	3D NMR structure of the transmembrane domain of the full-length inner membrane protein YgaP from Escherichia coli	X	X
19995	LysRS Anticodon Binding Domian 72-207	X	X
19996	Backbone chemical shifts of the murine ROQUIN-1 ROQ domain in complex with Tnf CDE 23mer RNA	X	X		X
19999	1H, 15N, 13C resonance assignment of human osteopontin	X	X
20009	NMR STRUCTURE OF THE MUTANT OF CHIGNOLIN, CLN025	X	X
20010	Superimposed fifteen structures of 17-residue peptide corresponding to the segment within ice nucleation protein of X. campestris pv. campestris	X	X
20011	NMR STRUCTURE OF THE MUTANT OF CHIGNOLIN, CLN025	X	X
20014	STRUCTURE OF ANTIBACTERIAL PEPTIDE CAPISTRUIN: A 19-RESIDUE LARIAT PROTOKNOT WITH A THREADED 9-MEMBER SIDECHAIN TO-BACKBONE RING	X	X
20022	1H Chemical Shift Assignments for metastin analog, s5a	X	X
20024	NMR solution structure of mu-conotoxin TIIIA	X	X
20025	NMR solution structure of mu-conotoxin SIIIA	X	X
20026	Mutagenesis and nuclear magnetic resonance analyses of the fusion peptide of Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus F protein	X	X
20027	Brome Mosaic Virus protein 1a Helix A bound to SDS micelle	X	X
20029	13C and 1H atom assignments and structure for Apelin 17 (Human form) at 35C	X	X
20030	13C, 1H chemical shifts and structure of apelin 17(human form, major conformation) at 5C	X	X
20031	13C, 1H chemical shifts and structure of Apelin 17 (Human form, minor conformation at 5C)	X	X
20033	Solution structure of dicarba-ImI: an alpha-conotoxin with a non-reducible cystine analogue	X	X
20034	Solution NMR Structure of 4F Associated With DMPC Disc	X	X
20036	Cyclic Pseudotetrapeptide L-Phe-L-Trp-L-Lys-L-Thr	X	X
20037	Cyclic Pseudotetrapeptide D-Phe-L-Trp-L-Lys-L-Thr	X	X
20038	Cyclic Pseudotetrapeptide L-Phe-D-Trp-L-Lys-L-Thr	X	X
20039	Cyclic Pseudotetrapeptide L-Phe-L-Trp-D-Lys-L-Thr	X	X
20040	Cyclic Pseudotetrapeptide D-Phe-D-Trp-D-Lys-L-Thr	X	X
20041	Cyclic Pseudotetrapeptide L-Phe-D-Trp-D-Lys-L-Thr	X	X
20042	Cyclic Pseudotetrapeptide L-Phe-L-Trp-D-Lys-D-Thr	X	X
20043	Cyclic Pseudotetrapeptide L-Phe-D-Trp-L-Lys-D-Thr	X	X
20044	NMR structure of the Interleukin-8 C-terminal domain in solution with SDS micelles	X	X
20047	INTERACTION OF THE DENGUE VIRUS FUSION PEPTIDE WITH MEMBRANES ASSESSED BY NMR: THE ESSENTIAL ROLE OF THE ENVELOPE PROTEIN TRP101 FOR MEMBRANE FUSION	X	X
20050	NMR STRUCTURE OF DPAKKR, A CYCLIC PENTAPEPTIDE MIMIC OF BDNF	X	X
20054	Tetramer of KIA7W peptide	X	X
20055	Tetramer of KIA7H peptide	X	X
20056	LSEAL penta-peptide Calpain inhibitor	X	X
20057	NMR structure of designed peptide, YI12WF in the presence of Lipopolysaccharide	X	X
20058	Solution structure of designed peptide, YI12WW in the presence of Lipopolysaccharide	X	X
20059	Solution structure of designed peptide, YI12WY in the presence of LPS bilayer	X	X
20060	Solution structure of designed peptide, YI12FF in the presence of LPS bilayer	X	X
20061	Solution structure of designed peptide GG8WF in the presence of LPS bilayer	X	X
20062	3D NMR models of MBP83-99 peptide in DMSO	X	X
20063	NMR STRUCTURE OF A MODEL PEPTIDE BOUND TO GROEL	X	X
20075	Solution structure of the N(1-21)MeuTXK-beta in presence of TFE	X	X
20076	NMR Solution Structure of a TC5b_D9E miniprotein	X	X
20078	Solution Structure of Antimicrobial Peptide Hedistin	X	X
20079	NMR solution structure of the loopregion Tyr67 - Leu77 of visual arrestin in complex with lightactivated rhodopsin	X	X
20080	Structure and interactions in membranes of human and bovine Catestatin by solution and solid-state NMR spectroscopy	X	X
20081	solution structures of bradykinin - penta-O-galloyl-D-glucopyranose complexe	X	X
20085	Solution structure of SFT-L1	X	X
20086	Helical Agonist of Nociceptin (NOP) Receptor	X	X
20087	Novel Helix-Constrained Nociceptin Derivatives Are Potent Agonists and Antagonists of ERK Phosphorylation and Thermal Analgesia in Mice	X	X
20088	Novel Helix-Constrained Nociceptin Derivatives Are Potent Agonists and Antagonists of ERK Phosphorylation and Thermal Analgesia in Mice	X	X
20089	Novel Helix-Constrained Nociceptin Derivatives Are Potent Agonists and Antagonists of ERK Phosphorylation and Thermal Analgesia in Mice	X	X
20090	KAAAD, single alpha helix turn	X	X
20091	RSV_1nal	X	X
20092	To be advised	X	X
20093	REV_HIV peptides	X	X
20094	Effects of Peptoid Residue Substitutions on Structural Flexibility and Bacterial-Cell Selectivity of Piscidin 1	X	X
20095	Effects of Peptoid Residue Substitutions on Structural Flexibility and Bacterial-Cell Selectivity of Piscidin 1	X	X
20098	Effects of Peptoid Residue Substitutions on Structural Flexibility and Bacterial-Cell Selectivity of Piscidin 1	X	X
20101	Lipid-induced Conformation of Substance P	X	X
20102	C-Terminal helix of the SERCA2b Ca2+ pump (ATP2A2B)	X	X
20104	structural studies of antimicrobial peptide XT-7 and its Lysine mutated peptide	X	X
20109	CHARACTERIZATION OF THE LIGAND-FREE CONSTITUTIVE ACTIVITY OF THE THROMBOXANE A2 RECEPTOR BY THE INTEGRATED APPROACHES OF NMR SPECTROSCOPY AND A RECOMBINANT RECEPTOR	X	X
20112	CHARACTERIZATION OF THE LIGAND-FREE CONSTITUTIVE ACTIVITY OF THE THROMBOXANE A2 RECEPTOR BY THE INTEGRATED APPROACHES OF NMR SPECTROSCOPY AND A RECOMBINANT RECEPTOR	X	X
20113	1H, 13C assignments and NMR structure of temporin-SHf	X	X
20115	Substance P 40 structures in water pH 5.5 298 K NMR DATA & STRUCTURES	X	X
20116	Substance P in DMPC:CHAPS q=0.25 bicelles	X	X
20117	Substance P 40 structures in water pH 5.5 298 K NMR DATA & STRUCTURES	X	X
20118	A 15-residue peptide corresponding to the C-terminal domain of the Gq protein alpha subunit (Gaq-Ct peptide) was synthesized and characterized using NMR spectroscopic studies.	X	X
20119	Assembling NMR structures for the intracellular loops of the human thromboxane A2 receptor: Implication of the G protein-coupling pocket	X	X
20121	Tubulysin conformation bound to tubulin	X	X
20122	Solution structure of CCAP-vil with one disulfide bond from Conus villepinii	X	X
20123	NS4A(1-22)	X	X
20124	Structure and lipid interactions of an anti-atherogenic Apolipoprotein J peptide using solution NMR	X	X
20125	DPC micelle bound VK22	X	X
20126	Alpha-conotoxin Vc1.2	X	X
20127	Nociceptin Agonist	X	X
21000	Lasso peptide based integrin inhibitor: Microcin J25 variant with RGD substitution of Gly12-Ile13-Gly14	X	X
21002	Solution NMR structure of TZ2C-BG	X	X
21008	LPS bound structure of Temporin-1Tl	X	X
21009	The Binding Mechanism of a Peptidylic Cyclic Serine Protease Inhibitor - upain-1	X	X
21010	The Binding Mechanism of a Peptidylic Cyclic Serine Protease Inhibitor - extended upain	X	X
21011	LPS bound structure of Cysteine deleted TachyplesinI	X	X
21013	DPC micelle bound RI23	X	X
21014	solution structure of conotoxin lt14a	X	X
21015	solution structure of conotoxin pu14a	X	X
21031	Solution structure of Lewis a [Gal-beta1_3-(Fuc-alpha1_4-)GlcNAc-beta-Me]	X				X
21032	Solution structure of 1,3-Fucosylated chitobiose	X				X
21033	Solution structure of Lewis x (Gal-beta1,4-[Fuc-alpha1,3]-GlcNAc-beta) attached to a protein	X	X			X
21034	Solution structure of Lewisx (Gal-beta1,4-[Fuc-alpha1,3-]GlcNAc-beta-OMe) at 277 K	X				X
21035	AIP-III	X	X
21036	AIP-III_D4A	X	X
21037	AIP-III_DF5	X	X
21038	AIP-III_DL7	X	X
21039	AIP-III_F5A cyclic peptide	X	X
21040	AIP-III_L7A	X	X
21041	tAIP-III	X	X
21042	tAIP-III_D2A	X	X
21045	AIP-I	X	X
21046	AIP-II	X	X
21047	AIP-IV	X	X
21053	Solution structure of fucosylated LacDiNAc (LDNF)	X				X
21054	Solution structure of the amphibian egg glycan Bv9 from Bombina variegata	X				X
21056	SFTI-TCTR N12 N14 NMeSer6	X	X
21057	SFTI-TCTR N12 N14	X	X
21058	PapMA	X	X
21059	Trans-PapMA-k	X	X
21062	conotoxin Im10A	X	X
21074	Structure of the membrane proximal region of ITBG3 - residues 722-739	X	X
21075	NMR Structure of Lactam Constrained beta3-Integrin Cytoplasmic Domain Fragment (K724-D728)	X	X
21076	NMR Structure of Lactam Constrained beta3-Integrin Cytoplasmic Domain Fragment (K725-D729)	X	X
21077	NMR Structure of Lactam Constrained beta3-Integrin Cytoplasmic Domain Fragment (K728-D732)	X	X
21078	NMR Structure of Lactam Constrained beta3-Integrin Cytoplasmic Domain Fragment (K729-D733)	X	X
21098	Solution structure of the Secapin-like peptide U17-MYRTX-Tb1a from Ant venom.	X	X
21099	Solution structure of U3-MYRTX-Tb1a peptide from Ant venom.	X	X
21100	Solution structure of M-MYRTX-Tb1a peptide (Bicarinalin) from Ant peptide venom.	X	X
21101	Solution structure of U9-MYRTX-Tb1a from Ant peptide venom.	X	X
25000	WW3 domain of Nedd4L in complex with its HECT domain PY motif	X	X
25003	1H, 13C and 15N backbone resonance assignments for the class A beta-lactamase BlaP from Bacillus licheniformis 749/C with proline-glycine inserted at position 216	X	X
25005	THREE-DIMENSIONAL STRUCTURE OF CAP-GLY DOMAIN ASSEMBLED ON MICROTUBULES DETERMINED BY MAS NMR SPECTROSCOPY	X	X
25009	Cysteine Deleted Protegrin-1 (CDP-1): Anti-bacterial Activity, Outer-Membrane Disruption and Selectivity	X	X
25011	Cysteine Deleted Protegrin-1 (CDP-1): Anti-bacterial Activity, Outer-Membrane Disruption and Selectivity	X	X
25012	Cysteine Deleted Protegrin-1 (CDP-1): Anti-bacterial Activity, Outer-Membrane Disruption and Selectivity	X	X
25013	apo_YqcA_dynamics	X	X
25014	holo_YqcA_dynamics	X	X
25015	holo_FldA_dynamics	X	X
25016	Solution structure of Y125F mutant of eRF1 N-domain	X	X
25018	Solution NMR Structure of DE NOVO DESIGNED PROTEIN LFR1 WITH FERREDOXIN FOLD, Northeast Structural Genomics Consortium (NESG) Target OR414	X	X
25019	Sequential backbone HN, N, Ca and Cb assignments of E.coli dihydrofolate reductase-folate binary complex at pH 7.0 and 308 K	X	X
25020	Solution structure of E55Q mutant of eRF1 N-domain	X	X
25021	Backbone chemical shifts of murine Roquin-1 ROQ domain (147-326), apo form	X	X
25022	Polyglutamine binding peptide 1 (QBP1)	X	X
25023	15N HSQC assignment of Drosophila ELF domain from FANCL	X	X
25026	NMR structure of putative beta-lactamase (NP_372339.1) from Staphylococcus aureus Mu50	X	X
25027	NMR structure of the hypothetical protein BVU_0925 from Bacteroides vulgatus ATCC 8482	X	X
25028	NMR structure of the hypotheical protein Lreu_0056 from Lactobacillus reuteri	X	X
25029	Specific and Non-Specific Interactions in Ultra-Weak Protein-Protein Associations Revealed by Solvent Paramagnetic Relaxation Enhancements	X	X
25030	Solution structure of Escherichia coli Outer membrane protein A C-terminal domain	X	X
25032	Solution structure of a bacterial immunoglobulin-like domain form a surface protein of Leptospira	X	X
25034	Amide 1H and 15N chemical shift assignments and 15N relaxation parameters of the troponin C-troponin I hybrid proteins cChimera	X	X
25035	Amide 1H and 15N chemical shift assignments and 15N relaxation parameters of the troponin C-troponin I hybrid proteins cChimeraX	X	X
25036	Solution structure of CsUbl	X	X
25037	Solution structure of N terminal domain of the MuB AAA+ ATPase	X	X
25038	Structural Investigation of hnRNP L	X	X
25039	Structural Investigation of hnRNP L	X	X
25040	Structural Investigation of hnRNP L	X	X
25041	Structural Investigation of hnRNP L bound to RNA	X	X		X
25042	Structural Investigation of hnRNP L bound to RNA	X	X		X
25043	Structural Investigation of hnRNP L bound to RNA	X	X		X
25046	Backbone 1H, 15N Chemical Shift Assignments of the DC-SIGNR carbohydrate recognition domain in the Apo state.	X	X
25047	RRM-Peptide and RES Complex	X	X
25049	A Structure based mechanism for tRNA and retroviral RNA remodeling during primer annealing	X			X
25052	A structure-based mechanism for tRNA and retroviral RNA remodeling during primer annealing	X	X		X
25059	Backbone assignment for cold shock domain 1 of Drosophila Upstream of N-ras	X	X
25060	Backbone assignment for cold shock domain 1 of Drosophila Upstream of N-ras bound with RNA	X	X		X
25061	Solution NMR Structure of De novo designed Protein, Northeast Structural Genomics Consortium (NESG) Target OR457	X	X
25062	Solution NMR Structure of De novo designed protein, Northeast Structural Genomics Consortium (NESG) Target OR462	X	X
25064	apo structure of the Peptidyl Carrier Protein Domain 7 of the teicoplanin producing Non-ribosomal peptide synthetase	X	X
25065	holo structure of the Peptidyl Carrier Protein Domain 7 of the teicoplanin producing Non-ribosomal peptide synthetase	X	X
25067	Solution NMR Structure of De novo designed protein, Northeast Structural Genomics Consortium (NESG) Target OR459	X	X
25068	NMR Structure and 1H, 13C and 15N Chemical Shift Assignments for High mobility group protein from Plasmodium falciparum 3D7.	X	X
25069	Solution structure of human Ca2+-loaded S100A4 cys-free mutant	X	X
25070	NMR structure of the Rad18-UBZ/ubiquitin complex	X	X
25071	NMR structure of the ubiquitin-binding zinc finger (UBZ) domain from human Rad18	X	X
25072	Sex-lethal in complex with Upstream-to-N-Ras and msl2 mRNA	X	X		X
25077	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the PDZ domain and the linker of the Protein Tyrosine phosphatase non-receptor type 4	X	X
25078	CSD1-UNR bound to msl2 mRNA and Sex-lethal	X	X
25079	Assignment of the transmembrane domain of the erythropoietin receptor	X	X
25081	Fyn SH2 bound	X	X
25082	Fyn SH2 domain in complex with the natural inhibitory phosphotyrosine peptide	X	X
25083	Backbone 1H, 13C, and 15N Chemical Shift Assignments and NMR structure for potential drug target from Burkholderia thailandensis E264'	X	X
25084	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Sp Cdc5-D3	X	X
25085	Solution structure of the rhodanese domain of YgaP from E. coli	X	X
25086	truncated EcMazE	X	X
25092	truncated EcMazE-DNA complex	X	X	X
25093	full-length EcMazE	X	X
25094	full-length EcMazE-DNA complex	X	X
25096	Solution Structure of MciZ from Bacillus subtilis	X	X
25098	NMR solution structure of copper binding protein in the apo form	X	X
25099	Dimeric structure of the Human A-box	X		X
25100	Solution NMR structure pf tRNApro:MLV-Nucleocapsid (1:2) Complex	X	X		X
25101	Solution NMR structure of tRNApro:MLV Nucleocapsid Protein (1:1) Complex	X	X		X
25105	BAZ2B bromodomain	X				X
25106	Structural dynamics of double-helical RNA having CAG motif	X			X
25109	Solution NMR structure of MAVS CARD	X	X
25110	Solution structure of a left-handed G-quadruplex	X		X
25111	Resonance assignment of the ligand-free cyclic nucleotide-binding domain from the murine ion channel HCN2	X	X
25113	Domain Orientation and Dynamics of the 38.8 kDa Staphylococcus aureus Hemoglobin Receptor, IsdH	X	X
25117	1H, 13C, and 15N Chemical Shift Assignments for SAIL-DsbA	X	X
25118	Chemical shift assignments for human cardiac troponin I, residues 1-73	X	X
25119	Chemical shift assignments for human cardiac troponin I, residues 1-73, bound to cardiac troponin C	X	X
25120	Human cardiac troponin C (aCys) in complex with cTnI[1-73] and cTnI[144-163]	X	X
25122	NMR SOLUTION STRUCTURE OF SCORPION VENOM TOXIN Ts11 (TsPep1) FROM Tityus serrulatus	X	X
25124	Solution Structure and Chemical Shift Assignments for BeF3 activated Receiver Domain of Nitrogen Regulatory Protein C ( NtrC ) at 35C	X	X
25125	Solution Structure and Chemical Shift Assignments for the Apo form of the Receiver Domain of Nitrogen Regulatory Protein C ( NTRC ) at 35C	X	X
25130	Solution structure of LEDGF/p75 IBD in complex with MLL1 peptide (140-160)	X	X
25131	1H chemical shift assignment of Kindlin-2 F2	X	X
25132	NMR study of non-structural proteins - 1H, 13C, 15N resonance assigment of macro domain of Venezuelan equine encephalitis virus (VEEV)	X	X
25133	HOXD13 Solution NMR Chemical Shift Coordinates	X	X
25134	H, N, Calpha assignments of AMA1-bound R1 peptide at pH 7 and 313k	X	X
25135	Solution structure of the MLKL N-terminal domain	X	X
25136	Backbone and Side Chain Chemical Shift Assignments for S100A4dC	X	X
25137	Ligand-induced folding of a receiver domain	X	X
25139	The solution structure of the MANEC-type domain from Hepatocyte Growth Factor Inhibitor 1 reveals an unexpected PAN/apple domain-type fold	X	X
25141	Backbone chemical shift assignment of EL_LovR bound to magnesium chloride	X	X
25142	Solution structure of Hox homeodomain	X	X
25143	Solution structure of the RING finger of the tripartite 19 from human.	X	X
25145	Solution structure of the B1 box monomer of the tripartite 19 from human.	X	X
25146	Solid-state NMR chemical shifts of amyloid-like fibrils formed by huntingtin N-terminal fragments (httNTQ30P10K2)	X	X
25147	Struture of -24 DNA binding domain of sigma 54 from E. coli	X	X
25149	Isolated Ring domain	X	X
25150	Solution structure of the human ubiquitin conjugating enzyme Ube2w	X	X
25152	Solution structure MTAbl13, a grafted MCoTI-II	X	X
25153	holo_FldB	X	X
25154	Backbone 1H, 15N and 13C resonance assignments of murine STING in complex with DMXAA	X	X
25155	apo_FldB	X	X
25156	Structure of decorin binding protein A from strain N40 of Borrelia burgdorferi	X	X
25157	Strcucture of Decorin Binding Protein A from strain PBr of Borrelia garinii	X	X
25158	Solution structure of Doc48S	X	X
25161	Carnolysin A1'	X	X
25162	Carnolysin A2'	X	X
25163	NMR structure of the III-IV-V three-way junction from the VS ribozyme	X			X
25164	NMR structure of the III-IV-V three-way junction from the VS ribozyme and identification of magnesium-binding sites using paramagnetic relaxation enhancement	X			X
25165	Solution NMR Structure of DE NOVO DESIGNED DE NOVO DESIGNED FR55, Northeast Structural Genomics Consortium (NESG) Target OR109	X	X
25167	Backbone 1H, 13C, and 15N Chemical Shift Assignments for CS domain of human Shq1	X	X
25168	flpp3sol BMRB submission	X	X
25172	H, 13C and 15N assignments of EGF domains 4 to 7 of human Notch-1	X	X
25175	NMR resonance assignment of the N-terminal domain of the lantibiotic immunity protein NisI	X	X
25177	Solution Structure of a De Novo Designed Peptide that Sequesters Toxic Heavy Metals	X	X
25179	Backbone resonance assignments of the wt NS4A N-terminal domain of DENV	X	X
25180	Backbone resonance assignments of the mutant NS4A N-terminal domain of DENV (L6E;M10E)	X	X
25188	Solution Structure of the YTH Domain of YT521-B in complex with N6-Methyladenosine containing RNA	X	X		X
25193	NMR resonance assignment of the lantibiotic immunity protein NisI	X	X
25194	NMR resonance assignment of the C-terminal domain of the lantibiotic immunity protein NisI	X	X
25195	Solution structure of a putative arsenate reductase from Brucella melitensis. Seattle Structural Genomics Center for Infectious Disease target BrabA.00073.a	X	X
25196	haloSRC assignment	X	X
25199	Backbone (HN, NH, CO and CA) Chemical Shift Assignments for Ca(2+)-bound Myristoylated GCAP-2 in the Presence of 10 mM CHAPS	X	X
25203	Changing ABRA protein peptide to fit the HLA-DR B1*0301 molecule renders it protection-inducing	X	X
25208	Backbone and Side Chain Chemical Shift Assignments for S100A4dC in complex with MPT	X	X
25209	Binding activity, structure, and immunogenicity of synthetic peptides derived from Plasmodium falciparum CelTOS and TRSP proteins	X	X
25218	Chemical shifts of amyloid beta (1-42) peptide in aqueous solution	X	X
25219	Solution Structure of the UBM1 domain of human HUWE1/ARF-BP1	X	X
25221	Solution structure of the PHD domain of Yeast YNG2	X	X
25224	Backbone 1H, 13C, and 15N resonance assignments of the Fc fragment of human immunoglobulin G glycoprotein	X	X
25225	Structure of the trans-(Tyr39-Pro40) form of the Human Secreted Ly-6/uPAR Related Protein-1 (SLURP-1)	X	X
25226	Structure of the cis-(Tyr39-Pro40) form of the Human Secreted Ly-6/uPAR Related Protein-1 (SLURP-1)	X	X
25227	1H, 13C, and 15N chemical shift assignments for alpha-synuclein monomer (WT)	X	X
25228	1H, 13C, and 15N chemical shift assignments for alpha-synuclein (H50Q)	X	X
25229	Solution Structure of the Human FAAP20 UBZ	X	X
25230	Solution Structure of the Human FAAP20 UBZ-Ubiquitin Complex	X	X
25231	14-3-3 Zeta Backbone Assignment	X	X
25232	Solution structure of the F231L mutant ERCC1-XPF dimerization region	X	X
25233	NOE-based model of the influenza A virus S31N mutant (19-49) bound to drug 11	X	X
25234	NOE-based model of the influenza A virus M2 (19-49) bound to drug 11	X	X
25237	Solution NMR Structure of Maltose-binding protein from Escherichia coli, Northeast Structural Genomics Consortium (NESG) Target ER690	X	X
25238	Solution NMR structure of Human Relaxin-2	X	X
25239	NMR Chemical Shift Assignments of La-RRM1 of La protein.	X	X
25240	Solution structure of Twinstar from Drosophila melanogastor	X	X
25242	SKELEMIN ASSOCIATION WITH ALFA2B,BETTA3 INTEGRIN: A STRUCTURAL MODEL	X	X
25243	AN ARSENATE REDUCTASE IN OXIDIZED STATE	X	X
25244	1H, 15N and 13C resonance assignments of the RRM1 domain of the key post-transcriptional regulator HuR	X	X
25247	Chemical Shift 1H, 13C, 15N Assignments of FliG bound to unlabeled FliF C-terminal peptide	X	X
25250	Solution structure of Ovis Aries PrP with mutation delta190-197	X	X
25251	Solution structure of Ovis Aries PrP with mutation delta193-196	X	X
25253	Chemical Shifts of Y99E,N111D mutant CaM with iNOS	X	X
25255	Denatured state of HIV-1 protease	X	X
25257	Chemical Shifts of Y99E mutant CaM with eNOS	X	X
25259	NMR structure of hypothetical protein NP_344732.1 from Streptococcus pneumoniae TIGR4	X	X
25260	Solution structure of human insulin at pH 1.9	X	X
25261	Solution structure of [GlnB22]-insulin mutant at pH 1.9	X	X
25263	NMR assignments of the CUS-3 phage coat protein insertion domain.	X	X
25265	Structural insight into an essential assembly factor network on the pre-ribosome	X	X
25266	Solution structure of decorin binding protein B from Borrelia burgdorferi	X	X
25267	Backbone 1H, 13C and 15N Chemical Shift Assignments for Human TRIM25 (PRYSPRY) domain	X	X
25269	Structure of ASM1	X	X
25275	Solution structure of eEF1Bdelta CAR domain	X	X
25276	Solution structure of eEF1Bdelta CAR domain in TCTP-bound state	X	X
25278	Backbone chemical shift assignments for the sensor domain of the Burkholderia pseudomallei histidine kinase RisS. Seattle Structural Genomics Center for Infectious Disease target BupsA.00863.i.	X	X
25280	1H, 13C, and 15N chemical shift assignments of mouse BMAL1 transactivation domain	X	X
25281	NMR STRUCTURE OF YERSINIA PESTIS AIL (ATTACHMENT INVASION LOCUS) IN DECYLPHOSPHOCHOLINE MICELLES	X	X
25282	Backbone assignment of native and 8M urea-denatured MJ0366	X	X
25283	Solution structure of scoloptoxin SSD609 from Scolopendra mutilans	X	X
25288	Solution structure of the TRIM19 B-box1 (B1) of human promyelocytic leukemia (PML)	X	X
25289	Atomic-resolution 3D structure of amyloid-beta fibrils: the Osaka mutation	X	X
25293	Kalata B7 Ser mutant	X	X
25294	NMR structure of the protein NP_809137.1 from Bacteroides thetaiotaomicron	X	X
25298	Tetramerization domain of the Ciona intestinalis p53/p73-b transcription factor protein	X	X
25299	Backbone fold of Human Small Ubiquitin like Modifier protein-1 (SUMO-1) based on Prot3D-NMR approach.	X	X
25301	Ig1 domain of human obscurin	X	X
25302	Solution NMR structure of a novel cysteine framework containing Conus peptide Mo3964	X	X
25303	Titin M10 bound to obscurin ig1	X	X
25304	obscurin Ig1 bound to titin M10	X	X
25305	titin M10 domain	X	X
25307	solution structure of SATB1 homeodomain	X	X
25308	Chemical shift assignments of human obscurin Ig58	X	X
25309	FBP28 WW2 , mutation Y438R	X	X
25310	FBP28 WW2 mutant Y446L	X	X
25311	FBP28 WW2 mutant W457F	X	X
25312	SOLUTION STRUCTURE OF HUMAN MBD1 CXXC1 DOMAIN	X	X
25313	FBP28 WW2 mutant Y438R DNDC	X	X
25314	FBP28 WW2 mutant Y238R L453A DNDC	X	X
25315	FBP28 WW2 mutant Y438R DN	X	X
25317	pH-dependent random coil 1H, 13C, and 15N chemical shifts of the ionizable amino acids: a guide for protein pKa measurements	X	X
25318	pH-dependent random coil 1H, 13C, and 15N chemical shifts of the ionizable amino acids: a guide for protein pKa measurements	X	X
25319	pH-dependent random coil 1H, 13C, and 15N chemical shifts of the ionizable amino acids: a guide for protein pKa measurements	X	X
25320	pH-dependent random coil 1H, 13C, and 15N chemical shifts of the ionizable amino acids: a guide for protein pKa measurements	X	X
25321	pH-dependent random coil 1H, 13C, and 15N chemical shifts of the ionizable amino acids: a guide for protein pKa measurements	X	X
25322	pH-dependent random coil 1H, 13C, and 15N chemical shifts of the ionizable amino acids: a guide for protein pKa measurements	X	X
25326	The structure of the carboxy-terminal domain of DNTTIP1	X	X
25328	Backbone assignment of the homodimer HUA2 from E.coli	X	X
25329	Backbone Assignment Of the homodimer HUB2 from E.coli at 293K	X	X
25330	Backbone Assignment of the heterodimer HUAB from E. coli at 293K	X	X
25334	Hybrid structure of the Type 1 Pilus of Uropathogenic E.coli	X	X
25342	NMR structure of the protein YP_193882.1 from Lactobacillus acidophilus NCFM in presence of FMN	X	X
25343	Talin-F3 / RIAM N-terminal Peptide complex	X	X
25344	Calcium bound calmodulin C-terminal domain, E140Q mutant	X	X
25345	Second calciumbinding domain from P. falciparum CDPK3	X	X
25346	MG200 EAGR box	X	X
25347	Solution structure of 53BP1 tandem Tudor domains in complex with a p53K370me2 peptide	X	X
25348	Solution structure of 53BP1 tandem Tudor domains in complex with a p53K382me2 peptide	X	X
25349	Nedd4 WW3	X	X
25350	Solution structure of PsbQ from spinacia oleracea	X	X
25351	1H, 13C and 15N Chemical Shift Assignments of the H962C mutant from Arkadia (RNF111) E3 RING domain	X	X
25352	Acidocin B	X	X
25354	SH3 domain from yeast Abp1p	X	X
25355	EphB2 kinase domain and juxtamembrane segment, S677A/S680A/D754A	X	X
25356	Thiopurine methyltransferase *1 15-245	X	X
25358	Resonance assignments of the periplasmic domain of a cellulose-sensing trans-membrane anti-sigma factor from Clostridium thermocellum	X	X
25359	BamA barrel in nanodiscs	X	X
25363	1H and 13C chemical shift assignments and structure calculation for crotalicidin in DPC micelles	X	X
25364	Backbone 1H, 13C, and 15N Chemical Shift Assignments drosophila stem-loop binding protein complexed with histone mRNA stem-loop	X	X		X
25365	Backbone 1H, 13C, and 15N Chemical Shift Assignments for drosophila histone mRNA stem-loop-binding protein	X	X
25366	1H and 13C chemical shift assignments for Crotalicidin-Nt in DPC micelles	X	X
25368	Backbone 1H, 13C and 15N chemical shifts for Staphylococcus aureus EF-GC3, a truncated form of elongation factor G comprising domains III-V.	X	X
25370	1H and 13C chemical shift assignments for crotalicidin-Ct in DPC micelles	X	X
25371	NMR assignments of a novel lectin from sea mussel Crenomytilus grayanus	X	X
25372	Solution Structure of the Mediator Gall11 KIX Domain of C. Glabrata	X	X
25375	Assignment of PTP1B bound to the inhibitor CPT-157633	X	X
25376	The RING Domain of human Promyelocytic Leukemia Protein (PML)	X	X
25377	MDMX-P53	X	X
25378	A structure of G-quadruplex	X		X
25379	Resonance assignment of PsbP an extrinsic protein from photosystem II of Spinacia oleracea	X	X
25382	UBX-L domain of VCIP135	X	X
25383	Backbone chemical shift assignment of human TRAP1-NTD (60-296)	X	X
25385	NMR assignments of Ssa1 substrate binding domain	X	X
25386	Chemical shift assignments of Zinc finger Domain of Methionine amino peptidase 1 from Homo sapiens	X	X
25387	Backbone and side-chain 1H, 15N, 13C assignment and secondary structure of BPSL1445 from Burkholderia pseudomallei	X	X
25391	1H, 15N and 13C resonance assignments of translationally-controlled tumor protein from Nannochloropsis oceanica	X	X
25393	Backbone 1H, 13C, and 15N Chemical Shift Assignments for IST1 residues 303-366	X	X
25395	Solution structure of the internal EH domain of gamma-synergin	X	X
25396	assignment of the transmembrane domain of the mouse erythropoietin receptor	X	X
25400	Solution structure of firefly light organ fatty acid binding protein (lcFABP)	X	X
25401	1H, 15N 13C Chemical shift assignments for CCL28	X	X
25403	NMR Structural Mapping Reveals Promiscuous Interactions between Clathrin Box Motif Peptides and the N-Terminal Domain of the Clathrin Heavy Chain	X	X
25406	Titin M10 H56P mutation	X	X
25408	NMR resolved structure of VG16KRKP, an antimicrobial peptide in D8PG micelles	X	X
25409	NMR resolved structure of VG16KRKP, an antimicrobial peptide in SDS	X	X
25416	Structural features of a 3' splice site in influenza A: 39-nt hairpin	X			X
25417	NMR resonance assignments of CadC 1-159 from E.coli	X	X
25424	The solution structure of DEFA1, a highly potent antimicrobial peptide from the horse	X	X
25425	Backbone and side-chain 13C, 15N resonance assignments of artificially disordered FAS 1-4 A546T domain of TGFBIp dissolved in 95 % of DMSO in presence of water	X	X
25426	MBD2 intrinsically disordered region	X	X
25428	NMR structure of the acidic domain of SYNCRIP (hnRNPQ)	X	X
25430	GADD34; PP1-binding domain	X	X
25432	Solution NMR assignment of the 6th TOG domain of minispindles	X	X
25433	NMR structure of the first Zinc Finger domain of RBM10	X	X
25434	Solution NMR Structure of the OCRE Domain of RBM10	X	X
25435	Structure of Amylase binding Protein A of Streptococcous gordonii: a potential receptor for human salivary amylase enzyme	X	X
25436	Solution structure of hnRNP C RRM in complex with the 5'-AUUUUUC-3' RNA	X	X		X
25437	Endo T5-ZN+2	X	X
25441	Backbone chemical shift assignments for human Rotavirus P[19] VP8* domain of VP4	X	X
25442	Snu17p-Bud13p structure intermediate during RES complex assembly	X	X
25443	Snu17p-Pml1p structure intermediate during RES complex assembly	X	X
25448	Solution structure of N-terminal domain of human TIG3	X	X
25449	Solution structure of RNA recognition motif of a cyclophilin33 - like protein from Plasmodium falciparum	X	X
25451	Solution structure of the dithiolic glutaredoxin 2-C-Grx1 from the pathogen Trypanosoma brucei brucei	X	X
25452	Omega-Tbo-IT1 selective inhibitor of insect calcium channels isolated from Tibellus oblongus spider venom	X	X
25455	Backbone, side chain and heme resonance assignments of cytochrome OmcF from Geobacter sulfurreducens	X	X
25456	Cullin3 - BTB interface: a novel target for stapled peptides	X	X
25457	Cullin3 - BTB interface: a novel target for stapled peptides	X	X
25459	Solution structure of Fungus protein Q8J180_MAGGR	X	X
25460	Solution structure of Fungus protein B9WZW9_MAGOR	X	X
25461	Structure of the CUE domain of yeast Cue1	X	X
25462	Backbone Chemical Shift Assignments for the Monomeric [R238A] Mutant of Non-Structural Protein 1 Effector Domain from Influenza B Virus	X	X
25463	Backbone Chemical Shift Assignments for the Wild-Type Dimeric Non-Structural Protein 1 Effector Domain from Influenza B Virus	X	X
25464	Solution structure of an MbtH-like protein from Mycobacterium marinum. Seattle Structural Genomics Center for Infectious Disease target MymaA.01649.c	X	X
25465	ConRlBNQO	X	X
25467	Backbone H, N and C assignments for PLAT domain of human polycystin-1, W3128A mutant	X	X
25468	Solution NMR Structure of PDFL2.1 from Arabidopsis thaliana	X	X
25469	Solution structure of hnRNP C RRM in complex with 5'-UUUUC-3' RNA	X	X		X
25475	Structure of Tau(267-312) bound to Microtubules	X	X
25481	Backbone 1H, 13C and 15N chemical shift assignment for perforin C2 quad mutant	X	X
25482	Solution structural studies of GTP:adenosylcobinamide-phosphate guanylyltransferase (CobY) from Methanocaldococcus jannaschii	X	X
25484	Characterization of the p300 Taz2-p53 TAD2 Complex and Comparison with the p300 Taz2-p53 TAD1 Complex	X	X
25485	NMR Solution Structure of the PRO Form of Human Matrilysin (proMMP-7)	X	X
25486	Purotoxin-2 NMR structure in water	X	X
25487	Purotoxin-2 NMR structure in DPC micelles	X	X
25488	NMR Solution Structure of the PRO Form of Human Matrilysin (proMMP-7) in Complex with Zwitterionic Membrane	X	X
25489	NMR Solution Structure of the PRO Form of Human Matrilysin (proMMP-7) in Complex with Anionic Membrane	X	X
25490	Structure of Conantokin Rl-B	X	X
25491	Structure of Conantokin Rl-B	X	X
25494	First and second KH domains of hnRNP E1	X	X
25495	Structure and dynamics of the acidosis-resistant a162H mutant of the switch region of troponin I bound to the regulatory domain of troponin C	X	X
25496	NMR structure of the RRM3 domain of Gbp2	X	X
25497	NMR structure of the RRM1 domain of Hrb1	X	X
25498	NMR structure of the RRM2 domain of Hrb1	X	X
25499	NMR structure of the RRM3 domain of Hrb1	X	X
25500	Backbone chemical shift assignments for the folded/unfolded drkN SH3 protein in the presence of DnaK chaperone at pH 7.2	X	X
25501	Backbone chemical shift assignments for the folded/unfolded drkN SH3 protein at pH 7.2	X	X
25506	Synthesis, Characterization and In Vitro Evaluation of New 99mTc/Re(V)-cyclized Octreotide Analogues: An Experimental and Computational Approach	X				X
25507	Synthesis, Characterization and In Vitro Evaluation of New 99mTc/Re(V)-cyclized Octreotide Analogues: An Experimental and Computational Approach	X				X
25508	1H, 13C, and 15N Chemical Shift Assignments and structure of Probable Fe(2+)-trafficking protein from Burkholderia pseudomallei 1710b.	X	X
25509	1H, 13C, 15N chemical shift assignments for APOBEC3G NTD variant, sNTD	X	X
25510	NMR Solution structure of AIM2 PYD from Mus musculus	X	X
25511	Structure and dynamics of the acidosis-resistant a162H mutant of the switch region of troponin I bound to the regulatory domain of troponin C	X	X
25513	SOLUTION STRUCTURE OF THE A147T VARIANT OF THE MITOCHONDRIAL TRANSLOCATOR PROTEIN (TSPO) IN COMPLEX WITH PK11195	X	X
25514	Solution Structure of the phosphorylated J-domain of Human Cysteine String Protein (CSP)	X	X
25515	Solution Structure of the non-phosphorylated J-domain of Human Cysteine String Protein (CSP)	X	X
25516	Design of a Highly Stable Disulfide-Deleted Mutant of Analgesic Cyclic alpha-Conotoxin Vc1.1	X	X
25517	Short hydrophobic peptide, 11mer	X	X
25518	Atomic-resolution structure of alpha-synuclein fibrils	X	X
25527	Chemical shift assignments and structure of the alpha-crystallin domain from human, HSPB5	X	X
25529	NMR Solution Structure and Model Membrane Interaction Studies of the Peptide Hylin a1 from the Arboreal South American Frog Hypsiboas albopunctatus	X	X
25530	AQ1974	X	X
25533	1H, 13C and 15N assignments of EGF domains 8 to 11 of human Notch-1	X	X
25535	Further exploration of the conformational space of alpha-synuclein fibrils: Solid-state NMR assignment of a high-pH polymorph	X	X
25536	MDMX-057	X	X
25538	Mdmx-SJ212	X	X
25540	NMR structure of the complex between the C-terminal domain of the Rift Valley fever virus protein NSs and the PH domain of the Tfb1 subunit of TFIIH.	X	X
25541	Solution structure of MyUb (1080-1122) of human Myosin VI	X	X
25542	Solution structure of MyUb (1080-1131) of human Myosin VI	X	X
25543	Solution structure of human Myosin VI isoform3 (998-1071)	X	X
25544	Solution structure of human Myosin VI isoform3 (1050-1131)	X	X
25545	Complex structure of MyUb (1080-1122) of human Myosin VI with K63-diUb	X	X
25546	MDMX-295	X	X
25548	structure of a peptide	X	X
25549	1H, 13C, 15N backbone chemical shift assignments of mouse BMAL2 transactivation domain	X	X
25551	Backbone amide chemical shift assignments of the CN-bound yeast cytochrome c peroxidase covalently cross-linked to yeast iso-1 cytochrome c	X	X
25552	STIL binding to Polo-box 3 of PLK4 regulates centriole duplication - NMR solution structure of human Polo-box 3	X	X
25554	NMR solution structure of nucleotide-free Ran GTPase	X	X
25555	Structure of PvHCt, an antimicrobial peptide from shrimp litopenaeus vannamei	X	X
25556	Solution structure of the MRG15-MRGBP complex	X	X
25557	Backbone chemical shift assignments for reduced peroxiredoxin Q from the plant pathogen Xanthomonas campestris.	X	X
25560	Solution structure of the GBII-beta MRH domain W409A point mutant	X	X
25565	Solution structure of the BCOR PUFD	X	X
25566	Backbone chemical shift assignments for oxidized peroxiredoxin Q from the plant pathogen Xanthomonas campestris	X	X
25567	NMR structure of the apo-form of the flavoprotein YP_193882.1 from Lactobacillus acidophilus NCFM	X	X
25569	PIN1 WW domain in complex with a phosphorylated CPEB1 derived peptide	X	X
25570	Structure of the C-terminal membrane domain of HCV NS5B protein	X	X
25572	Dad2 C terminal	X	X
25576	Solution structure of human SUMO1	X	X
25577	Solution structure of human SUMO2	X	X
25582	structure of a protein	X	X	X
25584	NMR structure of the complex between the PH domain of the Tfb1 subunit from TFIIH and the N-terminal activation domain of EKLF (TAD1)	X	X
25586	Backbone resonance assignments of the wt NS4A N-terminal domain of DENV in aqueous solution	X	X
25588	Direct attack of vanilloids on the regulation of the pain receptor TRPV1	X	X
25590	1H, 13C and 15N resonance assignments and second structure information of Fag s 1: Fagales allergen from Fagus sylvatica	X	X
25593	Spatial structure of HER2/ErbB2 dimeric transmembrane domain in the presence of cytoplasmic juxtamembrane domains	X	X
25596	Structure of DNA G-quadruplex adopted by ALS and FTD related GGGGCC repeat with G21 to Br-G21 substitution	X		X
25597	Solution NMR structure of Dynorphin 1-13 bound to Kappa Opioid Receptor	X	X
25599	Solution structure of Sds3 in complex with Sin3A	X	X
25600	Solution structure of LigA4 Big domain	X	X
25601	Ensemble structure the closed state of Lys63-linked diubiquitin in the absence of a ligand	X	X
25602	Tom1 negatively modulates binding of Tollip to phosphatidylinositol 3-phosphate via a coupled folding and binding mechanism	X	X
25605	NMR solution structure of HsAFP1	X	X
25606	1H, 13C and 15N assignment of HA, HB, HN, CA, CB, C' and N of human Androgen Receptor-4Q	X	X
25607	1H, 13C and 15N assignment of HA, HB, HN, CA, CB, C' and N of human Androgen Receptor-25Q	X	X
25609	NMR solution structure of RsAFP2	X	X
25610	NMR solution structure of the pheromone Ep-1 from Euplotes petzi	X	X
25611	Solution NMR Structure of DE NOVO DESIGNED PROTEIN (FDA_60), Northeast Structural Genomics Consortium (NESG) Target OR303	X	X
25612	Solution NMR Structure of DE NOVO DESIGNED Ferredoxin Fold PROTEIN sfr3, Northeast Structural Genomics Consortium (NESG) Target OR358	X	X
25613	Solution structure of [B26-B29 triazole cross-linked]-insulin analogue at pH 1.9	X	X
25614	Solution structure of [B26-B29 triazole cross-linked]-insulin analogue at pH 8.0	X	X
25615	Solution structure of [GlyB24,B27-B29 triazole cross-linked]-insulin analogue at pH 1.9	X	X
25627	Solution structure of the meiosis-expressed gene 1 (Meig1)	X	X
25628	Backbone 1H, 13C and 15N Chemical Shift Assignments for G56C_T163C mutant of Adenylate Kinase at oxidized condition	X	X
25629	Backbone 1H, 13C and 15N Chemical Shift Assignments for G56C_T163C mutant of Adenylate Kinase at reduced condition	X	X
25631	structure of ace-pvhct-nh2	X	X
25632	Tom1 negatively modulates binding of Tollip to phosphatidylinositol 3-phosphate via a coupled folding and binding mechanism	X	X
25634	Fusion to a Highly Stable Consensus Albumin Binding Domain Allows for Tunable Pharmacokinetics	X	X
25636	Solution structure of AVR-Pia	X	X
25638	NMR solution structure of a C-terminal domain of the chromodomain helicase DNA-binding protein 1	X	X
25639	Solution structure of LEDGF/p75 IBD in complex with POGZ peptide (1389-1404)	X	X
25640	STRUCTURE OF OXIDIZED HORSE HEART CYTOCHROME C ENCAPSULATED IN REVERSE MICELLES	X	X
25642	Atomic structure of the cytoskeletal bactofilin BacA revealed by solid-state NMR	X	X
25645	Chemical Shift Assignments and Structure of HSPB1_ACD	X	X
25646	Backbone chemical shift assignment of rat p75NTR transmembrane and intracellular domains in lipid/protein nanodiscs	X	X
25647	Backbone and sidechain chemical shift assignment of rat p75NTR transmembrane and intracellular juxtamembrane domains in DPC micelles	X	X
25648	Backbone chemical shift assignment of rat p75NTR transmembrane and juxtamembrane intracellular domains in lipid/protein nanodiscs	X	X
25649	Human Brd4 ET domain in complex with MLV Integrase C-term	X	X
25650	Solution structure of RNA recognition motif-1 of Plasmodium falciparum serine/arginine-rich protein 1.	X	X
25651	Isolation and structural characterization of an active G-quadruplex motif from AGRO100	X		X
25652	Structure of PTB RRM1(41-163) bound to an RNA stemloop containing a structured loop derived from viral internal ribosomal entry site RNA	X	X		X
25653	SOLUTION NMR STRUCTURE OF ASTEROPSIN G FROM MARINE SPONGE ASTEROPUS	X	X
25654	NMR structure of the II-III-VI three-way junction from the VS ribozyme	X			X
25655	NMR structure of the II-III-VI three-way junction from the VS ribozyme and identification of magnesium-binding sites using paramagnetic relaxation enhancement	X			X
25657	Proteasome protein fragment	X	X
25659	Solution Structure of TDP-43 Amyloidogenic Core Region	X	X
25660	NMR structure of the Y48pCMF variant of human cytochrome c in its reduced state	X	X
25662	Solution NMR Structure of DE NOVO DESIGNED PROTEIN, Rossmann2x2 Fold, Northeast Structural Genomics Consortium (NESG) Target OR446	X	X
25664	Solution NMR Structure of DE NOVO DESIGNED PROTEIN Top7NNSTYCC, Northeast Structural Genomics Consortium (NESG) Target OR34	X	X
25666	Solution NMR Structure of DE NOVO DESIGNED PROTEIN Top7NNSTYCC, Northeast Structural Genomics Consortium (NESG) Target OR34	X	X
25667	Solution Structure of the G335D Mutant of TDP-43 Amyloidogenic Core Region	X	X
25668	Solution Structure of the Q343R Mutant of TDP-43 Amyloidogenic Core Region	X	X
25670	Solution Structure of Enterocin HF, an Antilisterial Bacteriocin Produced by Enterococcus faecium M3K31	X	X
25671	1H Chemical Shift Assignments of the HIV ISS element	X			X
25673	NMR structure for a 3-stranded parallel beta-sheet	X	X
25674	Backbone Assignment of the MALT1 Paracaspase by Solution NMR	X	X
25675	SOLUTION STRUCTURE OF THE N-TERMINAL DOMAIN OF TDP-43	X	X
25676	Backbone resonance assignments of the mutant NS4A N-terminal domain	X	X
25677	Solution NMR structure of CBX8 in complex with AF9 (CBX8-AF9)	X	X
25678	FBP28 WW L453D	X	X
25679	FBP28 WW L453E	X	X
25680	FBP28 WW L453W	X	X
25681	FBP28 WW E454Y	X	X
25682	FBP28 WW T456D	X	X
25683	FBP28 WW T456Y	X	X
25684	SOLUTION STRUCTURE OF THE LIPID DROPLET ANCHORING PEPTIDE OF CGI-58 BOUND TO DPC MICELLES	X	X
25686	Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome	X		X
25688	Novel Structural Components Contribute to the High Thermal Stability of Acyl Carrier Protein from Enterococcus faecalis	X	X
25690	NMR structure of the C-terminal region of human eukaryotic elongation factor 1B	X	X
25692	SOLUTION STRUCTURE OF OVIS ARIES PRP	X	X
25693	Solution structure of a disulfide stabilized XCL1 dimer	X	X
25694	Structure of constitutively monomeric CXCL12 in complex with the CXCR4 N-terminus	X	X
25702	Structures of the reduced and oxidized state of the mutant D24A of yeast thioredoxin 1: insight into the mechanism for the closing of the water cavity	X	X
25703	Structure of the reduced and oxidized state of the mutant D24A of yeast thioredoxin 1: insight into the mechanism for the closing of the water cavity	X	X
25704	Solution NMR structure of the lasso peptide chaxapeptin	X	X
25705	Backbone assignment of the N-terminal domain of human respiratory syncytial virus nucleoprotein	X	X
25706	1H, 13C, and 15N Chemical Shift Assignments of PKS domains	X	X
25707	Methyl resonances of ubiquitin in complex with R0RBR domain (141-465) of parkin	X	X
25708	Methyl and backbone amide resonances of ubiquitin S65E	X	X
25709	Methyl resonances of ubiquitin S65E in complex with R0RBR domain (141-465) of parkin	X	X
25710	Structure of high-density lipoprotein particles	X	X
25711	Chemical shifts of the HLA-B2705 heavy chain in complex with the peptide TIS	X	X
25712	Solution structure of the dehydroascorbate reductase 3A from Populus trichocarpa	X	X
25713	Chemical shifts of the HLA-B2709 heavy chain in complex with the peptide pVIPR	X	X
25714	Chemical shifts of the HLA-B2705 heavy chain in complex with the peptide pVIPR	X	X
25715	Chemical shifts of the HLA-B2709 heavy chain in complex with the peptide TIS	X	X
25716	PltL-holo	X	X
25717	PltL-pyrrolyl	X	X
25718	Regnase-1 N-terminal domain	X	X
25719	Regnase-1 Zinc finger domain	X	X
25720	Regnase-1 C-terminal domain	X	X
25721	1H, 15n, 13C chemical shifts assignments of VirA DD in complex with VirFGDD	X	X
25722	Unveiling the structural determinants of KIAA0323 binding preference for NEDD8	X	X
25725	Solution structure of cystein-rich peptide jS1 from Jasminum sambac	X	X
25728	1H, 13C, and 15N Chemical Shift Assignments for Histamine-Binding Protein (D24R) apo	X	X
25729	Spatial structure of EGFR transmembrane and juxtamembrane domains in DPC micelles	X	X
25730	1H, 15N and 13C backbone assignments of GDP-bound human H-Ras mutant G12V	X	X
25732	Solution structure of the cyanobacterial cytochrome b6f complex subunit PetP	X	X
25738	Synthesis, Characterization and In Vitro Evaluation of New 99mTc/Re(V)-cyclized Octreotide Analogues: An Experimental and Computational Approach	X				X
25739	Synthesis, Characterization and In Vitro Evaluation of New 99mTc/Re(V)-cyclized Octreotide Analogues: An Experimental and Computational Approach	X				X
25740	C-terminal domain of Cdc37 cochaperone	X	X
25744	NMR structure and dynamics of the resuscitation promoting factor RpfC catalytic domain	X	X
25745	Structure of the N-terminal domain of the metalloprotease PrtV from Vibrio cholerae	X	X
25746	G-quadruplex structure	X		X
25748	ddFLN5+110	X	X
25750	NMR Structure of the C-terminal Coiled-Coil Domain of CIN85	X	X
25751	Disulphide linked homodimer of designed antimicrobial peptide VG16KRKP	X	X
25753	NMR Structure of sweeter mutant (D40K) of sweet protein Brazzein	X	X
25755	NMR structure of non-sweet mutant (ins18RI19) of sweet protein Brazzein	X	X
25757	NMR structure of a human calmodulin / rat connexion-36 peptide hybrid	X	X
25758	NMR structure of the de-novo toxin Hui1	X	X
25759	Solution structure for quercetin complexed with c-myc G-quadruplex DNA	X		X
25760	NMR structure of the 140-315 fragment of the N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	X	X
25761	NMR structure of a DUF1491 family protein (CC_1065) from Caulobacter crescentus CB15	X	X
25762	Structure of Pleiotrophin	X	X
25763	Solution structure of an MbtH-like protein from Mycobacterium avium, Seattle Structural Genomics Center for Infectious Disease target MyavA.01649.c	X	X
25764	NMR structure for a 2-stranded parallel beta-sheet	X	X
25765	NMR structure for a 2-stranded parallel beta-sheet	X	X
25767	NMR structure of the Vta1NTD-Did2(176-204) complex	X	X
25768	Solution NMR structure of Outer Membrane Protein G from Pseudomonas aeruginosa	X	X
25769	Structural elucidation of the frog skin-derived peptide Esculentin-1a[Esc(1-21)NH2] in Lipopolysaccharide and correlation with their function	X	X
25770	N-terminal domain of the telomerase catalytic subunit Est2 from Ogataea polymorpha	X	X
25773	1H, 13C, 15N assignments of Trappin-2	X	X
25774	Chemical Shift Assignments and Structure Determination for spider toxin, U4-agatoxin-Ao1a	X	X
25776	Solution NMR structure of Outer Membrane Protein G P92A mutant from Pseudomonas aeruginosa	X	X
25777	Solution NMR structure of Tetrahymena telomerase RNA pseudoknot	X			X
25778	Chemical shift assignments and structure calculation of spider toxin U4-hexatoxin-Hi1a	X	X
25779	Partial 1H, 13C and 15N backbone resonance assignments for the carboxy-terminal RNA recognition motif of Plasmodium falciparum Ser/Arg-rich protein 1	X	X
25786	Solution structure of holo ArCP from yersiniabactin synthetase	X	X
25787	Solution structure of the salicylate-loaded ArCP from yersiniabactin synthetase	X	X
25788	Two-fold symmetric structure of the 18-60 construct of S31N M2 from Influenza A in lipid bilayers	X	X
25789	NMR structure of CmPI-II, a serin protease inhibitor isolated from mollusk Cenchitis muricatus	X	X
25790	Solution structure of regulatory protein	X	X
25791	Solution structure of kinase in complex with its regulatory protein	X	X
25794	Solution NMR Structure of DE NOVO DESIGNED PROTEIN, Rossmann2x2 Fold, Northeast Structural Genomics Consortium (NESG) Target OR446	X	X
25796	NMR solution structure of a complex of PEP-19 bound to the C-domain of apo calmodulin	X	X
25797	The structural and functional effects of the Familial Hypertrophic Cardiomyopathy-linked cardiac troponin C mutation, L29Q	X	X
25798	NMR structure of human I-type lectin domain	X	X
25799	NMR structure of human I-type lectin domain-glycan complex	X	X			X
25800	Solution structure of Plasmodium falciparum SR1-RRM1 in complex with ACAUCA RNA	X	X		X
25801	UBL domain of the human DNA damage-inducible protein homolog 2	X	X
25802	Resonance assignments of [15N, 13C] human DCL-1 (CD302) extracellular domain	X	X
25803	UBL domain of the yeast DNA damage-inducible protein homolog 1	X	X
25805	Structure of the cyclic nucleotide-binding homology domain of the hERG channel	X	X
25806	NMR structure of the prolactin receptor transmembrane domain	X	X
25807	Sidechain chi1 distribution in B3 domain of protein G from extensive sets of residual dipolar couplings	X	X
25808	Unveiling the structural determinants of KIAA0323 binding preference for NEDD8	X	X
25809	1H, 13C, 15N assignments of W60G mutant of human beta2-microglobulin	X	X
25810	NMR structure of the N-domain of troponin C bound to the switch region of troponin I and the covalent levosimendan analog i9.	X	X
25811	NMR-SAXS/WAXS Structure of the core of the U4/U6 di-snRNA	X			X
25813	NMR structure of Peptide PG-989 in DPC micelles	X	X
25814	NMR Structure of Peptide PG-990 in DPC micelles	X	X
25817	Structure of the transmembrane domain of human nicastrin in SDS micelles	X	X
25818	Structure of the transmembrane domain of human nicastrin in DPC micelles	X	X
25820	NMR structure of Peptide PG-992 in DPC micelles	X	X
25821	1H, 13C and 15N backbone resonance assignments for the class A beta-lactamase BlaP from Bacillus licheniformis 749/C	X	X
25825	UBL protein	X	X
25826	solution structure of microRNA 20b pre-element	X			X
25827	Backbone 1H, 13C, and 15N chemical shift assignments for metal-binding domain 1 of ATP7B	X	X
25828	RIP2 CARD	X	X
25829	p75NTR DD:RhoGDI	X	X
25831	solution structure of the complex of microRNA 20b pre-element with Rbfox RRM	X	X		X
25832	NMR assignment of CPR3 from Saccharomyces cerevisiae	X	X
25833	p75NTR DD:RIP2 CARD	X	X
25834	Solution structure of the FHA domain of TbPar42	X	X
25835	NMR structure of OtTx1a - AMP in DPC micelles	X	X
25836	NMR structure of OtTx1a - ICK	X	X
25837	Chemical shift assignment, NMR constraints and PDB for chromodomain 3 (CD3) of cpSRP43	X	X
25838	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the C-terminal intrinsically disordered domain of Alb3	X	X
25839	THE STRUCTURE OF KBP.K FROM E. COLI	X	X
25840	Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC at acidic pH	X		X
25847	three-dimensional structure of cyclic PVIIA	X	X
25848	Chemical shift assignments and structure calculation of spider toxin pi-hexatoxin-Hi1a	X	X
25849	NMR Structure of the homeodomain transcription factor Gbx1[E17R,R52E} from Homo sapiens	X	X
25850	Solution NMR Structure of Designed Protein DA05, Northeast Structural Genomics Consortium (NESG) Target OR626	X	X
25852	Structure and 15N relaxation data of Calmodulin bound to the endothelial Nitric Oxide Synthase Calmodulin Binding Domain Peptide at Physiological Calcium Concentration	X	X
25853	Chemical Shift Assignments and Structure Determination for spider toxin, U33-theraphotoxin-Cg1c	X	X
25856	Solution structure of translation initiation factor from Staphylococcus aureus Mu50	X	X
25857	NMR Solution Structure of Lacticin Q and Aureocin A53	X	X
25858	Solution Structure of Lacticin Q and Aureocin A53	X	X
25859	Productive complex between MMP-12 and synthetic triple-helical collagen, revealed through paramagnetic NMR	X	X
25860	Backbone resonance assignments for S. aureus DHFR complexed with NADPH and Trimethoprim	X	X
25861	Backbone resonance assignments for S. aureus DHFR complexed with NADPH	X	X
25863	Adenylate cyclase toxin RTX domain from Bordetella pertussis	X	X
25867	An NMR/SAXS structure of the PKI domain of the honeybee dicistrovirus, Israeli acute paralysis virus (IAPV) IRES	X			X
25868	Solution NMR Structure of Designed Protein DA05R1, Northeast Structural Genomics Consortium (NESG) Target OR690	X	X
25869	Solution structure of LptE from Pseudomonas Aerigunosa	X	X
25872	TrkA transmembrane domain NMR structure in DPC micelles	X	X
25873	Free RSK1 683-735 peptide	X	X
25877	Solution structure of cecropin P1 with LPS	X	X
25881	Chemical shift assignment of yeast Hit1 protein zinc finger	X	X
25883	DD homodimer	X	X
25886	Solution structure of acyl carrier protein LipD from Actinoplanes friuliensis	X	X
25887	Solution structure of the SLURP-2, a secreted isoform of Lynx1	X	X
25898	3D Structure of Decoralin-NH2 by Solution NMR	X	X
25899	Solution NMR Structure of Antiparallel Myosin-10:GCN4 Tandem Coiled-Coil	X	X
25900	NRAS Isoform 5	X	X
25902	actinin-1 EF hand 3,4 Bound to Cav1.2 IQ Motif	X	X
25903	Glucose as non natural nucleobase	X		X
25905	Solution structure of the bromodomain of Trypanosoma brucei Bromodomain Factor 2(BDF2)	X	X
25906	Glucose as a nuclease mimic in DNA	X		X
25907	solution structure of reduced human cytochrome c	X	X
25908	Solution structure of oxidized human cytochrome c	X	X
25911	VG16KRKP solution structure in C.neoformans live cells	X	X
25912	Backbone 1H, 13C, and 15N Chemical Shift of bacterial IscA protein	X	X
25913	Solution structure of RNF126 N-terminal zinc finger domain	X	X
25914	Solution structure of RNF126 N-terminal zinc finger domain in complex with BAG6 Ubiquitin-like domain	X	X
25915	Photoswitchable G-quadruplex	X		X
25918	Solution NMR structure of Erythrobacter litoralis PhyR response regulator REC domain	X	X
25921	NMR assignment of the 65-residue-long inactivating factor of glutanmine synthetase I from cyanobacterirum Synechocystis sp. PCC 6803	X	X
25924	Drosha Quad	X	X
25925	Chemical shift assignments of rv3053c from Mycobacterium tuberculosis in the oxidized state	X	X
25927	Curli secretion specificity factor CsgE W48A/F79A mutant	X	X
25933	NSD1-PHD_5-C5HCH tandem domain structure	X	X
25934	Nizp1-C2HR zinc finger structure	X	X
25942	Full-length WT SOD1 in DPC MICELLE	X	X
25943	3D NMR solution structure of NLRP3 PYD	X	X
25944	Solution structure of AVR3a_60-147 from Phytophthora infestans	X	X
25945	The NMR Structure of the Cdc42-interacting region of TOCA1	X	X
25950	1H, 13C, and 15N chemical shift assignments of the mannose-bound lectin from Ralstonia solanacearum	X	X
25951	1H, 13C, and 15N chemical shift assignments of the fucose-bound lectin from Ralstonia solanacearum	X	X
25952	1H, 13C, and 15N chemical shift assignments of the free lectin from Ralstonia solanacearum	X	X
25953	Structure of CCHC zinc finger domain of Pcf11	X	X
25954	Bt1.8 peptide	X	X
25955	Solution structure of reduced and zinc-bound RsrA	X	X
25956	Solution structure of oxidised RsrA and without zinc ion	X	X
25957	Structure of D19S variant of the Penicillium Antifungal Protein (PAF)	X	X
25958	p63/p73 hetero-tetramerisation domain	X	X
25965	Solution structure of N-terminal extramembrane domain of SH protein	X	X
25966	Solution structure of C-terminal extramembrane domain of SH protein	X	X
25968	NMR resonance assignments of the apple allergen Mal d 1.0101	X	X
25970	NMR structure of the Acidic domain of SYNCRIP (24-140)	X	X
25972	Solution structure of V26A mutant of Ubiquitin at pH 6.0	X	X
25973	Solution structure of V26A mutant of Ubiquitin at pH 2.0	X	X
25974	Structure of calcium-bound form of Penicillium antifungal protein (PAF)	X	X
25975	Structure and Dynamics of the Geobacillus stearothermophilus IF2 G3-subdomain	X	X
25976	Solution structure of the HYD1 hydrophobin from Schizophyllum commune	X	X
25979	protein complex	X	X
25982	Peptide model of 4-stranded beta-arch.	X	X
25983	Solution NMR structure of ligand free sterol carrier protein 2 like 2 from Aedes aegypti	X	X
25984	Solution NMR structure of palmitated SCP2L2 from Aedes aegypti	X	X
25985	NMR Structure of the C-Terminal Domain of human APOBEC3B	X	X
25986	Solution structure of the F87M/L110M variant of transthyretin in the monomeric state	X	X
25987	Solution structure of the T119M variant of transthyretin in its monomeric state	X	X
25988	BAZ2B PHD	X	X
25989	1H, 13C, and 15N Chemical Shift Assignments of HAdV E1A243 (E1A 12S)	X	X
25990	1H, 13C, and 15N Chemical Shift Assignments of HAdV E1A289 (E1A-13S)	X	X
25991	1H, 13C, and 15N Chemical Shift Assignments of HAdV E1ACR3 (E1A CR3)	X	X
25992	Backbone and Side Chain Chemical Shift Assignments for the myosin IIA fragment 1893-1937 (MPT)	X	X
25993	The Solution Structure of Human gammaC-crystallin	X	X
25994	Backbone 1H, 13C, and 15N Chemical Shift Assignments for designed protein E_1r26	X	X
25995	Protein complex	X	X
25996	Solution structure of the J-K region of EMCV IRES	X			X
25997	Solution structure of the J domain of EMCV IRES	X			X
25998	Solution structure of the K domain of EMCV IRES	X			X
25999	Solution structure of the St domain of EMCV IRES	X			X
26000	Solution structure of the delta-J-delta-K domain of EMCV IRES	X			X
26001	Structure, Dynamics and functional Aspects of the antifungal protein sfPAFB	X	X
26002	HIGH RESOLUTION SOLUTION NMR STRUCTURE OF THE SPIDER VENOM PEPTIDE U3-SCYTOTOXIN-STH1A	X	X
26003	HIGH RESOLUTION SOLUTION NMR STRUCTURE OF THE SPIDER VENOM PEPTIDE U3-SCYTOTOXIN-STH1H	X	X
26004	HIGH RESOLUTION SOLUTION NMR STRUCTURE OF THE SPIDER VENOM PEPTIDE U5-SCYTOTOXIN-STH1A	X	X
26010	NMR structure of the Mycobacterium tuberculosis LppM (Rv2171) protein folded domain.	X	X
26011	Apo solution structure of Hop TPR2A	X	X
26016	Solution Structure of Ca2+-bound C2 domain from Protein Kinase C alpha in the form of complex with V5-pHM peptide	X	X
26022	Solution structure of translation initiation factor IF1 from wolbachia endosymbiont strain TRS of Brugia malayi	X	X
26024	RNA Bulge Loop that Specifically Binds Metal Ions	X			X
26025	1H, 13C, and 15N Chemical Shift Assignments for Q4DY78	X	X
26031	Solution structure of BOLA3 from Homo sapiens	X	X
26033	Structural insight for dynamics of r(CGG) motif RNA found in Fragile X syndrome/ Fragile X tremor ataxia at 25 degree C	X			X
26034	NMR assignment and structure of a peptide derived from the membrane proximal external region of HIV-1 gp41 in the presence of dodecylphosphocholine micelles	X	X
26035	NMR assignment and structure of a peptide derived from the membrane proximal external region of HIV-1 gp41 in the presence of hexafluoroisopropanol	X	X
26036	KYE21 structure in LPS micelles	X	X
26037	RWS21 structure in LPS	X	X
26038	WWWKYE21 structure in LPS	X	X
26040	Solution structure of pseudin-2 analog (Ps-P)	X	X
26045	Solution structure of the de novo mini protein HHH_06	X	X
26046	Solution structure of the de novo mini protein EEH_04	X	X
26047	Lysine dimethylated FKBP12	X	X
26048	1H, 13C, 15N backbone and side-chain resonance assignment of Nostoc sp. C139A variant of the heme nitric oxide/oxygen binding (H-NOX) domain	X	X
26049	STRUCTURE OF DK17 IN GM1 LUVS	X	X
26050	STRUCTURE OF DK17 IN POPC:POPG:CHOLESTEROL:GM1 LUVS	X	X
26051	STRUCTURES OF DK17 IN TBLE LUVS	X	X
26052	Solution structure of MapZ extracellular domain first subdomain	X	X
26053	Solution structure of MapZ extracellular domain second subdomain	X	X
26055	Solution Structure of BMAP-28(1-18)	X	X
26057	Solution Structure of Mutant of BMAP-28(1-18)	X	X
26058	Backbone 1H, 13C, and 15N Chemical Shift Assignments for a 58 truncated variant of the CI repressor from the temperated bacteriophage Tp901-1	X	X
26062	Solution structure of the toxin ISTX-I from Ixodes scapularis	X	X
26065	NMR solution structure of PawS Derived Peptide 21 (PDP-21)	X	X
26066	NMR solution structure of PawS Derived Peptide 20 (PDP-20)	X	X
26068	Structure of DNA-binding HU protein from micoplasma Mycoplasma gallisepticum	X	X
26069	Toward the real-time monitoring of HPV-16 E7 phosphorylation events	X	X
26300	The structure of SeviL, a GM1b/asialo-GM1 binding R-type lectin from the mussel Mytilisepta virgata	X	X
26301	Crystal structure of higher plant heme oxygenase-1 and the mechanism of interaction with ferredoxin	X	X
26307	Sensitivity-Enhanced Solid-state NMR Detection of Structural Differences and Unique Polymorphs in Pico- to Nanomolar Amounts of Brain-derived and Synthetic 42-residue Amyloid-b Fibrils.	X	X
26312	Ufm1	X	X
26314	Backbone 1H, 13C, 15N and Side chain CB Chemical Shift Assignments for Paip2A	X	X
26315	Backbone 1H, 15N and HA Chemical Shift Assignments for Paip2A(25-83)	X	X
26316	Backbone 1H, 13C, 15N, HA and Side chain 13C Chemical Shift Assignments for RRM2 of PABPC1	X	X
26317	Backbone 1H, 13C, 15N, HA and Side Chain 13C Chemical Shift Assignments for RRM3 of PABPC1	X	X
26318	Backbone 1H, 13C, 15N and CB Chemical Shift Assignments for RRM2/3	X	X
26319	Backbone 1H, 13C, 15N and CB Chemical Shift Assignments for RRM2/3 when in complex with 12mers of adenine	X	X		X
26320	Backbone 1H, 13C, and 15N Chemical Shift Assignments for RRM2/3 in complex with Paip2A(25-83)	X	X
26331	Backbone 1H, 13C, and 15N Chemical Shift Assignments for tyrosine kinase A domain 5	X	X
26503	A 13C Labeling Strategy Reveals a Range of Aromatic Side Chain Motion in Calmodulin	X	X
26504	A Dynamic Pharmacophore Drives the Interaction between Psalmotoxin-1 and the Putative Drug Target Acid-Sensing Ion Channel 1a	X	X
26505	13C NMR Relaxation Studies of RNA Base and Ribose Nuclei Reveal a Complex Pattern of Motions in the RNA Binding Site for Human U1A Protein	X			X
26506	Analysis of 15N-1H NMR Relaxation in Proteins by a Combined Experimental and Molecular Dynamics Simulation Approach: Picosecond-Nanosecond Dynamics of the Rho GTPase Binding Domain of Plexin-B1 in the Dimeric State Indicates Allosteric Pathways	X	X
26507	Whole-Body Rocking Motion of a Fusion Peptide in Lipid Bilayers from Size-Dispersed 15N NMR Relaxation	X	X
26508	Transient small molecule interactions kinetically modulate amyloid b peptide self-assembly	X	X
26509	Backbone resonance assignments and secondary structure determination for the human PHF6-ePHD1	X	X
26510	The Sortase A Enzyme That Attaches Proteins to the Cell Wall of Bacillus anthracis Contains an Unusual Active Site Architecture	X	X
26511	Anisotropic rotational diffusion of perdeuterated HIV protease from 15N NMR relaxation measurements at two magnetic fields	X	X
26512	Thermal stability of chicken brain a-spectrin repeat 17: a spectroscopic study	X	X
26513	The Apo-structure of the Low Molecular Weight Protein-tyrosine Phosphatase A (MptpA) from Mycobacterium tuberculosis Allows for Better Target-specific Drug Development	X	X
26514	Temperature Dependence of Molecular Interactions Involved in Defining Stability of Glutamine Binding Protein and Its Complex with L-Glutamine	X	X
26515	Targeting and Maturation of Erv1/ALR in the Mitochondrial Intermembrane Space	X	X
26516	Transient small molecule interactions kinetically modulate amyloid b peptide self-assembly	X	X
26517	TAM DOMAIN OF TIP5_BAZ2A	X	X
26519	Studying Invisible Excited Protein States in Slow Exchange with a Major State Conformation	X	X
26520	Studying Invisible Excited Protein States in Slow Exchange with a Major State Conformation	X	X
26525	Structure, Dynamics, and Kinetics of Weak Protein Protein Complexes from NMR Spin Relaxation Measurements of Titrated Solutions	X	X
26526	UBCH10	X	X
26528	UBCH10 in complex with WHB	X	X
26529	WHB in complex with UBCH10	X	X
26530	NMR assignment of intrinsically disordered self-processing module of FrpC protein of Neisseria meningitidis	X	X
26532	Assignment of the BeF3-activated PmrA response regulator from Klebsiella pneumoniae	X	X
26533	Targeting and Maturation of Erv1/ALR in the Mitochondrial Intermembrane Space	X	X
26535	Assignment of the BeF3-activated PmrA response regulator from Klebsiella pneumoniae in complex with the promoter DNA	X	X
26536	Short hydrophobic peptides with cyclic constraints are po-tent GLP-1R agonists.	X	X
26537	Short hydrophobic peptides with cyclic constraints are po-tent GLP-1R agonists.	X	X
26538	Short hydrophobic peptides with cyclic constraints are po-tent GLP-1R agonists.	X	X
26543	Type III Secretion Protein	X	X
26544	Prostate associated gene 4 (PAGE4) Wild Type	X	X
26545	Prostate associated gene 4 (PAGE4) phosphorylated	X	X
26546	Type III Secretion Protein	X	X
26547	STIL binding to the Polo-box 3 of PLK4 regulates centriole duplication - Backbone assignment of human Polo-box 3 bound to STIL	X	X
26549	Backbone 1H, 13C and 15N assignment of the intrinsically disordered region of HCV protein NS5A (191-447)	X	X
26550	Sequence-specific solid-state NMR assignments of the mouse ASC PYRIN domain in its filament form	X	X
26551	Backbone resonance assignments of the human p73 DNA binding domain	X	X
26554	Chemical shift assignments of K2 dehydrin in the presence of SDS micelles	X	X
26557	Disordered monomeric alpha-synuclein in 20 mM HEPES buffer (pH 7)	X	X
26558	Chemical shift assignments of the fibronectin III like domains 7-8 of type VII collagen	X	X
26564	Y-family polymerase Dbh (dinB homolog) from Sulfolobus acidocaldarius 1H, 15N, and 13C chemical shifts	X	X
26569	Backbone chemical shift assignments for TCR_3c8m_t55a	X	X
26573	Tom1 negatively modulates binding of Tollip to phosphatidylinositol 3-phosphate via a coupled folding and binding mechanism	X	X
26574	Tom1 negatively modulates binding of Tollip to phosphatidylinositol 3-phosphate via a coupled folding and binding mechanism	X	X
26575	Gli3_1_90 assignment	X	X
26578	NMR Assignment of Homo sapiens cytochrome c in its oxidized state	X	X
26579	Resonance assignment of the N-terminal domain of hLCN2-R	X	X
26583	Backbone 1H, 13C and 15N chemical shift assignments for the ternary L28F ecDHFR:TETRAHYDROFOLATE:NADP+ complex	X	X
26584	Backbone 1H, 13C and 15N chemical shift assignments for the ternary L28F ecDHFR:FOLATE:NADP+ complex	X	X
26585	Backbone 1H, 13C and 15N chemical shift assignments for the binary L28F ecDHFR:NADPH complex	X	X
26597	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the N-terminal active domain of the gyrase B subunit of Pseudomonas aeruginosa	X	X
26598	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the N-terminal active domain of the gyrase B subunit of Pseudomonas aeruginosa with an inhibitor	X	X
26599	1H, 13Ca, 13Cb and 15N chemical shift assignment of coiled-coil motif from human Thanatos-associated protein 11	X	X
26603	Sequence-specific 1H, 15N, and 13C resonance assignments of the autophagy-related protein LC3C	X	X
26604	Protein resonance assignment at MAS frequencies approaching 100 kHz: a quantitative comparison of J-coupling and dipolar-coupling-based transfer methods	X	X
26605	Methyl resonances of Ubiquitin-like domain (1-76) of parkin in complex with R0RBR domain (141-465) of parkin.	X	X
26607	Neisseria meningititis Fic	X	X
26608	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the active domains of the type II topoisomerases from Pseudomonas aeruginosa	X	X
26609	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the active domains of the type II topoisomerases from Pseudomonas aeruginosa with a bis-pyridylurea inhibitor	X	X
26610	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the active domains of the type II topoisomerases from Streptococcus pneumoniae	X	X
26611	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the active domains of the type II topoisomerases from Streptococcus pneumoniae with a bis-pyridylurea inhibitor	X	X
26612	Transmembrane domain of E. coli OmpA in 8 m Urea	X	X
26613	Periplasmic chaperone Skp from E. coli in 8 m Urea	X	X
26614	Solid-state NMR assignment of MxiH (serotype 5a) T3SS needles	X	X
26616	1H, 13C and 15N Chemical Shift Assignments for human CBP-ID4	X	X
26618	Resonance assignment of DVU2108 that is part of the Orange Protein complex in Desulfovibrio vulgaris Hildenborough	X	X
26619	Amide/Methyl/Aromatic Chemical Shifts and Order Parameters of Free Barnase	X	X
26620	Amide/Methyl/Aromatic chemical shift and order parameter of Barnase-dCGAC	X	X	X
26625	PH domain of the Arf GAP ASAP1	X	X
26626	Backbone 1H, 13C and 15N resonance assignments for CaM-Fas-6-35 complex	X	X
26627	Backbone 1H, 13C and 15N resonance assignments for CaM-Fas-47-83 complex	X	X
26628	assignment of HuR RRM1-2	X	X
26629	SPOP-MATH	X	X
26630	Protein G Domain Beta-1 Wild Type	X	X
26631	SPOP_MATH_PUC complex	X	X
26632	Protein G Domain Beta-1 Sequence H	X	X
26634	Backbone and sidechain 1H, 13C, and 15N resonance assignments for Methylobacterium extorquens PqqD	X	X
26635	Backbone 1H, and 15N Chemical Shift Assignments for human K-Ras4B-GDP	X	X
26636	1H and 15N Chemical Shifts of Intrinsically Disordered Dehydrin ERD14 at Various Temperature and pH Values	X	X
26637	Backbone assignments of dengue virus NS4B N-terminal region	X	X
26638	Backbone and side chain chemical shift assignments of apolipophorin III from Galleria mellonella	X	X
26639	1H, 13C and 15N Chemical Shift Assignments for human CBP-ID4	X	X
26641	Backbone assignments for E. coli MurD	X	X
26642	Backbone 1H, 13C and 15N Chemical Shift Assignments for the Plakin Repeat Domain of Envoplakin	X	X
26643	Backbone 1H, 13C, and 15N chemical shift assignments for the N-WASP-GBD Nck complex	X	X
26644	Backbone assignment of the N-terminal 24-kDa fragment of Escherichia coli topoisomerase IV ParE subunit	X	X
26645	Backbone 1H, 15N, 13C NMR assignment of the 518-627 fragment of the androgen receptor encompassing N-terminal and DNA Binding domains	X	X
26648	FVO Plasmodium falciparum AMA1	X	X
26649	1H, 13C, 15N chemical shift assignments of initiation factor 1 from Pseudomonas aeruginosa	X	X
26651	1H, 13C, and 15N assignments of the Pleckstrin Homology Domain of Akt1.	X	X
26652	1H, 13C, and 15N assignments of the Pleckstrin Homology Domain of Akt1 bound to Calmodulin.	X	X
26653	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Nogo-A-Delta20	X	X
26654	1H, 13C and 15N resonance assignments of the intrinsically disordered region of the nuclear envelope protein emerin	X	X
26657	Resonance Assignment of MERS-CoV macro domain	X	X
26658	Backbone 1H, 13C, and 15N Chemical Shift Assignments for SczA from Streptococcus agalactiae	X	X
26659	1H, 13C, and 15N Chemical Shift Assignments for SRC in the sugar-free state	X	X
26660	1H, 13C, and 15N Chemical Shift Assignments for SRC in the lactose-bound state	X	X
26661	1H, 13C, and 15N Chemical Shift Assignments for SRC in the 6'-sialyllactose-bound state	X	X
26662	Backbone 1H, 13C and 15N Chemical Shift Assignments for c-Myc-1-88	X	X
26663	Backbone 1H, 13C and 15N Chemical Shift Assignments for c-Myc-1-88, pS62	X	X
26664	UBXD1	X	X
26667	Backbone and side chain order parameters for calcium-bound calmodulin (E84K)	X	X
26670	order parameters for the CaM(E84K):nNOS(p) complex	X	X
26672	Backbone 1H, 13C (C, CA, CB), and 15N Chemical Shift Assignments for the low complexity prion-like domain of Fused in Sarcoma (FUS 1-163)	X	X
26674	Structural basis for the inhibition of voltage-gated sodium channels with conotoxin-muOxi-GVIIJ	X	X
26675	Structural basis for the inhibition of voltage-gated sodium channels with conotoxin-muOxi-GVIIJ	X	X
26676	1H, 13C, and 15N Chemical Shift Assignments for the redox-stable inhibitor of SPSB2-iNOS interaction - CP1	X	X
26677	1H, 13C, and 15N Chemical Shift Assignments for redox-stable cyclic peptide inhibitors of SPSB2-iNOS interaction - CP2	X	X
26678	Backbone resonance assignments of Abeta(1-42) in aqueous trifluoroethanol	X	X
26679	Backbone resonance assignments of pyroglutamate Abeta(3-42) in 50 % trifluoroethanol	X	X
26680	backbone resonance assignment of pEAbeta(3-42) in 40 % trifluoroethanol	X	X
26681	Chemical shifts of ApoCaM1234 (CaM D20A, D56A, D93A, D129A)	X	X
26682	Chemical shifts of ApoCaM12 (CaM D20A, D56A)	X	X
26683	Chemical shifts of ApoCaM34 (CaM D93A, D129A)	X	X
26685	Chemical shifts of calcium saturated CaM12 (CaM D20A, D56A)	X	X
26686	Chemical shifts of calcium saturated CaM34 (CaM D93A, D129A)	X	X
26687	Chemical shifts of calcium saturated CaM34 (CaM D93A, D129A) with the iNOS CaM-binding domain peptide	X	X
26690	Backbone and sidechain 1H, 13C, and 15N resonance assignments for Methylobacterium extorquens PqqD + PqqA	X	X
26691	Chemical shift assignment of yeast Bcd1 protein zinc finger	X	X
26692	Solid State NMR sequential assignment of Amyloid b(1-42) fibrils	X	X
26693	Backbone resonance assignments for apo S. aureus DHFR	X	X
26694	Backbone resonance assignments for S. aureus S1 DHFR complexed with NADPH and Trimethoprim	X	X
26695	Backbone resonance assignments for S. aureus S1 DHFR complexed with NADPH	X	X
26697	Denatured CSE4 Protein from Saccharomyces cerevisiae	X	X
26702	Partial assignments of full-length (deltaAH)-NS5A protein from Hepatitis C Virus (Con1) produced in wheat germ cell-free system	X	X
26703	RDPheH25-117	X	X
26705	Backbone chemical shifts of the oligomerization inhibited mutant of the CASKIN2 SAM domain tandem	X	X
26708	Backbone Assignment of Human NEMO residues 258-350	X	X
26709	Backbone Assignment of Human linear diubiquitin	X	X
26710	Relaxation and model-free data from beta-2-microglobulin and the heavy chain of HLA-B*27:05 in complex with the peptide pVIPR	X	X
26711	Relaxation and model-free data from beta-2-microglobulin and the heavy chain of HLA-B*27:05 in complex with the peptide TIS	X	X
26712	Relaxation and model-free data from beta-2-microglobulin and the heavy chain of HLA-B*27:09 in complex with the peptide pVIPR	X	X
26713	Relaxation and model-free data from beta-2-microglobulin and the heavy chain of HLA-B*27:09 in complex with the peptide TIS	X	X
26714	Relaxation and model-free data from human beta-2-microglobulin	X	X
26715	beta-endorphin	X	X
26716	Backbone HN, 15N, 13Ca shifts for GB1 in 0%, 10%, 25%, 50% ionic liquid [C4-mim]Br, and KBr	X	X
26718	Domain Swapped HIV RNase H	X	X
26721	RXFP1-LDLa linker	X	X
26722	1H, 15N, 13C backbone shift assignments of PhyR protein from Erythrobacter litoralis	X	X
26726	Backbone 1H, 15N, and 13C resonance assignments of the Extracellular Adherence Protein Domain 4	X	X
26727	1H, 13C and 15N assignment for the C-terminal domain of human Doublecortin	X	X
26730	Structural and dynamics studies of Pax5 reveal asymmetry in stability and DNA binding by the Paired domain	X	X
26731	Structural and dynamics studies of Pax5 reveal asymmetry in stability and DNA binding by the Paired domain	X	X	X
26732	Methyl 1H, 13C Chemical Shift Assignments for MAPK p38g	X	X
26733	Backbone 1H, 13C, and 15N Chemical Shift Assignments for MAPK p38g	X	X
26734	D53S/D55S variant of Penicillium Antifungal Protein, PAF	X	X
26735	LdcI Assocating Domain of RavA Backbone Assignment	X	X
26738	1H, 13C, and 15N Chemical Shift Assignments for Ca2+-bound human mS100A9	X	X
26741	Backbone and Partial Side-Chain Chemical Shift Assignments and Dynamics Measurements for The Catalytic Domain of Human Prolyl Hydroxylase Domain 2 (PHD2) With Zn(II) and 2-Oxoglutarate (2OG)	X	X
26742	Backbone and Partial Side-Chain Chemical Shift Assignments and Dynamics Measurements for The Catalytic Domain of Human Prolyl Hydroxylase Domain 2 (PHD2) With Zn(II), 2-Oxoglutarate (2OG) and Hypoxia Inducible Factor-alpha (HIF-alpha) Peptide	X	X
26744	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the m1A22 tRNA methyltransferase TrmK from Bacillus subtilis	X	X
26745	Backbone 1H, 13C, and 15N assignments for Sortase C1 (SrtC1) from Streptococcus pneumoniae	X	X
26746	Backbone resonance assignment of an inhibitory G-alpha domain	X	X
26748	NMR study of Met-1 Human Angiogenin - 1H, 13C, 15N backbone and side chain resonance assignment	X	X
26751	Backbone NMR assignments of the 2B4 T-cell receptor.	X	X
26752	Backbone 1H, 13C and 15N resonance assignments of the OB domain of the single stranded DNA binding protein hSSB1 (NABP2/OBFC2B)	X	X
26753	NMR study of non-structural proteins - 1H, 13C, 15N resonance assignment of macro domain of Venezuelan equine encephalitis virus (VEEV) in complex with ADP-ribose	X	X
26754	BAZ2A PHD	X	X
26755	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the intrinsically disordered NHE1 distal tail	X	X
26756	1H, 13C, 15N backbone and 1H, 13C methionine methyl chemical shifts of human wildtype Glucocorticoid receptor Ligand Binding Domain	X	X
26757	1H, 13C, 15N backbone and 1H, 13C methionine methyl chemical shifts of human F602S Glucocorticoid receptor Ligand Binding Domain	X	X
26758	Backbone 1H, 13C, and 15N Chemical Shift Assignments for p38 gamma MAPK	X	X
26759	Backbone resonance assignments for the SET domain of the human methyltransferase NSD2	X	X
26762	Elk1 C-terminus aa309-429	X	X
26765	NMR backbone 1H, 13C and 15N chemical shift assignments of human S-phase kinase-associated protein 1 (Skp1)	X	X
26766	1H, 13C and 15N backbone resonance assignment for the 40.5 kDa catalytic domain of Ubiquitin Specific Protease 7 (USP7)	X	X
26768	1H, 15N and 13C backbone assignments of the catalytic domain of human NSD2	X	X
26769	1H, 13C and 15N resonance assignments for the response regulator CheY3 from Rhodobacter sphaeroides	X	X
26771	Backbone and Side-chain chemical shift assignments of C. elegans TDP2 Ubiquitin Association domain	X	X
26772	Chemical shift assignments of PfEMP1 ATSCore - variant PFF0845c	X	X
26773	Chemical shift assignments of Spectrin repeat a17	X	X
26775	Backbone and side chain 1H, 13C, and 15N Chemical Shift assignments for Plasmodium falciparum SUMO.	X	X
26776	1H, 13C and 15N resonance assignments for the response regulator CheY3 from Rhodobacter spheroids at pH 7.25 with BeF3-	X	X
26777	1H, 13C and 15N resonance assignments for the response regulator CheY3 from Rhodobacter spheroids at pH 4.5 with BeF3-	X	X
26778	1H, 13C and 15N resonance assignments for the response regulator CheY3 from Rhodobacter spheroids at pH 4.5 in the absence of BeF3-	X	X
26779	Human Cdc25B complete catalytic domain: backbone assignments (1H, 13CA, 13CB, 13C', 15N), 15N relaxation times (T1 and T2), heteronuclear NOEs and residual dipolar couplings (NH)	X	X
26780	Chemical Shift Assignments for Interleukin-36alpha	X	X
26782	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human USP7 in complex with ICP0 from HSV-1	X	X
26783	APC11 binding Ubiquitin Variant	X	X
26784	Ubiquitin Variant in complex with APC11	X	X
26785	APC11 in complex with Ubiquitin Variant	X	X
26786	Elk1 C-terminus aa309-429 - 8 phosphorylated sites (pS337-pT354-pT364-pT369-pS384-pS390-pT418-pS423)	X	X
26787	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human RIT1	X	X
26788	1H, 13C and 15N backbone resonance assignments and 15N relaxation data of the PDZ tandem of Whirlin	X	X
26789	1H, 13C and 15N resonance assignments for the response regulator CheY3 from Rhodobacter sphaeroides at pH 7.3 in the absence of Mg2+	X	X
26791	Backbone 1H, 13C, and 15 N Chemical Shift Assignment for human Langerin CRD	X	X
26792	Backbone assignment of p23 GOLD domain	X	X
26793	Backbone assignment of p24 GOLD domain	X	X
26794	NMR Assignment of L-Dfp6,D-Trp8-SRIF	X	X
26795	NMR Assignment of L-Dfp7,D-Trp8-SRIF	X	X
26796	NMR Assignment of L-Dfp11,D-Trp8-SRIF	X	X
26797	NMR Assignment of L-Dfp6,L-Msa7,D-Trp8-SRIF	X	X
26798	NMR Assignment of L-Dfp11,L-Msa7,D-Trp8-SRIF	X	X
26799	NMR Assignment of L-Dfp6,L-Msa7,D-Trp8, L-Dfp11-SRIF	X	X
26800	Resonance assignments of a VapC family toxin from Clostridium thermocellum	X	X
26801	1H, 13C and 15N Assignment of NFU1 Iron-Sulfur Cluster Scaffold Homolog from Homo sapiens, Northeast Structural Genomics Consortium (NESG) Target HR2876	X	X
26803	Recombinant human carcinoembryonic antigen related cell adhesion molecule 1 (hCEACAM1) N-terminal Igv domain	X	X
26806	Chemical Shift Assignment of Tom1 VHS Domain	X	X
26807	The DNA-binding domain of the human Egr-1 in the free state	X	X
26808	Egr-1 - DNA complex	X	X	X
26811	13C Chemical shifts of free backbone carbonyls in bovine rhodopsin and Meta II	X	X
26814	Backbone 1H, 13C, and 15N chemical shift assignments for Protein Tyrosine Phosphatase 1B residues 1-284	X	X
26821	apoTrpR	X	X
26822	Backbone 1H, 13C, and 15N Chemical Shift Assignments of Human integrin alpha1 I domain mutant E317A	X	X
26823	Backbone 1H, 13C, and 15N Chemical Shift Assignments, HNHA scalar coupling, and 15N backbone relaxation data for TDP-43 C-terminal domain wild type	X	X
26826	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TDP-43 C-terminal domain ALS-associated variant A321G	X	X
26827	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TDP-43 C-terminal domain ALS-associated variant A321V	X	X
26828	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TDP-43 C-terminal domain engineered variant A326P	X	X
26829	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TDP-43 C-terminal domain ALS-associated variant Q331K	X	X
26830	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TDP-43 C-terminal domain ALS-associated variant M337V	X	X
26831	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TDP-43 C-terminal domain engineered variant M337P	X	X
26832	Backbone 1H, 13C, and 15N Chemical shift assignments for Protein Tyrosine Phosphatase 1B YAYA (Y152A, Y153A) variant.	X	X
26833	Backbone 1H, 13C, and 15N Chemical Shift Assignments for alpha-N Catenin C-terminal domain	X	X
26835	Backbone 1H, 13C, 15N Chemical shift assignments for Protein Phosphatase 1B T178A variant	X	X
26836	Backbone 1H, 13C, and 15N chemical shift assignments for Protein Tyrosine Phosphatase 1B L192A variant	X	X
26837	Backbone 1H, 13C, and 15N chemical shift assignments for Protein Tyrosine Phosphatase 1B N193A variant.	X	X
26838	Backbone 1H, 13C, and 15N chemical shift assignments for Protein Tyrosine Phosphatase 1B (1-301) in complex with TCS401	X	X
26840	'1H, 13C, and 15N Chemical Shift Assignments for the periplasmic domain of GacS histidine-kinase'	X	X
26841	Chemical shift assignment of CBP-ID3	X	X
26844	NMR assignments for the insertion domain of bacteriophage Sf6 coat protein	X	X
26845	Field dependent R1 and R2 relaxation in B3 domain of protein G (GB3)	X	X
26846	Backbone assignments of the full length Dengue Virus NS4B protein in micelles	X	X
26848	1H, 15N, 13C backbone resonance assignments of human soluble catechol O-methyltransferase in complex with 3,5-dinitrocatechol and S-adenosyl-L-methionine	X	X
26851	1H, 15N, 13C backbone resonance assignments of human soluble catechol O-methyltransferase in complex with 3,5-dinitrocatechol and Sinefungin	X	X
26852	Partial Backbone 1H, 13C, and 15N Chemical Shift Assignments for VirB8 from Brucella suis	X	X
26854	AsLOV2 (Avena sativa phototropin 1, LOV2 domain)	X	X
26855	phosducin chemical shift	X	X
26858	Backbone chemical shift assignments for the U1 protein from the Bas-Congo virus. Seattle Structural Genomic Center for Infectious Disease target RhbaA.18619.a.D16.	X	X
26861	Tunicate_crystallin_Ca2+form	X	X
26862	Stress Response Peptide-2; Manduca Sexta	X	X
26863	ScribPDZ4apo	X	X
26864	ScribPDZ4withp22phoxC10	X	X
26866	SNX27 PDZ domain	X	X
26867	HADDOCK model of the complex between the KIX domain of CBP and the transactivation domain of p65	X	X
26870	NMR chemical shifts of the N-terminal SH3 domain from CT10-Regulator of Kinase (Crk)-II	X	X
26873	Backbone assignment of NS2B-NS3 Protease from Zika Virus	X	X
26874	Roseltide rT1	X	X
26875	Backbone chemical shift assignments of H24N mutant of Vibrio cholerae peptidyl-tRNA hydrolase	X	X
26876	Backbone chemical shift assignments of N14D mutant of Vibrio cholerae peptidyl-tRNA hydrolase	X	X
26877	Backbone chemical shift assignments of N72D mutant of Vibrio cholerae peptidyl-tRNA hydrolase	X	X
26878	Backbone chemical shift assignments of N118D mutant of Vibrio cholerae peptidyl-tRNA hydrolase	X	X
26880	1H, 13C and 15N backbone assignments of the R3 domain of talin (residues 781-911) carrying four mutations T809I, T833V, T867V and T901I (R3-IVVI)	X	X
26881	Backbone 1H, 15N assignment for LC3B	X	X
26882	Dual-targeting anti-angiogenic cyclic peptides as potential drug leads for cancer therapy	X	X
26883	HIV-1 Capsid-SP1 in immature virus-like particles	X	X
26884	Backbone assignment of Rhea (talin) F0.	X	X
26887	Complete 1H 13C 15N chemical shift assignments of Mycobacterial Heparin-Binding Hemagglutinin	X	X
26888	Complete 1H 13C 15N chemical shift assignments of Mycobacterial Heparin-Binding Hemagglutinin in association with heparin analogs	X	X
26889	1H, 13C assignments for bovine insulin	X	X
26891	Solution and solid-state NMR studies of soluble tissue factor	X	X
26893	Backbone resonance assignments of monomeric SOD1 in dilute environment	X	X
26894	Backbone resonance assignments of monomeric SOD1 in crowded environment	X	X
26900	Beta-endorphin salt-free amyloid fibrils	X	X
26902	Backbone chemical shift assignment of the N-terminal domain of the phosphoprotein of Respiratory Syncytial Virus	X	X
26903	Backbone chemical shift assignment of a deletion mutant of Respiratory Syncytial Virus phosphoprotein without oligomerization domain	X	X
26904	Backbone chemical shift assignment of a tetrameric N-terminal fragment of Respiratory Syncytial Virus phosphoprotein (residues M1-R163)	X	X
26905	backbone chemical shift assignment of S23C mutant of the Respiratory Syncytail Virus phosphoprotein	X	X
26906	Backbone chemical shift assignment of the C-terminal domain of Respiratory Syncytial Virus phosphoprotein	X	X
26908	Backbone 1H, 13C, 15N chemical shift assignments of portions of Thermotoga maritima flagellar motor proteins FliG (N-terminal domain; FliGN) and FliF (C-terminal domain; FliFC) in complex	X	X
26909	N-terminal domain of the E. coli DNA polymerase III delta subunit	X	X
26912	Chemical shift assignments of the first and second RRMs of Nrd1, a fission yeast MAPK target RNA binding protein	X	X
26913	Partially-Deuterated Samples of HET-s(218-289) Fibrils: Assignment and Deuterium Isotope Effect	X	X
26916	Recombinant Human Granulocyte-Colony Stimulating Factor variant C3 (G-CSFC3) backbone assignments	X	X
26919	1H, 15N and 13C resonance assignments and secondary structure of PulG, the major pseudopilin from Klebsiella oxytoca Type 2 Secretion System	X	X
26920	1H, 13C and 15N backbone resonance assignment of the TPR2B domain of mouse STI1	X	X
26923	Backbone and Ile, Leu, Val Methyl Chemical Shift Assignments for Rhizopus microsporus var. chinensis lipase	X	X
26924	13C and 15N Chemical Shift Assignments for Mouse Y145Stop Prion Protein Amyloid Fibrils	X	X
26925	13C and 15N Chemical Shift Assignments for human Y145Stop Prion Protein Amyloid Fibrils	X	X
26926	13C and 15N Chemical Shift Assignments for Syrian Hamster Y145Stop Prion Protein Amyloid Fibrils	X	X
26927	Backbone assignment of unlinked NS2B-NS3 Protease of Zika Virus in complex with acetyl-lysine-arginine	X	X
26928	Backbone assignment of unlinked NS2B-NS3 Protease of Zika Virus	X	X
26931	Backbone chemical shifts of the MBD2/3 methyl-cytosine binding domain from Ephydatia muelleri	X	X	X
26932	Backbone 1H, 13C, and 15N Chemical Shift Assignments for MTTTm	X	X
26933	Backbone assignment of unlinked NS2B-NS3 Protease of Zika Virus in complex with acetyl-lysine-arginine aldehyde	X	X
26934	Solution Structure of first stem-loop of Escherichia coli DsrA RNA	X			X
26935	Backbone 1H, 13C, and 15N Chemical Shift Assignments for KISS-1	X	X
26938	Iminoproton chemical shifts of ASH1 E3 28mer RNA stem-loop	X			X
26939	Iminoproton chemical shifts of ASH1 E3 42mer RNA stem-loop	X			X
26940	Backbone 1H, 15N and 13C assignments for LITAF	X	X
26944	mini monomeric TGF-b2-7m	X	X
26945	Human SMAD4 MH1 domain	X	X
26946	Backbone and Side Chain Chemical Shift Assignments for C-terminal truncated S100A4	X	X
26947	NMR resonance assignments of AIPL1 FKBP in complex with a farnesyl ligand	X	X
26948	Backbone chemical shift assignment of RNA recognition domain 2 of SART3	X	X
26949	Early Response to Dehydration 10 (ERD10) from Arabidopsis thaliana	X	X
26951	Backbone 1H, 13C, and 15N Chemical Shift Assignments for USP7 catalytic domain	X	X
26954	Fyn SH3 V39V/N53P/V55L delta56	X	X
26955	Fyn SH3 WT delta57	X	X
26956	Backbone assignment of S100A4 and C-ERMAD fragment of ezrin	X	X
26957	ICP4 DNA binding domain	X	X
26958	Backbone assignment of mouse prion (23-231) at pH 4 and 37C	X	X
26959	side-chain methyl order parameters, stereospecific resonance assignments, and relaxation rates for apo CzrA	X	X
26960	Quantitative mapping of MAP2c phosphorylation and 14-3-3 binding sites reveals key differences between MAP2c and Tau	X	X
26963	PSEUDOMONAS AERUGINOSA ICP	X	X
26964	Backbone 1H, 13C, and 15N Chemical Shift Assignments for an Exon-1 Fragment of Huntingtin at pH = 1.7 and T = 25 C.	X	X
26965	Backbone 1H, 13C, and 15N Chemical Shift Assignments for an Exon-1 Fragment of Huntingtin at pH = 7.1 and T = 4 C	X	X
26966	Backbone 1H, 13C, 15N backbone assignment of the human Heat Labile Enterotoxin (hLTB)	X	X
26967	Assignments of Dictyostelium GlcNAc-Skp1	X	X
26968	Assignments of Dictyostelium Skp1	X	X
26969	Backbone resonance assignments of the Pseudomonas aeruginosa major pilin PilA from strain PA14	X	X
26970	Chemical shifts of Lc-LTP2 in complex with DMPG	X	X
26971	Chemical shifts of Lc-LTP2 in complex with DHPC	X	X
26972	Backbone resonance assignments for the SET domain of human methyltransferase NSD3	X	X
26974	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Hsp31	X	X
26975	AILV Methyl Resonance Assignments for G protein alpha i3 subunit in the GDP-bound state	X	X
26976	AILV Methyl Resonance Assignments for G protein alpha i3 subunit in the GoLoco14-bound state	X	X
26977	An allosteric site in the T cell receptor constant domain plays a critical role in T cell signaling	X	X
26978	MeCP2 bound to methylated DNA	X	X	X
26979	Wild type fused Npu DnaE from Nostoc punctiforme with Phe +2 Extein	X	X
26980	Wild type fused Npu DnaE from Nostoc punctiforme with Gly +2 Extein	X	X
26981	Fused Npu DnaE GEP loop mutant from Nostoc punctiforme with Phe +2 Extein	X	X
26982	Chemical shift assignments of the RYBP NZF domain	X	X
26983	HBP(D24R)-Histamine-Seratonin methyl and amide order parameters	X	X
26984	Fused Npu DnaE GEP loop mutant from Nostoc punctiforme with Phe +2 Extein	X	X
26986	1H, 13C and 15N Chemical shift assignments of yeast thioredoxin Saccharomyces cerevisiae in the oxidized state by solution NMR spectroscopy.	X	X
26987	HIV1 protease folded and cold-denatured	X	X
26990	1H, 15N and 13C Chemical Shift Assignments of the Regulatory Domain of Human Calcineurin	X	X
26991	Full atom 1H, 13C, and 15N Chemical Shift Assignments for Mouse CCL5	X	X
26995	A consensus homeodomain	X	X
26996	Backbone assignments for NS2b, NS3 complex	X	X
26997	Backbone assignment of human 4E-BP1 (fragment 44 to 87) bound to mouse eIF4E	X	X
27002	Assignment of HuR RRM1-RRM2 tandem domain	X	X
27011	Relaxation data for sigma1.1 from Bacillus subtilis	X	X
27012	Chemical shift assignments (HN,N,CA,CB) of oxidised n-NmDsbD	X	X
27013	Chemical shift assignments (HN,N,CA,CB) of reduced n-NmDsbD	X	X
27014	Chemical shift assignments (HN,N,CA,CB) of oxidised c-NmDsbD	X	X
27015	Chemical shift assignments (HN,N,CA,CB) of reduced c-NmDsbD	X	X
27016	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the DHDD Region of GbnD4 KS14 from the Gladiolin Polyketide Synthase	X	X
27022	1H, 15N, 13C backbone resonance assignments of human phosphoglycerate kinase in a transition state analogue complex with ADP, 3-phosphoglycerate and magnesium trifluoride	X	X
27023	Ascl1_fragment_A	X	X
27024	Ascl1 fragment B	X	X
27025	Ascl1 fragment C	X	X
27026	Ascl1 fragment D	X	X
27027	N-terminally acetylated beta-Synuclein	X	X
27028	side-chain methyl order parameters, stereospecific resonance assignments, and relaxation rates for Zn(II) CzrA	X	X
27029	Backbone 1H, 13C, and 15N Chemical Shift Assignment for Human TRPV1 Sensing Domain	X	X
27030	Chemical shift assignments of DANCER-0, a dynamic pentamutant of the B1 domain of streptococcal protein G (GB1)	X	X
27031	Chemical shift assignment of DANCER-1, a natively folded and dynamic hexamutant of the B1 domain of streptococcal protein G (GB1)	X	X
27032	Chemical shift assignment of DANCER-3, a natively folded and dynamic pentamutant of the B1 domain of streptococcal protein G (GB1)	X	X
27033	1H, 13C and 15N Chemical Shift Assignments of cyclophilin 2 from Trichomonas vaginalis	X	X
27035	Backbone assignment of human Ube2T	X	X
27036	PR-R7 from staphylocoagulase of S. aureus Newman D2 Tager 104 strain	X	X
27037	Alanine chemical shifts of the N-terminal domain (residues 1-215) of HtpG, the Hsp90 from Escherichia coli. Northeast Structural Genomics Consortium Target ER697A.	X	X
27038	Alanine chemical shifts of the C-terminal dimerization domain (residues 511-624) of HtpG, the Hsp90 from Escherichia coli. Northeast Structural Genomics Consortium Target ER697C.	X	X
27039	Chemical shifts of amorphous-looking aggregates of the P23T mutant of human gamma-D-crystallin formed at pH 7.	X	X
27040	NMR resonance assignments of a hypoallergenic isoform of the major birch pollen allergen Bet v 1	X	X
27041	Backbone 1H, 13C, and 15N and partial sidechain 1H and 13C Chemical Shift	X	X
27044	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Sgt2_TPR	X	X
27045	Solid-state NMR chemical shifts of amyloid-like fibrils formed by huntingtin exon 1 with a 44-residue polyQ domain.	X	X
27051	1H, 15N and 13C resonance assignments of the Ixolaris, a tissue factor pathway inhibitor from the tick salivary gland	X	X
27052	Backbone 1H, 13C, and 15N and ALV methyl Chemical Shift Assignments of the yeast TIM9/10 complex	X	X
27053	NMR chemical shift assignments of a 22mer G-quadruplex formed within the KRAS proto-oncogene promoter region	X		X
27055	NMR structure of the RNA recognition motif 2 (RRM2) of the splicing factor RBM10	X	X
27056	C. elegans SAS-5 N-term backbone assignments	X	X
27057	Chemical Shift Assignment of the PP1 and Microtubule binding domain of human KNL-1	X	X
27058	Resonance assignment of MOAG-4 at pH 6.0	X	X
27059	15N, 13C assignments of Leptosphaeria Rhodopsin	X	X
27060	1H assignments for DecP-11 in solution	X	X
27062	1H, 13C and 15N NMR Assignments of a Bacterial Immunoglobulin- like Domain (group 2) of a Protein from a Bacterium Paenarthrobacter aurescens TC1	X	X
27064	Solution structure of the IgI domain of CD147	X	X
27066	Chemical Shift Assignment of the PP1 and Microtubule binding domain of phosphorylated human KNL-1	X	X
27079	Backbone Resonance Assignment of the BCL6-BTB/POZ Domain	X	X
27081	1H, 13C, and 15N backbone and side chain resonance assignments for a structured domain in atg32	X	X
27082	NMR backbone assignments of the Tyrosine kinase domain of human fibroblast growth receptor 3 in apo state and in complex with inhibitor PD173074	X	X
27083	NMR backbone assignment of the Tyrosine Kinase domain of human fibroblast receptor 3 in apo state and in complex with inhibitor PD173074	X	X
27084	beta-Ginkgotides: Hyperdisulfide-constrained peptides from Ginkgo biloba	X	X
27085	1H, 13C, 15N backbone NMR assignment of N-terminal domain of SaHPF	X	X
27093	Chemical shift assignment of human MOZART1 protein (mitotic-spindle organizing protein associated with a ring of gamma-tubulin 1)	X	X
27097	1H, 15N and 13C resonance assignments of Mvo10b	X	X
27098	1H, 15N and 13C resonance assignments of Mth10bTQQA	X	X
27099	Chemical shift assignment of gp17.1 by proton-detected solid-state NMR	X	X
27102	Backbone assignments for the Val66 prodomain of BDNF	X	X
27103	Backbone assignment for Met66 prodomain of BDNF	X	X
27104	Steroid receptor coactivator-2 (SRC-2/NCoA-2/GRIP1/TIF2) receptor interaction domain (RID) backbone NMR chemical shift assignments	X	X
27108	Backbone 1H, 13C, and 15N Chemical Shift Assignments for SH3 domain of Noxa1	X	X
27110	1H, 13C and 15N chemical shifts of HIV-1 gp41 cytoplasmic tail residues 707-751	X	X
27111	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Musashi2 RRM1	X	X
27112	1H, 15N and 13C assignments of Drosophila brain-type fatty acid-binding protein ligated with oleic acid	X	X
27121	Sequence Specific Backbone Assignment of the catalytic domain of HePTP (residues 44-339) at pH 7.8	X	X
27122	Sequence Specific Backbone Assignment of the catalytic domain of HePTP (residues 44-339) in presence of vanadate (inhibitor) at pH 7.8	X	X
27130	1H, 13C, and 15N chemical shift assignments of the FnIII-2 domain from Vibrio cholerae RbmA	X	X
27131	Backbone 1H, 13C, and 15N Chemical Shift Assignments for 98-243	X	X
27135	Backbone 1H, 15N and 13C assignments of the Sec63 unit of human Brr2	X	X
27140	3Jcgn & 3Jcgc' scalar couplings for CUG-BP2 RRM3 wild type	X	X
27141	1H, 13C, and 15N Chemical Shift Assignments for the N-terminal Signaling Domain of the Pseudomonas capeferrum TonB-dependent Transducer PupB	X	X
27144	DNA with compounds	X		X
27145	Backbone 1H, 13C, 15N assignments for the chromoshadow domain of S. pombe Swi6	X	X
27146	Est3 Hansenula polymorpha telomerase subunit	X	X
27151	Human Guanylate Kinase	X	X
27158	NMR study of non-structural proteins part III: 1H, 13C, 15N resonance assignment of macro domain from Chikungunya virus (CHIKV)	X	X
27159	LRT2 Cyclophilin of rice	X	X
27160	1H, 15N, 13C backbone resonance assignments of the nuclease core residues 2-336 of wild type human flap endonuclease-1	X	X
27162	NMR resonance assignments of the EVH1-domain of Neurofibromin's recruitment factor Spred1	X	X
27165	Chemical Shift Assignments of the partially deuterated Fyn SH2-SH3 domain	X	X
27166	1H, 13C, and 15N Chemical Shift Assignments for LisH Domain of GID8	X	X
27169	1H, 13C, and 15N Chemical Shift Assignments for truncated forms of the coronavirus nsp1 protein and its solubility domain GB1	X	X
27170	Sequence specific 1H, 13C and 15N resonance assignments of a cataract-related variant G57W of human Gamma S-Crystallin	X	X
27171	FXN_AIN_ISCU	X	X
27176	1H, 13C, and 15N Chemical Shift Assignments for truncated forms of the coronavirus nsp1 protein and its solubility domain GB1	X	X
27177	1H, 13C, and 15N Chemical Shift Assignments for truncated forms of the coronavirus nsp1 protein and its solubility domain GB1	X	X
27180	Coheson Domain 5 from Clostridium themocellum	X	X
27183	1H, 15N, 13C backbone resonance assignment of the C-terminal domain of Enzyme I from Thermoanaerobacter Tengcongensis	X	X
27184	Backbone 1H, 13C and 15N resonance assignments of the OB domain of the single stranded DNA-binding protein hSSB2 (NABP1/OBFC1B) and chemical shift mapping of the DNA-binding interface	X	X
27185	ProXp-ala free form	X	X
27188	N, H, CA, CB chemical shifts of E.coli CheA	X	X
27189	N,H,Ca,Cb chemical shifts and methionine sidechain chemical shifts of the isolated P1 domain of CheA from Escherichia Coli	X	X
27191	ProXp-ala bound to microhelixPro	X	X
27192	NMR assignment of Rab5a (double deletion mutant) from Leishmania donovani	X	X
27193	Backbone 1H, 15N chemical shift for Y39E EVH1	X	X
27194	Dynamics of Dehaloperoxidase-Hemoglobin A Derived from NMR Relaxation Spectroscopy and Molecular Dynamics Simulation	X	X
27195	NMR Chemical Shift Assignments of Frataxin protein from Chaetomium thermophilum	X	X
27196	Solution-NMR assignment of the Ig-like domain of bacteriophage T5 tail tube protein pb6	X	X
27199	1H and 15N chemical shift assignments of human S100B	X	X
27207	Gcn4 tAD 1-134	X	X
27210	PhoBN F20D assignment	X	X
27213	RSK1 C-terminal peptide (696-735)	X	X
27214	RSK1 phosphorylated C-terminal peptide (696-735)	X	X
27215	Chemical shift assignments of free prothymosin alpha	X	X
27216	Chemical shift assignments of prothymosin alpha in complex with Histone H1	X	X
27219	ssNMR assignment of membrane embedded NaK channel (ion-free conformer)	X	X
27220	ssNMR assignment of membrane embedded NaK channel (ion-favored conformer)	X	X
27224	1H, 15N, 13C backbone resonance assignments of pentaerythritol tetranitrate reductase from Enterobacter cloacae PB2 in complex with oxidised flavin mononucleotide	X	X
27225	hsa-miR-34a-5p	X			X
27226	hsa-miR-34a-mSIRT1_bulge	X			X
27227	Backbone 1H and 15N Chemical Shift Assignments for mSin3B	X	X
27228	Backbone 1H, 13C, and 15N Chemical Shift Assignments for SLP-65	X	X
27229	hsa-miR-34a-mSIRT1 bulge U5C9mut	X			X
27230	Elastin-like Protein 40 (ELP40)	X	X
27231	Backbone assignments of the full length Dengue Virus NS4A protein in micelles	X	X
27232	13C chemical shifts of solid-state NMR signals of subunit c-ring of TFoF1 ATP synthase	X	X
27233	Backbone 1H, 13C, and 15N Chemical Shift Assignments for MazF from M. tuberculosis	X	X
27234	Solution chemical shifts CAMSAP3 CKK domain	X	X
27235	Solution NMR assignment of the C-terminal domain of chTOG	X	X
27236	Resonance assignment of the central conserved region (domains 8 to 14) of human tropoelastin	X	X
27237	Backbone 1H, 13C, and 15N Chemical Shift Assignments for mouse galectin-2	X	X
27238	Backbone 1H, 13C, and 15N Chemical Shift Assignments for S-nitrosylated mouse galectin-2	X	X
27239	Trigger factor	X	X
27240	NMR backbone and side chain assignments of the Kringle domain of ROR1	X	X
27242	Trigger Factor	X	X
27245	Backbone 15N relaxation data for c-teminal domain of delta subunit of RNA polymerase from bacillus subtilis	X	X
27246	Backbone assignments of engineered hairpin loop3 mutant of single chain monellin.	X	X
27247	Backbone assignments of domain swapped dimer of engineered hairpin loop3 mutant of single chain Monellin	X	X
27248	Backbone amide and AILV methyl chemical shift assignments for Beta2-microglobulin, a human class I major histocompatibility molecule light chain	X	X
27249	Backbone amide and AILV methyl chemical shift assignments for H2-Dd, a murine class I major histocompatibility molecule heavy chain	X	X
27252	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the yeast ADP/ATP carrier 3	X	X
27254	Molten globule of L94G mutant of horse cytochrome-c	X	X
27255	Hydrogen exchange rate of human galectin-1 in apo and lactose-bound form	X	X
27256	Hydrogen exchange rate of human galectin-7 in apo and lactose-bound form	X	X
27257	Hydrogen exchange rate of human galectin-8 NTD in apo and lactose-bound form	X	X
27258	Hydrogen exchange rate of human galectin-8 CTD in apo and lactose-bound form	X	X
27259	1H, 15N, 13C resonance assignments for Human prion protein (91-231): mutant V127M129 (scilicet HuPrPG127V)	X	X
27262	'1H, 13C and 15N Chemical shift assignment for double stranded RNA Binding Domain 1 of Trans Activation Response element (TAR) RNA Binding protein 2'	X	X
27263	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the actin-binding domain of the TARP protein from Chlamydia.	X	X
27264	1H, 15N, 13C resonance assignments for Human prion protein (91-231): wild type (scilicet HuPrPM129)	X	X
27265	Backbone and sidechain assignments of human Cyclophilin A	X	X
27267	Backbone 1H, 13C and 15N Chemical Shift Assignments for c-Jun	X	X
27268	Backbone chemical shifts for the complex between WASp interacting protein (WIP) and the EVH1 domain of WASp	X	X
27269	Backbone 1H, 13C, and 15N Chemical Shift Assignments for gHEEE_02 in presence of 10 mM TCEP	X	X
27272	Backbone assignment of SGTA C-terminal domain	X	X
27273	Backbone 1H, 13C, and 15N Chemical Shift Assignments of phosphorylated (T183 and Y185) p38 alpha	X	X
27274	Backbone 1H, 13C, and 15N Chemical Shift Assignments of phosphorylated (T183 and Y185) p38 alpha in complex with an MKK3bKIM peptide	X	X
27275	Backbone assignment of SGTA TPR_C-terminal(deltaQ) domains	X	X
27276	Backbone assignment of SGTA N-terminal domain including linker residues	X	X
27282	Backbone assignment of Zika Virus NS2B-NS3 Protease in complex with a covalent inhibitor	X	X
27287	Catalytic Domain of Human Aprataxin	X	X
27290	(1)H, (13)C, (15)N resonance assignment of human YAP 50-171 fragment	X	X
27292	Methyl-methionine resonance assignments for Turkey beta-1 adrenergic receptor, Delta5 mutant, Apo form	X	X
27293	Methyl-methionine resonance assignments for Turkey beta-1 adrenergic receptor, Delta5 mutant, Isoprenaline-bound form	X	X
27294	Methyl-methionine resonance assignments for Turkey beta-1 adrenergic receptor, Delta5-L190M mutant, Apo form	X	X
27295	Methyl-methionine resonance assignments for Turkey beta-1 adrenergic receptor, Delta5-L190M mutant, Isoprenaline-bound form	X	X
27296	Methyl-methionine resonance assignments for Turkey beta-1 adrenergic receptor, Delta5-L190M mutant, bound to nanobody Nb6B9, without orthosteric ligand.	X	X
27297	Methyl-methionine resonance assignments for Turkey beta-1 adrenergic receptor, Delta5-L190M mutant, bound to nanobody Nb6B9 and full agonist isoprenaline	X	X
27298	C8 bound E.coli GcvH backbone chemical shift assignments	X	X
27301	Backbone and side chain assignments of Scm3 from Saccharomyces cerevisiae	X	X
27302	1H, 13C and 15N backbone chemical shift assignments of A. thaliana RCD1(499-572)	X	X
27303	1H, 13C and 15N backbone chemical shift assignments of A. thaliana DREB2A(255-272)	X	X
27304	Backbone 1H and 15N Chemical Shift Assignments for HOLO-BAMB5917	X	X
27307	NMR resonance assignments of RNase P protein from Thermotoga maritima	X	X
27313	HusA from porphyromonas gingivalis	X	X
27314	Acidothermus cellulolyticus endoglucanase 1 catalytic domain Y245G (E1)	X	X
27316	NMR assignment of the transmembrane helix of BclxL in phospholipid nanodiscs	X	X
27317	Solid-state NMR assignment of HBV core protein	X	X
27321	1H, 13C and 15N Chemical Shift Assignments and 15N backbone relaxation data for intracellular loop 2 of the human ZIP4 protein	X	X
27328	Chemical shifts of the human GPCR A2AAR in complex with the antagonist ZM241385 at pH 7	X	X
27330	1H, 13C and 15N resonance assignment of SpyCatcher	X	X
27331	1H, 13C and 15N resonance assignment of SpyCatcher part of complex	X	X
27334	Ataxin7N10QT3N9 (Residues:1-62)	X	X
27339	Chemical shifts of UBQLN2 residues 450-624	X	X
27341	Backbone assignment of HSV-1 ICP27 103-155	X	X
27343	Backbone 1H, 13C, 15N Chemical Shift Assignments of GB1 Seq2	X	X
27344	Backbone 1H, 13C, 15N Chemical Shift Assignments of GA Seq5	X	X
27345	Backbone 1H, 13C, 15N Chemical Shift Assignments of SH3 Seq3	X	X
27347	Babckbone 1HN, 13C, and 15N Chemical Shift Assignments of the ATAD2B Bromodomain	X	X
27348	1H, 13C and 15N assignment of C', CA, N and HN of intrinsically disordered alpha-synuclein near-phsysiological conditions	X	X
27349	1H, 13C, 15N chemical shift assignments of initiation factor 1 from Clostridium difficile	X	X
27351	Chemical shift assignments of the N-terminal peptide segment of human cystathionine-beta-synthase	X	X
27354	1H, 13C, and 15N Chemical Shift Assignments for the Thermus thermophilus HB8 TTHA1718 protein in sf9 cells by in-cell NMR spectroscopy	X	X
27356	1H, 13C, and 15N Chemical Shift Assignments for ubiquitin in sf9 cells by in-cell NMR spectroscopy	X	X
27357	AC12 peptide from Hypsiboas raniceps	X	X
27358	DNA binding protein inhibitor ID2 in 8M urea pH2.3	X	X
27359	Backbone (HN, N, HA) Resonance Assignment and 15N T1, T2 Relaxation Parameters for Abl1 SH3	X	X
27360	Stromal Interaction Molecule 1, Homo Sapiens, WT	X	X
27361	Stromal Interaction Molecule 1 CC1 R304W mutant	X	X
27362	Backbone (HN, N) Resonance Assignment and 15N T1, T2 Relaxation Parameters for doubly phosphorylated Abl1 SH3 pY89/pY134	X	X
27363	Biochemical and functional insights on the triheme cytochrome PpcA from Geobacter metallireducens	X	X
27364	Backbone 1H, 15N chemical shift assignments of Kaiso zinc finger DNA binding domain in complex with its double CpG-methylated DNA consensus binding site (MeCG2)	X	X	X
27366	Backbone 1H, 15N chemical shift assignments of Kaiso E535Q zinc finger DNA binding domain in complex with its double CpG-methylated DNA consensus binding site (MeCG2)	X	X	X
27367	Backbone 1H, 15N chemical shift assignments of Kaiso E535A zinc finger DNA binding domain in complex with its double CpG-methylated DNA consensus binding site	X	X	X
27368	Backbone 1H, 15N chemical shift assignments of Kaiso zinc finger DNA binding domain in complex with a double CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	X	X	X
27369	Backbone 1H, 15N chemical shift assignments of Kaiso E535Q zinc finger DNA binding domain in complex with a double CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	X	X	X
27370	Backbone 1H, 15N chemical shift assignments of Kaiso E535A zinc finger DNA binding domain in complex with a double CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	X	X	X
27371	Backbone 1H, 15N chemical shift assignments of Kaiso zinc finger DNA binding domain in complex with a semi-CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	X	X	X
27372	Backbone 1H, 15N chemical shift assignments of Kaiso zinc finger DNA binding domain in complex with a hemi-CpG-methylated DNA resembling the specific Kaiso binding site (KBS)	X	X	X
27377	Backbone 1H, 13C, and 15N Chemical Shift Assignments of HIV-1 Protease (Flap + mutant) bound to Darunavir	X	X
27378	Backbone 1H, 13C, and 15N Chemical Shift Assignments of WT HIV-1 Protease bound to Darunavir	X	X
27379	mu-PIIIA-3	X	X
27382	mu-PIIIA-4	X	X
27383	mu-PIIIA-5	X	X
27384	mu-PIIIA-6	X	X
27385	mu-PIIIA-9	X	X
27386	mu-PIIIA-11	X	X
27387	NMR 1H,13C,15N resonance assignment of the G12C mutant of human K-Ras bound to GDP	X	X
27388	mu-PIIIA-8	X	X
27389	mu-PIIIA-10	X	X
27390	mu-PIIIA-15	X	X
27391	mu-PIIIA-14	X	X
27394	Backbone 1H, 13C, and 15N Chemical Shift Assignments for FHA-1 domain of Rv1747 from Mycobacterium tuberculosis	X	X
27396	NMR assignments of Rous sarcoma virus matrix protein (M domain)	X	X
27401	Backbone assignment of Dynein Light Intermediate Chain 1 C-terminal domain (LIC1 Cterminal)	X	X
27403	1H, 15N, 13C backbone resonance assignments of the nuclease core residues 2-336 of P188A human flap endonuclease-1	X	X
27404	1H, 15N, 13C backbone resonance assignments of the nuclease core residues 2-336 of K93A human flap endonuclease-1 in complex with dual-hairpin DNA substrate	X	X	X
27405	The 15N, 13C and 1H Chemical Shift Assignment of Sis1 J domain from S. cerevisiae	X	X
27406	Backbone and side chain NMR assignments for heterologously expressed Er-23	X	X
27407	Ile and Met methyl 1H and 13C chemical shifts of DNA polymerase beta	X	X
27408	Axin RGS domain	X	X
27409	Ile and Met methyl 1H and 13C chemical shifts of DNA polymerase beta and 1-nucleotide gapped double hairpin DNA binary complex	X	X	X
27410	Ile and Met methyl 1H and 13C chemical shifts of DNA polymerase beta, 1-nucleotide gapped double hairpin DNA and dAMPCPP ternary complex	X	X	X
27415	Chemical shift assignments for TRAP, a MMP20 proteolysis product of murine amelogenin.	X	X
27420	Chemical shifts for the de novo mini protein gHH_44 in the reduced state.	X	X
27422	Backbone 1H, 15N, 13C assignment of Human Myc, N353 to A399, phosphorylated by PAK2	X	X
27426	Chemical shift assignments for mutant Hs MBD2 intrinsically disordered region	X	X
27427	Methyl assignment of human eukaryotic translation initiation factor 4E (eIF4E) in its apo form	X	X
27428	Methyl assignment of cap-bound form of human eukaryotic translation initiation factor 4E (eIF4E)	X	X
27429	Distinctive phosphoinositide and Ca2+ binding properties of normal and cognitive performance-linked variant forms of KIBRA C2 domain	X	X
27430	Distinctive phosphoinositide and Ca2+ binding properties of normal and cognitive performance-linked variant forms of KIBRA C2 domain	X	X
27431	Backbone 1H, 13C, and 15N Chemical Shift Assignments for BamA barrel of E.coli	X	X
27432	Solution structure of the cross-linked dimer of the SLy1 SAM domain S320C mutant	X	X
27433	Double knot toxin (DkTx)	X	X
27435	NMR assignments of Decorator, a phage-cementing 15 KDa monomer	X	X
27436	Backbone and side-chain resonance assignments of the methyl-CpG-binding domain of MBD6 from Arabidopsis thaliana	X	X
27437	1H, 13CA, 13CB and 15N chemical shift assignments of b2-microglobulin and a-chain of the neonatal Fc receptor	X	X
27438	Competitive Regulation of the Cold Sensing Ion Channel TRPM8 by PIP2 and PIRT	X	X
27440	Long-range effects induced by peptide-MHC binding to a human T cell receptor: Implications for the initiation of T cell signaling	X	X
27441	Long-range effects induced by peptide-MHC binding to a human T cell receptor: Implications for the initiation of T cell signaling	X	X
27442	Backbone 1H, 13C, and 15N Chemical Shift Assignments for residues 1-136 of yeast Rpn5.	X	X
27445	Backbone Assignment of GII.4 Saga Norovirus Protruding Domain	X	X
27446	Assignment of the apo-form of the human C-terminal domain of UDP-Glucuronsyltransferase A1 (UGT1A)	X	X
27447	Backbone and side-chain methyl relaxation rates, methyl order parameters, and stereospecific resonance assignments for Zn(II) AdcR	X	X
27448	Backbone and side-chain methyl relaxation rates, methyl order parameters, and stereospecific resonance assignments for apo-AdcR	X	X
27449	Backbone 1H, 13, 15N Chemical Shifts for Repressor of Primer (Rop) Variant C38A C52V (Ala-Val)	X	X
27452	NMR resonance assignment for the SAM/SAH binding riboswitch RNA bound to S-Adenosylhomocysteine	X			X
27453	NMR resonance assignments for an Legionella pneumophila ProQ-homolog	X	X
27455	side-chain methyl order parameters for apo CzrA L34A mutant at 25C-40C	X	X
27458	Backbone and Side-chain Chemical Shift Assignments for MarH	X	X
27459	side-chain methyl order parameters for Zn(II)-bound CzrA L34A mutant at 25C-40C	X	X
27460	chemical shift assignnment of recombinant repetitive domain of spider dragline silk	X	X
27461	Human TGIF1 c-term domain	X	X
27462	Backbone chemical shift assignments for Apo form of Biliverdin reductase B	X	X
27463	Backbone chemical shift assignments for Holo form of Biliverdin reductase B	X	X
27465	Sensory rhodopsin II has distinct fast internal motion and residual conformational entropy	X	X
27468	Isoleucine-, leucine-, valine-, alanine-, methionine-, threonine-methyl and backbone chemical shift assignment of gp17.1	X	X
27469	1H, 15N, 13C backbone resonance assignments of pentaerythritol tetranitrate reductase from Enterobacter cloacae PB2 in complex with 1,4,5,6-tetrahydro-NADP	X	X
27470	1H, 15N, 13C backbone resonance assignments of pentaerythritol tetranitrate reductase from Enterobacter cloacae PB2 in complex with 1,4,5,6-tetrahydro-NAD	X	X
27471	peptide AapA1 toxin of Helicobacter pylori	X	X
27472	NMR 1H,13C,15N resonance assignment of the G12C mutant of human K-Ras bound to GppNHp	X	X
27473	NMR Parameters for the Short Isoform of Hypogastrura harveyi "snow flea" Antifreeze Protein	X	X
27475	NMR assignments of the mammalian proteasome subunit DSS1.	X	X
27476	Cardiac troponin I_135-209 chemical shift	X	X
27477	The complete 1H, 13C, 15N chemical shift assignment of the Itch HECT C-lobe	X	X
27478	Structural studies suggest aggregation as one of the modes of action for teixobactin	X	X
27479	Structural studies suggest aggregation as one of the modes of action for teixobactin	X	X
27480	Structural studies suggest aggregation as one of the modes of action for teixobactin	X	X
27481	Partial 1H, 13C, and 15N assignments of DFsc	X	X
27482	Amide backbone chemical shift assignments for SET nuclear proto-oncogene.	X	X
27483	Backbone assignment of ICP27 1-138	X	X
27484	Backbone assignment of KSHV ORF57 68-178	X	X
27485	Chemical shift data of [P13A]PeIA	X	X
27488	ASK1-TBD	X	X
27489	1H, 15N, 13C Assignment of rS1-D5	X	X
27490	1H, 15N Assignment of rS1-D345	X	X
27491	1H Chemical Shift Assignments for SG4 variant of Schistocerca gregaria protease inhibitor 2	X	X
27492	1H Chemical Shift Assignments for SG5 variant of Schistocerca gregaria protease inhibitor 2	X	X
27494	Backbone 1H, 13C, 15N chemical shifts of deubiquitinase A	X	X
27495	Backbone 1H, 13C, 15N chemical shifts of deubiquitinase A phosphorylated at Ser177	X	X
27497	Human titin ZIg10	X	X
27498	1H, 15N and 13C resonance assignments of the C-terminal domain of the P protein of the Nishigahara strain of rabies virus	X	X
27499	SFRS1-RRM1	X	X
27500	1H, 13C, and 15N Chemical Shift Assignments for SP5 variant of SPINK1	X	X
27501	1H and 15N Chemical Shift Assignments for SP6 variant of SPINK1	X	X
27502	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Histidine Kinase NsaS from S. aureus	X	X
27506	Chemical shift assignment of the viral protein genome-linked (VPg) from Potato virus Y	X	X
27509	Backbone 1H, 13C, and 15N Chemical Shift Assignments for hFABP1 triple-mutant (K57A,E77A,K96A)	X	X
27510	Backbone 1H, 13C, and 15N Chemical Shift Assignments for hFABP1 triple-mutant (K57A,E77A,K96A)in complex with GW7647	X	X
27513	NMR measurements reveal the structural basis of transthyretin destabilization by pathogenic mutations	X	X
27515	NMR measurements reveal the structural basis of transthyretin destabilization by pathogenic mutations	X	X
27516	NMR measurements reveal the structural basis of transthyretin destabilization by pathogenic mutations	X	X
27519	Solution NMR chemical shift assignments of nanobody Nb11 specific for aflatoxin B1	X	X
27524	Sequence specific 1H, 13C and 15N resonance assignments of the C-terminal domain of human Gamma S-Crystallin	X	X
27525	Human T-cell immunoglobulin and mucin domain containing protein- 3	X	X
27526	Backbone 1H, 13C, and 15N Chemical Shift Assignments for alpha-N catenin actin-binding domain H1 mutant	X	X
27530	apoCaM bound to Cav1.2 IQ	X	X
27531	Backbone chemical shift assignment of Macrophage infectivity potentiator virulence factor of Trypanosoma cruzi	X	X
27532	Backbone and side chain NMR assignments for the ribosome Binding Factor A (RbfA) from Staphylococcus aureus	X	X
27534	Solution NMR Structure of PALB2 Colied-coil Domain (PALB2cc)	X	X
27537	Chemical Shift Assignments for the C-terminal domain of histone H1.0	X	X
27538	Chemical Shift Assignments for the triphosphorylated C-terminal domain of histone H1.0	X	X
27539	Influenza A virus non-structural protein 1 (NS1) effector domain	X	X
27541	Influenza A virus (2013 H7N9 strain) non-structural protein 1 effector domain	X	X
27542	Macaca fascicularis Eosinophil Cationic Protein backbone assignment	X	X
27543	Backbone assignment of mouse MARCH9 transmembrane domains in LMPG micelles	X	X
27544	Pongo pygmaeus Eosinophil Cationic Protein backbone assignment	X	X
27545	Pongo abelii ribonuclease 3 backbone assignment	X	X
27546	Aotus trivirgatus Eosinophil-Derived Neurotoxin backbone assignment	X	X
27548	Ressonance assignments for the human Smad5 MH1 domain	X	X
27549	Backbone 1H, 13C, and 15N Chemical Shift Assignments for TDP-43 RRM2 at 6M urea	X	X
27553	1H, 15N, and 13C resonance assignments of the intrinsically disordered SH4 and Unique domains of p59Hck	X	X
27554	1H, 15N, and 13C resonance assignments of the intrinsically disordered SH4 and Unique domains of p61Hck	X	X
27555	Backbone assignment of Rip2Card	X	X
27556	NMR chemical shifts of horse heart cytochrome c bound to 1:1 (molar) TOCL/DOPC vesicles.	X	X
27558	Amide chemical shifts of PCNA bound to p15 peptide and DNA	X	X
27559	Apo DNA Polymerase beta ILV Methyl Assignments	X	X
27560	protein-gapped DNA complex (Polymerase beta) ILV Methyl Assignments	X	X	X
27561	protein-gapped DNA-nucelotide complex (Polymerase beta) ILV Methyl Assignments	X	X	X
27565	Transmembrane protein 106B (TEM106B)	X	X
27566	Backbone assignments of the N domain of bacterial tRNA-(N1G37) methyltransferase (TrmD)	X	X
27567	TatRBD:TAR	X	X
27570	Chemical shift assignment of wild-type E.coli diacylglycerol kinase (DGK) by solid-state NMR	X	X
27571	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the bHLHZip c-MYC:MAX complex.	X	X
27574	human TGF-b2	X	X
27577	Resonance assignments for Ras-related C3 botulinum toxin substrate 1 bound to GDP and Mg2+	X	X
27580	Backbone 1H, 15N and 13C Chemical shifts of N-terminal domain of antitoxin VapB46 from Mycobacterium tuberculosis	X	X
27581	1H, 13C, and 15N chemical shift assignments of the Sushi 1 domain of GABAbR1a	X	X
27583	The structure of the Pro-domain of mouse proNGF in contact with the NGF domain	X	X
27588	Assignment of E.coli asparaginase (ANSII) by solution NMR	X	X
27589	Assignment of crystalline E.coli asparaginase II (ANSII) by solid-state NMR	X	X
27590	Assignment of pegylated E.coli asparaginase II (ANSII) by solid-state NMR	X	X
27595	Sequential backbone resonance assignment of AT-rich interaction domain of BAF200	X	X
27597	Backbone 1H, 13C, and 15N Chemical Shift Assignments for p53TAD in complex with S100A4	X	X
27599	Backbone chemical shifts for super-stable p53 DNA-Binding Domain C5xS	X	X
27602	13C-15N solid-state chemical shifts of three polymorphs of 6aJL2-R24G amyloid fibrils	X	X
27603	Partial backbone assignments of Cse4 protein in 5M urea	X	X
27605	Dynamics of the leucine zipper of Nek2 kinase	X	X
27606	Backbone and side chain resonance assignment of the NZF domain of HOIL-1L	X	X
27607	Sequence specific chemical shift assignments of the Caenorhabditis elegans SAS-6 N-terminal domain	X	X
27608	MapZ is a multi-functional regulator of FtsZ that controls both the precise positioning of Z-ring and proper timing of Z-ring formation	X	X
27609	Sequence-specific 1H, 13C, and 15N backbone assignment of Fibronectin type III 13	X	X
27610	Sequence-specific 1H, 13C, and 15N backbone assignment of Fibronectin type III 14	X	X
27612	NMR study of non-structural proteins - 1H, 13C, 15N resonance assignment of macro domain from Mayaro virus (MAYV) in complex with ADP-ribose	X	X
27617	1H, 13C, and 15N backbone chemical shift assignments of KPC-2	X	X
27618	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Dss1	X	X
27619	Backbone assignments of the bacterial tRNA-(N1G37) methyltransferase (TrmD)	X	X
27621	Backbone 1H, 15N, 13C assignment of DfdT337-K426.	X	X
27622	Backbone assignment of HOX protein SCR	X	X
27623	Klebsiella pneumoniae sigma4 of sigma70 fused to the beta-flap-tip helix	X	X
27624	Klebsiella pneumoniae sigma4 of sigmaS fused to the beta-flap-tip helix	X	X
27625	1H, 13C, 15N assignment of the CD44 cytoplasmatic tail (669-742)	X	X
27626	1H, 13C, and 15N Chemical Shift Assignments for the SAH domain from mouse myosin 7a	X	X
27627	Backbone Assignment Ubl45 domain of USP7	X	X
27628	Backbone 1H, 13C, and 15N Chemical Shift Assignments for SIRT1 183-233	X	X
27629	1HN,15N,13CO,13CA and 13CB Chemical Shift Assignments for the FBP21(326-276) Fragment	X	X
27630	1HN,15N,13CO,13CA and 13CB Chemical Shift Assignments for the FBP21(326-276) Fragment in Complex with the Brr2-CSec63 domain	X	X
27631	Backbone amide and AILV methyl chemical shift assignments for HLA-A*02:01, a human class I major histocompatibility molecule heavy chain.	X	X
27632	Backbone amide and AILV methyl chemical shift assignments for HLA-A*01:01, a human class I major histocompatibility molecule heavy chain	X	X
27633	Chemical shift assignments of the C-terminal domain of chicken H1.11L	X	X
27634	1H, 13C, and 15N Chemical Shift Assignments of the C-terminal region of the Menangle virus Phosphoprotein	X	X
27635	Microsecond Protein Dynamics from Combined Bloch-McConnell and Near-Rotary-Resonance R1rho Relaxation-Dispersion MAS NMR	X	X
27641	Backbone 1H, 13C, and 15N Chemical Shift Assignments for MPS1	X	X
27642	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Mps1 TPR domain	X	X
27645	Backbone 1H, 13C and 15N chemical shift assignment of the PDZ domain of the protein tyrosine phosphatase non-receptor type 3 complexed with the HPV16 E6 oncoprotein C-terminal peptide	X	X
27646	Full assignment of 13C,15N-labeled oncogenic mutant human KRas4B-G12C(1-169) bound to GDP at physiological pH	X	X
27647	Backbone 1H, 13C, and 15N Chemical Shift Assignments for phosphorylated KID domain (C90A, V118D) of CREB	X	X
27648	Backbone 1H, 13C, and 15N Chemical Shift Assignments for KID domain (C90A, V118D) of CREB	X	X
27651	Conformational Changes in the Cytoplasmic Region of KIR3DL1 upon Interaction with SHP-2	X	X
27652	NZ118	X		X
27653	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the N-terminal Domain of ING5	X	X
27654	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Plant Homeodomain (PHD) of ING5	X	X
27655	Backbone assignments and relaxation rates for Zn(II) L57M AdcR	X	X
27656	Backbone assignments and relaxation rates for apo L57M AdcR	X	X
27659	Backbone assignment of human ribonuclease 6	X	X
27661	Amide chemical shifts of human PCNA bound to p12 peptide	X	X
27662	amide chemical shifts of human PCNA bound to RecQ5 peptide	X	X
27664	UbcH7-Ub isopeptide conjugate	X	X
27666	Resonance assignment of human LARP4A La module	X	X
27673	backbone chemical shift assignments of full length rat adrenodoxin	X	X
27674	Chemical shifts for C-tail of the apelin receptor in LPPG micelles.	X	X
27677	Resonance Assignments for the PWWP-ARID domain of human RBBP1	X	X
27681	Chemical shift assignments for HSPB1 containing residues 1-176	X	X
27682	Backbone amide and AILV methyl chemical shift assignments for H2-Ld, a mouse class I major histocompatibility molecule heavy chain	X	X
27683	Euprosthenops australis major ampullate spidroin 1 N-terminal domain (NTD) mutant at pH7	X	X
27687	NMR resonance assignments of the peach allergen Pru p 1	X	X
27688	Chemical Shift Assignments for Interleukin-36beta isoform-2	X	X
27689	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Vibrio cholerae DciA 1-111	X	X
27690	MtFKBP	X	X
27691	Backbone assignment of the periplasmic glycoside hydrolase BoMan26A	X	X
27692	Backbone Chemical Shift Assignments for Ca+-Bound Calmodulin Mutant (D21A/D23A/D25A/E32A D57A/D59A/N61A/E68A) Bound to CaV1.2 IQ Motif	X	X
27693	Backbone and Sidechian 1H, 13C, and 15N Chemical Shift Assignments for Escherichia Coli Periplasmic Chaperone HdeA at pH 1.5	X	X
27696	NMR assignment of doubly monoubiquitinated p15	X	X
27698	p15CCSS	X	X
27699	Human linker histone NGH1x in high ionic strength conditions	X	X
27700	Human linker histone NGH1x in low ionic strength conditions	X	X
27705	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Guanylate Cyclase Activating Protein-5 (GCAP5) in Zebrafish Photoreceptors	X	X
27707	Domain 4 of Suilysin	X	X
27709	Backbone assignment of mouse MARCH9 transmembrane domains in TDPC:SDS micelles	X	X
27711	Chemical shifts of calmodulin C-terminal lobe in complex with KN-93	X	X
27712	15N chemical shifts of calmodulin N-terminal lobe in complex with KN-93	X	X
27713	Androgen Receptor (AR) polyQ-derived peptide L4Q4	X	X
27714	Androgen Receptor (AR) polyQ-derived peptide L4Q8	X	X
27715	Androgen Receptor (AR) polyQ-derived peptide L4Q12	X	X
27716	Androgen Receptor (AR) polyQ-derived peptide L4Q16	X	X
27717	Androgen Receptor (AR) polyQ-derived peptide L4Q20	X	X
27718	Backbone 1H, 15N assignment of 15N-labeled oncogenic mutant human KRas4B-G12V(1-169) bound to GDP at physiological pH	X	X
27719	Backbone 1H, 15N assignment of 15N-labeled oncogenic mutant human KRas4B-G12D(1-169) bound to GDP at physiological pH	X	X
27720	Backbone 1H, 15N assignment of 15N-labeled wildtype human KRas4B(1-169) bound to GDP at physiological pH	X	X
27721	Backbone, methyl and Arg Ne chemical shift assignments, relaxation data and order parameters of Galectin-3 bound to S	X	X
27722	Backbone, methyl and Arg Ne chemical shift assignments, relaxation data and order parameters of Galectin-3 bound to R	X	X
27724	NMR Assignments of the apo-form of Aedes aegypti odorant binding protein 22	X	X
27725	1H, 13C and 15N resonance assignments of the second peptidyl-prolyl isomerase domain of chaperone SurA from Escherichia coli	X	X
27726	Arf1_L8K_GTPgS	X	X
27727	Inhibitor-interaction, dimerization and activity change of HIV-1 protease mutants evolved under drug-pressure	X	X
27728	Structure determination of N-terminal fragment of UL49.5 protein from bovine herpesvirus 1 by NMR spectroscopy and molecular dynamics	X	X
27730	Structure determination of transmembrane- C-terminal fragment of UL49.5 protein from bovine herpesvirus 1 by NMR spectroscopy and molecular dynamics	X	X
27731	Inhibitor-interaction, dimerization and activity change of HIV-1 protease mutants evolved under drug-pressure	X	X
27732	15N, 13C and 1H backbone resonance assignments of the apo FKBP12 protein from Aspergillus fumigatus	X	X
27733	15N, 13C and 1H backbone resonance assignments of the FKBP12 protein from Aspergillus fumigatus bound to FK506	X	X
27734	15N, 13C and 1H backbone resonance assignments of FKBP12 from the pathogenic fungi Mucor circinelloides	X	X
27737	15N, 13C and 1H backbone resonance assignments of FKBP12 protein from the pathogenic fungi Mucor circinelloides bound to FK506	X	X
27738	15N, 13C and 1H backbone resonance assignments of Human FKBP12 protein	X	X
27739	15N, 13C and 1H backbone resonance assignments of Human FKBP12 protein bound to FK506	X	X
27742	hSmad2 MH1 domain	X	X
27743	hSmad2-beta MH1 domain	X	X
27744	Backbone chemical shift assignments of translation initiation factor 3 from Pseudomonas aeruginosa	X	X
27746	The conduction pathway of potassium channels is water-free under physiological conditions	X	X
27747	Assignment of the ARC4 domain of human Tankyrase	X	X
27753	The cytoplasm-entry domain of antibacterial CdiA is a dynamic alpha-helical bundle with disulfide-dependent structural features	X	X
27754	The cytoplasm-entry domain of antibacterial CdiA is a dynamic alpha-helical bundle with disulfide-dependent structural features	X	X
27755	The cytoplasm-entry domain of antibacterial CdiA is a dynamic alpha-helical bundle with disulfide-dependent structural features	X	X
27756	Assigned 1H NMR Chemical Shifts for endomorphin-1 in 10 mM phosphate pH 7.0	X	X
27761	Backbone 1H, 13C, and 15N Chemical Shift Assignments for ARNO Sec7	X	X
27763	FoxM1 Transactivation Domain	X	X
27764	FoxM1 Transactivation Domain, Phosphorylated form	X	X
27768	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the ShkA kinase Rec1 domain from Caulobacter crescentus	X	X
27771	1H,15N and 13C NMR assignments of the Solanum tuberosum Plant Specific Insert at pH 7.0	X	X
27772	1H, 15N,13C assignments of the Solanum tuberosum Plant Specific Insert at pH 2.0	X	X
27774	Backbone 1H, 13C, and 15N Chemical Shift Assignments for PhDim1	X	X
27775	HLS3_Olduvai	X	X
27776	ssNMR assignment of membrane embedded Rhomboid protease GlpG	X	X
27778	Backbone chemical shift assignments of human kappa-casein fragment 24 134 at pH 3.9	X	X
27783	Backbone 1H, 15N, 13C Chemical Shift Assignment of the Pr state of monomeric PAS-GAF-PHY from Deinococcus radiodurans	X	X
27784	Backbone 1H, 15N, 13C Chemical Shift Assignment of the Pfr state of monomeric PAS-GAF-PHY from Deinococcus radiodurans	X	X
27788	G335N TDP-43_267-414	X	X
27789	G335S TDP-43_267-414	X	X
27790	G338A TDP-43_267-414	X	X
27794	1H, 13C, and 15N chemical shift assignments of the GTP 9-12 RNA aptamer in complex with GTP	X			X
27795	FLNa4-6	X	X
27798	1H, 13C and 15N backbone chemical shift assignments of a mutated variant of UBE2S C95S/C118M/K100C	X	X
27801	Backbone 1H, 13C, and 15N chemical shift assignments for RCAN1 residues 128-164	X	X
27812	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the intrinsically disordered NHE1 distal tail phosphorylated at six sites by ERK2	X	X
27814	Backbone 1H, 13C, and 15N Chemical Shift Assignments of both isoforms of ITSN1 SH3A	X	X
27817	Backbone 1H, 13C, and 15N Chemical Shift Assignments of ITSN1 SH3D20	X	X
27818	Backbone 1H, 13C, and 15N Chemical Shift Assignments of ITSN1 L_SH3A	X	X
27819	Backbone 1H, 13C, and 15N Chemical Shift Assignments of ITSN1 SH3A_L	X	X
27820	Backbone 1H, 13C, and 15N Chemical Shift Assignments of ITSN1 L_SH3D20	X	X
27821	Backbone 1H, 13C, and 15N Chemical Shift Assignments of ITSN1 SH3D20_L	X	X
27825	Backbone chemical shift assignments of RNase H domain bound to ZW566	X	X
27826	Backbone chemical shift assignments of RNase H domain bound to YLC2-155	X	X
27827	Human IMP3 KH1-2 delta 1 amide chemical shifts	X	X
27835	HRdup moPrP 118-231	X	X
27836	Backbone 1H, 15N, and 13C Chemical Shifts of Myosin VI Medial Tail Domain	X	X
27837	Backbone 1H, 13C, and 15N Chemical Shift Assignments for RepA	X	X
27838	Backbone 1H, 13C and 15N chemical shift assignment of the cyclase IdmH from the indanomycin NRPS/PKS from Streptomyces antibioticus	X	X
27840	Backbone 1H, 13C, and 15N chemical shift assignments for the ligand-binding domain of human ionotropic glutamate receptor 2 complexed with glutamate	X	X
27841	Backbone 1H, 13C, and 15N chemical shift assignments for the T686A variant of the ligand-binding domain of human ionotropic glutamate receptor 2 complexed with glutamate	X	X
27842	Backbone 1H, 13C, and 15N chemical shift assignments for the T686S variant of the ligand-binding domain of human ionotropic glutamate receptor 2 complexed with glutamate	X	X
27843	Backbone 1H, 13C, and 15N chemical shift assignments for the ligand-binding domain of human ionotropic glutamate receptor 2 complexed with kainate	X	X
27844	Backbone 1H and 15N Chemical Shift Assignments for Proteasome Assembling Chaperone 3	X	X
27845	Solid-state NMR backbone assignment of HBV core protein at 100 kHz	X	X
27847	Backbone resonance assignments and secondary structures of Ebola Nucleoprotein 600-739 construct.	X	X
27848	Backbone 1H, 13C, and 15N Chemical Shift Assignments of co-repressor nuclear receptor interacting domain N-CoR NID	X	X
27851	Backbone resonance assignments of the PRY-SPRY domain of RNF135	X	X
27852	NMR resonance assignments for the GSPII-B domain of the traffic ATPase PilF from Thermus thermophilus in the apo and c-di-GMP-bound states	X	X
27853	NMR resonance assignments for the GSPII-B domain of the traffic ATPase PilF from Thermus thermophilus in the apo and c-di-GMP-bound states	X	X
27857	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments of RbfA	X	X
27860	Calcium sensing via EF-hand 4 enables thioredoxin activity in the sensor-responder protein calredoxin	X	X
27861	Characterization of H/D Exchange in Type 1 Pili by Proton-Detected Solid-State NMR and Molecular Dynamics Simulations	X	X
27862	NMR 1H chemical shift assignment heptapeptide EVNPAVP	X	X
27863	NMR 1H chemical shifts assignment heptapeptide EVNPPAP	X	X
27864	New insights into the mechanism and specificity of Pro-Pro endopeptidase-1	X	X
27865	Calcium sensing via EF-hand 4 enables thioredoxin activity in the sensor-responder protein calredoxin	X	X
27866	A ubiquitin-like dimerization domain controls protein kinase D activation by trans-autophosphorylation	X	X
27867	chemical shifts assignments of TGIF1-RD2a	X	X
27868	Backbone 1H, 13C and 15N chemical shift assignment for CHIKV HVD	X	X
27869	Backbone assignment of cytochrome PccH, a crucial protein for microbial electrosynthesis in Geobacter sulfurreducens	X	X
27873	Solution structure of an alpha sheet hairpin peptide	X				X
27875	Solution Structure of the RAZUL domain from 26S proteasome subunit hRpn10/S5a complexed with the AZUL domain from E3 ligase E6AP/UBE3A	X	X
27876	NMR resonance assignment for the GSPII-C domain of PilF from Thermus thermophilus in complex with c-di-GMP	X	X
27878	K1-K9 fragments of beta2-microglobulin	X	X
27879	Resonance assignemnt of HpDnaB:ADP:AlF4-:DNA	X	X
27880	1H, 13C, 15N Backbone chemical Shift Assignment of the RYMV-encoded viral supressor of RNA silencing P1 protein	X	X
27882	Backbone 1H, 13C, 15N chemical shift assignments for the ShkA kinase Rec2 domain from Caulobacter crescentus	X	X
27883	Backbone assignment of HMGA1a S64C mutant	X	X
27884	Backbone assignment of HMGA1a S64C mutant phosphorylated by Casein Kinase 2	X	X
27885	Backbone 1H, 13C, and 15N chemical shift assignments for the N-terminal domain of Sfr1	X	X
27886	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Shaker-VSD	X	X
27888	BlaC in free form	X	X
27890	BlaC in bound to clavulanic acid	X	X
27893	Constutively active Mutant D99N LicT-CAT-PRD1	X	X
27895	Backbone 1H, 13C, and 15N Chemical Shift Assignments for dimerization domain of NF-kappaB p50 subunit	X	X
27900	Identification of a short peptide motif in the N-terminal region of alpha-synuclein that plays a critical role in aggregation and function	X	X
27901	Identification of a short peptide motif in the N-terminal region of alpha-synuclein that plays a critical role in aggregation and function	X	X
27904	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human Fis1 residues 1-125	X	X
27911	1H, 13C and 15N NMR chemical shift assignments of cAMP-regulated phosphoprotein-19 and -16 (ARPP19 and ARPP16)	X	X
27912	1H, 13C and 15N NMR chemical shift assignments of cAMP-regulated phosphoprotein-19 and -16 (ARPP19 and ARPP16)	X	X
27913	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the C-terminal Fragment of a Kinesin KIF4A Variant	X	X
27917	1H, 13C, and 15N chemical shift assignments of COG4197, a monomeric Cro family member related to HigA	X	X
27920	1H, 15N, 13C backbone resonance assignments of the P146A variant of beta-phosphoglucomutase	X	X
27922	scAtg3(del 1-18, 86-159, 248-278)	X	X
27923	scAtg3FR(86-159)	X	X
27924	scAtg8(K26P,C33V,G116C)	X	X
27925	NMR assignments of capsid protrusion domain of dragon grouper nervous necrosis virus	X	X
27929	BlaC bound to avibactam	X	X
27932	Folded ZnF in FUS (371-526)	X	X
27934	Backbone 1H, 13C and 15N resonance assignments for IMP2 KH34	X	X
27936	NMR backbone assignment of full-length human 4E-BP1	X	X
27937	NMR backbone assignment of full-length human 4E-BP1 I15A F114A mutant	X	X
27938	NMR backbone assignment of full-length human phosphorylated 4E-BP1 S65A T70A S83A mutant	X	X
27939	NMR backbone assignment of full-length human phosphorylated 4E-BP1 T70E mutant	X	X
27943	Backbone 1H, 13C, and 15N Chemical Shift Assignments of reduced human DJ-1	X	X
27944	Backbone 1H, 13C, and 15N Chemical Shift Assignments for ribosomal protein bL12 S89C	X	X
27945	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Free Cellular Retinoic Acid Binding Protein 2	X	X
27946	Backbone 1H, 13C, and 15N Chemical Shift Assignments for RA-bound Cellular Retinoic Acid Binding Protein 2	X	X
27947	Backbone 1H, 13C, and 15N Chemical Shift Assignments of oxidized (cysteine sulfinic acid 106) human DJ-1	X	X
27948	Backbone 1H, 13C, and 15N Chemical Shift Assignments for ribosomal protein bL12 S89C and with LBT tag	X	X
27949	1H, 13C, 15N Backbone and Sidechain Assignments of HNH from SpyCas9	X	X
27951	1H, 13C, and 15N Chemical shift assignments of gypsy moth Lymantria dispar pheromone-binding protein 1 (LdisPBP1)	X	X
27952	Sequence-specific assignments of the P. falciparum PFE0660w J-domain	X	X
27953	Sequence-specific assignments of Plasmodium falciparum PFE0055c J-domain	X	X
27955	ILVM methyl assignments for Pyrococcus furiosus Rad50 NBD (wild type) with unlabeled Mre11	X	X
27956	ILVM methyl chemical shifts for Pyrococcus furiosus Rad50 NBD (L828F) with unlabeled Mre11	X	X
27957	ILVM methyl chemical shifts for Pyrococcus furiosus Rad50 NBD (D829N) with unlabeled Mre11	X	X
27958	Spin-labeled DNA duplex	X		X
27959	Including protons in solid-state NMR resonance assignment and secondary structure analysis: The example of RNA polymerase II subunits Rpo4/7	X	X
27961	NMR resonance assignments of the hazelnut allergen isoform Cor a 1.0402	X	X
27963	RDC of Delta subunit of RNA polymerase from Bacillus subtilis	X	X
27965	NMR resonance assignments of the hazelnut allergen isoform Cor a 1.0401	X	X
27967	NMR resonance assignments of the hazelnut allergen isoform Cor a 1.0403	X	X
27968	Solution NMR Backbone Resonance Assignments for p150Glued(1-191) of Dynactin	X	X
27969	Backbone amide and MILV methyl chemical shift assignments of mouse Interleukin-2	X	X
27970	ILV(proS) methyl assignment of mIL-2 in complex with JES6-1 scFV antibody	X	X
27971	ILV(proS) methyl assignment of mIL-2 in complex with IL-2Ra (CD25) receptor	X	X
27972	VSV Phosphoprotein 35-106	X	X
27974	MILV methyl chemical shift assignments of the R52A mutant of mouse Interleukin-2	X	X
27975	Mouse Lemur Biliverdin B reductase	X	X
27977	Solution structure of the PUB domain of human UBXD1 protein	X	X
27978	Complete 1H, 13C, 15N resonance assignments of the Vpr binding region of hHR23A (residues 223-363)	X	X
27980	13C-chemical-shifts-for_SPA_amyloid-beta42_oligomer	X	X
27981	Backbone 1H, 13C, and 15N chemical shift assignments for C. elegans STIM EF-SAM in the presence of calcium.	X	X
27982	Backbone 1H, 13C, and 15N chemical shift assignments for C. elegans STIM EF-SAM (form 1) in the absence of calcium.	X	X
27983	Backbone 1H, 13C, and 15N chemical shift assignments for C. elegans STIM EF-SAM (form 2) in the absence of calcium.	X	X
27984	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Cezanne UBA domain (residues 2-55)	X	X
27985	Canine CXCL8	X	X
27986	Mouse CCL2	X	X
27987	Backbone, side chain and heme resonance assignment of the triheme cytochrome PpcA from Geobacter metallireducens in the oxidized state	X	X
27992	MYB28 116-197 chemical shifts	X	X
27993	MYB29 residues 118-178 chemical shifts	X	X
27994	chemical shift assignments for RCAN1 residues 89-197	X	X
27995	chemical shift assignments for phosphorylated RCAN1 residues 89-197	X	X
27996	Chemical shift assignments of calcineurin catalytic subunit A residues 27-348 in complex with RCAN1 128-164	X	X
27997	Chemical shift assignments for RCAN1 residues 128-164 in complex with calcineurin catalytic subunit A residues 27-348	X	X
28001	Structural basis for client recognition and activity of hsp40 chaperones	X	X
28002	FDX1	X	X
28003	FDX2	X	X
28005	Backbone 1H, 13C, and 15N Chemical Shift Assignments for phosphomimetic mutant of cytoplasmic domain of MapZ protein	X	X
28006	Backbone and Aliphatic Side-chain 1H, 13C, and 15N Chemical Shift Assignments for cytoplasmic domain of MapZ protein	X	X
28008	HRASG12VGDP	X	X
28009	HRASG12VGMPPNP	X	X
28011	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Mdm2 (residues 284 to 434)	X	X
28012	Backbone resonance assignments for Human Focal Adhesion Targeting domain (892-1052)	X	X
28014	Backbone and sidechain 1H, 13C, and 15N Chemical Shift Assignments of RimP from E. coli	X	X
28015	Full assignment of 13C,15N-labeled oncogenic mutant human KRas4B-G12C(1-169) bound to GTP at physiological pH	X	X
28016	NMR resonance assignments of the hazelnut allergen isoform Cor a 1.0404	X	X
28017	QBP1+TDP-43 POLYPEPTIDE	X	X
28019	Backbone 1H, 13C, and 15N Chemical Shift Assignments for mouse Mdm2 (residues 282 to 432)	X	X
28020	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human Mdm2 (residues 284 to 434) phosphorylated by DNA-PK	X	X
28021	1H and 15N assignment of 15N-labeled wildtype human KRas4B(1-169) bound to GTP at physiological pH	X	X
28022	1H and 15N assignment of 15N-labeled oncogenic mutant human KRas4B-G12D(1-169) bound to GTP at physiological pH	X	X
28028	1H, 13C, 15N backbone and side-chain assignment of the native form of UbcH7 (UBE2L3)	X	X
28030	Complete assignment of Ala, Ile, Leu (proS), Met and Val (proS) methyl groups of human Norovirus protruding domain from the GII.4 Saga4/2006 strain	X	X
28032	Chemical shifts of mouse BTNL2 IgV1 domain	X	X
28033	Backbone assignments for the Asciz QT2-4/LC8 complex	X	X
28036	Shaker-VSD(S2bot_mutant)	X	X
28039	Backbone and CB Chemical Shift Assignments for the hSpt5-KOW5 Domain	X	X
28040	Backbone and CB Chemical Shift Assignments of the Methanocaldococcus jannaschii Spt5-KOW domain	X	X
28041	Backbone and CB Chemical Shift Assignments of Vibrio cholerae RfaH	X	X
28042	ubiquitin receptor protein complex	X	X
28043	Backbone 13C and 15N assignment of lambdaQ	X	X
28045	A short motif in the N-terminal region of a-synuclein plays a critical role in aggregation and function	X	X
28046	RalA.GMPPNP	X	X
28052	1H, 13C, and 15N chemical shift assignments of the C. diphtheriae methionine sulfoxide reductase B	X	X
28053	VDAC_E73V assignment in MSP1D1 nanodiscs	X	X
28055	Backbone resonance assignments of N-terminal domain of p50 NF-kappaB subunit	X	X
28056	Backbone resonance assignments of the apo form of the solute binding protein PiuA from Streptococcus pneumoniae	X	X
28057	Backbone resonance assignments of a holo form of the solute binding protein PiuA from Streptococcus pneumoniae	X	X
28059	1H-15N backbone Heteronuclear NOE values for free and ssDNA complex forms of Human YB1 cold shock domain.	X	X	X
28060	HP1	X	X
28061	Backbone and side-chain chemical shift assignments of a cellular FLICE-inhibitory protein (c-FLIPs)	X	X
28062	Backbone 1H, 13C, and 15N Chemical Shift Assignments for RPT1 of hSNF5 and SWIRM of BAF155	X	X
28063	Backbone 1H, 13C, and 15N Chemical shift Assignments for SWIRM domain of BAF155 and RPT1 of hSNF5	X	X
28064	Solution structure of hSNF5 RPT1 domain	X	X
28065	Backbone N, HN, CO and CA Chemical Shift Assignments for Tau (1-239)	X	X
28077	Backbone 1H, 13C, 15N chemical shift assignments for BRCT_S3R_V63A	X	X
28079	teEIC backbone and I/L/V methyl resonance assignment	X	X
28080	etEIC backbone and I/L/V methyl resonance assignment	X	X
28081	Trimolecular G-quadruplex	X		X
28084	1H, 13C, and 15N backbone assignments of the Brain And Acute Leukemia Cytoplasmic (BAALC) protein	X	X
28091	Retinoblastoma-like protein 1 / p107	X	X
28092	Art v 3 allergen from Artemisia vulgaris	X	X
28094	Solution NMR structure of 5'UTR of Stem loop B in DENV4	X			X
28095	1H, 15N and 13C backbone resonance assignments of wild-type substrate-free beta-phosphoglucomutase from Lactococcus lactis with a cis K145-P146 peptide bond (conformer A)	X	X
28096	1H, 15N and 13C backbone resonance assignments of wild-type substrate-free beta-phosphoglucomutase from Lactococcus lactis with a trans K145-P146 peptide bond (conformer B)	X	X
28099	NMR Assignments of the Programmed Cell Death 5 (PDCD5) Protein from Toxoplasma gondii	X	X
28100	Chemical shift assignment for human EDC3 residues 104-197	X	X
28101	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Scc4 in Chlamydia Trachomatis	X	X
28102	Resonance assignments of oxidized BpsDsbA	X	X
28103	Backbone assignments of reduced BpsDsbA	X	X
28104	Backbone and ILV methyl assignments of human Interleukin-2	X	X
28110	Backbone and ILV methyl assignments for REC3 domain of SpCas9	X	X
28112	1H, 13C, and 15N chemical shift assignments of the Gp4 from the Pseudomonas phage LUZ24	X	X
28113	revmodN_ACC	X	X		X
28115	Sequence-specific Backbone Resonance Assignments of Human PrP(23-144) at pH 4.5	X	X
28116	Sequence-specific Backbone Resonance Assignments of Human PrP(23-144) at pH 7.0	X	X
28118	1H, 13C, 15N backbone and side-chain resonance assignment of Nostoc sp. C139A variant of the heme nitric oxide/oxygen binding (H-NOX) domain in complex with cinaciguat	X	X
28121	Assignment of first 249 residues of yeast eIF4G1	X	X
28122	1H-13C-15N solid-state NMR assignment of a second conformation of HBV capsid	X	X
28123	Methionine sulfoxide-containing peptide for random coil chemical shifts at pH 2.3 and 7.4 (with Gly as succeeding residue)	X	X
28124	5-Hydroxytryptophan-containing peptide for random coil chemical shifts at pH 2.3 and 7.4	X	X
28125	Kynurenine-containing peptide for random coil chemical shifts at pH 2.3 and 7.4	X	X
28126	Methionine sulfoxide-containing peptide for random coil chemical shifts at pH 2.3 and 7.4 (with Ala as succeeding residue)	X	X
28127	Methionine sulfoxide-containing peptide for random coil chemical shifts at pH 2.3 and 7.4 (with Pro as succeeding residue)	X	X
28128	Methionine sulfone-containing peptide for random coil chemical shifts at pH 2.3 and 7.4	X	X
28129	N-formylkynurenine-containing peptide for random coil chemical shifts at pH 2.3 and 7.4	X	X
28130	Oxindolylalanine-containing peptide for random coil chemical shifts at pH 2.3 and 7.4	X	X
28133	Backbone 1H, 13C, 15N, and CB chemical shift assignments for the PDE6 inhibitory gamma-subunit (1-58)	X	X
28136	Resonance Assignments for the Rabies Phosphoprotein RavP	X	X
28137	Triple Resonance Assignments for the Rabies Phosphoprotein RavP (1-152)	X	X
28138	Resonance Assignments for the Rabies Phosphoprotein RavP C terminus (140-297)	X	X
28139	Backbone resonance assignment of dopamine N-acetyltransferase (Dat) in complex with Ac-CoA	X	X
30002	Solution Structure of p53TAD-TAZ1	X	X
30033	Solution Structure of Hge36: Scorpine-like Peptide from Hadrurus Gertschi	X	X
30035	Dimerization interface of the noncrystalline HIV-1 capsid protein lattice from solid state NMR spectroscopy of tubular assemblies	X	X
30046	Ground state sampled during RDC restrained Replica-averaged Metadynamics (RAM) simulations of the HIV-1 TAR complexed with cyclic peptide mimetic of Tat	X	X		X
30049	Excited state (Bound-like) sampled during RDC restrained Replica-averaged Metadynamics (RAM) simulations of the HIV-1 TAR complexed with cyclic peptide mimetic of Tat	X	X		X
30051	Intermediate state lying on the pathway of release of Tat from HIV-1 TAR.	X	X		X
30052	NMR solution structure of [Rp, Rp]-PT dsDNA	X		X
30053	Solution NMR structure of PT-free dsDNA from Streptomyces lividans	X		X
30054	NMR solution structure of [Sp, Sp]-PT dsDNA	X		X
30056	DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTGG) in sodium	X		X
30058	DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium	X		X
30089	Solution Structure of Hge36: Scorpine-like Peptide from Hadrurus Gertschi	X	X
30106	Phenol-soluble modulin Alpha 3	X	X
30107	Phenol-soluble modulin Beta2	X	X
30109	Structure of Phenol-soluble modulin Alpha1	X	X
30155	NMR solution structure of the RRM1 domain of the post-transcriptional regulator HuR	X	X
30156	Solution NMR-derived structure of calmodulin bound with ER alpha peptides	X	X
30163	NMR Structure of Apo-form Human Tear Lipocalin	X	X
30176	The Solution Structure of the Magnesium-bound Conantokin-R1B Mutant	X	X
30178	The Solution Structure of the Magnesium-bound Conantokin-R1B Mutant	X	X
30179	The Solution Structure of the Magnesium-bound Conantokin-R1B Mutant	X	X
30184	Solution structure of parallel stranded adenosine duplex r(AAAA)-dA-r(AAA)	X				X
30185	NMR structure of apo-PS1	X	X
30186	NMR structure of holo-PS1	X	X
30197	Solution structure of Serine 65 phosphorylated UBL domain from parkin	X	X
30202	Alpha Helix Nucleation by a Simple Cyclic Tetrapeptide	X	X
30203	Alpha Helix Nucleation by a Simple Cyclic Tetrapeptide	X	X
30212	Ocellatin-LB2, solution structure in TFE by NMR spectroscopy	X	X
30213	Ocellatin-F1, solution structure in TFE by NMR spectroscopy	X	X
30214	Ocellatin-LB1, solution structure in DPC micelle by NMR spectroscopy	X	X
30215	Ocellatin-LB2	X	X
30216	Ocellatin-F1	X	X
30217	Ocellatin-LB1, solution structure in SDS micelle by NMR spectroscopy	X	X
30218	Ocellatin-LB2, solution structure in SDS micelle by NMR spectroscopy	X	X
30219	Ocellatin-F1, solution structure in SDS micelle by NMR spectroscopy	X	X
30225	NMR SOLUTION STRUCTURE OF ALPHA-CONOTOXIN GID MUTANT A10V	X	X
30226	NMR SOLUTION STRUCTURE OF THE ALPHA-CONOTOXIN GID MUTANT V13Y	X	X
30229	Solution NMR Structure of Lasso Peptide Acinetodin	X	X
30230	Solution NMR Structure of Lasso Peptide Klebsidin	X	X
30232	ovGRN12-35_3s	X	X
30238	Solution structure of chemically synthesized antilisterial Pediocin PA-1 analog.	X	X
30244	Heterogeneous-backbone Foldamer Mimic of the Sp1-3 Zinc Finger	X	X
30248	peptide 38146 derived from fragment 41-60 of Plasmodium falciparum Thrombospondin-Related Sporozoite Protein (TRSP)	X	X
30256	Brassica napus DGAT1 exosite	X	X
30259	Solution structure of arenicin-3.	X	X
30260	Solution structure of arenicin-3 synthetic analog.	X	X
30261	HnRNP A1 Alters the Conformation of a Conserved Enterovirus IRES Domain to Stimulate Viral Translation	X			X
30262	HnRNP A1 Alters the Conformation of a Conserved Enterovirus IRES Domain to Stimulate Viral Translation	X			X
30263	Suboptimization of a glycine rich peptide allows the combinatorial space exploration for designing novel antimicrobial peptides	X	X
30265	Peptide 38148 modified from fragment 41-60 of Plasmodium falciparum Thrombospondin-Related Sporozoite Protein (TRSP)	X	X
30270	Peptide 38136 modified from fragment 21-37 of Plasmodium falciparum Cell-Traversal Protein for Ookinetes and Sporozoites (CelTOS)	X	X
30286	Solution NMR structure of the membrane electron transporter CcdA	X	X
30287	Peptide 38138 modified from fragment 21-37 of Plasmodium falciparum Cell-Traversal Protein for Ookinetes and Sporozoite (Pf-CelTOS)	X	X
30291	Structure of a Turripeptide from Unedogemmula bisaya venom	X	X
30292	Peptide 38142 modified from fragment 41-60 of Plasmodium falciparum Thrombospondin-Related Sporozoite Protein (TRSP)	X	X
30293	NMR structure of Ydj1 J-domain, a cytosolic Hsp40 from Saccharomyces cerevisiae	X	X
30303	Solution Structure of ETS Transcription Factor PU.1	X	X
30311	Solution structure of phage displayed derived peptide inhibitor of frizzled 7 receptor	X	X
30312	Solution structure of the de novo mini protein gHEEE_02	X	X
30313	SOLUTION NMR STRUCTURE OF SIGLEC-5 BINDING DOMAIN FROM STREPTOCOCCAL BETA PROTEIN	X	X
30323	Solution NMR structure of cyclotide MCoTI-I	X	X
30324	Solution NMR structure of cyclotide MCoTI-I	X	X
30337	PawL-Derived Peptide PLP-12	X	X
30338	PawL-Derived Peptide PLP-4	X	X
30341	PawL-Derived Peptide PLP-2	X	X
30343	PawL-Derived Peptide PLP-10 (trans conformer)	X	X
30344	PawL-Derived Peptide PLP-10 (cis conformer)	X	X
30351	NMR solution structure of Defensin1 from Centruroides limpidus limpidus	X	X
30354	NMR solution structure of Defensin1 from Centruroides limpidus limpidus	X	X
30379	NMR structure of Sodium/Calcium Exchanger 1 (NCX1) Two-helix Bundle (THB) domain	X	X
30380	SFTI-HFRW-1	X	X
30381	SFTI-HFRW-3	X	X
30382	SFTI-HFRW-2	X	X
30383	SFTI-HFRW-4	X	X
30386	Two-State 14-mer UUCG Tetraloop calculated from Exact NOEs (State one: Conformers 1-5, State Two: Conformers 6-10)	X			X
30389	Solution structure of AGL55	X	X
30390	Solution structure of KTI55	X	X
30391	Solution structure of VEK75	X	X
30400	NMR data-driven model of GTPase KRas-GMPPNP:Cmpd2 complex tethered to a nanodisc	X	X
30407	Solution structure of a 14mer fragment of the p21 protein	X	X
30411	Solution NMR structure of JzTx-V, a Nav 1.7 inhibitory peptide	X	X
30413	JzTx-V toxin peptide, wild-type	X	X
30414	Lactam cyclised mimetic of a fragment of p21	X	X
30415	Lactam cyclised mimetic of a fragment of p21	X	X
30424	LyeTxI-b, a synthetic peptide derived from Lycosa erythrognatha spider venom, shows potent antibiotic activity, in vitro and in vivo	X	X
30425	MT1-MMP HPX domain with Blade 4 Loop Bound to Nanodiscs	X	X
30426	MT1-MMP HPX Domain with Blade 2 Loop Bound to Nanodiscs	X	X
30436	Solution structure of SH3 domain from Shank1	X	X
30437	Solution structure of SH3 domain from Shank2	X	X
30438	Solution structure of SH3 domain from Shank3	X	X
30446	HRFLRH peptide NMR structure	X	X
30447	HRFLRH peptide NMR structure in the presence of Cd(II)	X	X
30448	HRFLRH peptide NMR structure in the presence of CO2	X	X
30449	HRFLRH peptide NMR structure in the presence of Zn(II)	X	X
30453	Trp-cage tr16b R16Nva : Elimination of pH Dependent Interactions	X	X
30454	Tamapin mutant DP30	X	X
30459	NMR solution structure of tamapin, mutant Y31+N	X	X
30460	NMR solution structure of tamapin, mutant DP30/Y31+N	X	X
30461	NMR solution structure of tamapin, mutant E25K	X	X
30462	NMR solution structure of tamapin, mutant K27E	X	X
30463	NMR solution structure of tamapin, mutant E25K/K27E	X	X
30464	NMR solution structure of tamapin, mutant K20E	X	X
30465	NMR solution structure of tamapin, mutant Y31H	X	X
30466	NMR solution structure of tamapin, mutant Y31A	X	X
30467	NMR solution structure of tamapin, mutant E25A	X	X
30468	NMR solution structure of tamapin, mutant K27A	X	X
30475	Solution structure of ZmD32	X	X
30476	Solution structure of the cyclic tetrapeptide, PYPV	X	X
30486	Solution structure of Rbfox2 RRM mimetic peptide CPfox2	X	X
30489	Solution structure of Rbfox2 RRM mimetic peptide CPfox6	X	X
30490	Solution structure of Rbfox2 RRM mimetic peptide CPfox7	X	X
30491	NMR solution structure of the CARD9 CARD bound to zinc	X	X
30492	NMR solution structure of the CARD9 CARD	X	X
30496	Heterogeneous-Backbone Mimics of a Designed Disulfide-Rich Protein: Aib turn	X	X
30497	Heterogeneous-Backbone Mimics of a Designed Disulfide-Rich Protein: Orn turn	X	X
30498	Heterogeneous-Backbone Mimics of a Designed Disulfide-Rich Protein: Aib turn, beta3 helix, N-methyl hairpin	X	X
30499	Heterogeneous-Backbone Mimics of a Designed Disulfide-Rich Protein: Aib turn, Aib helix, N-methyl hairpin	X	X
30501	Solution structure of ZZZ3 ZZ domain in complex with histone H3 tail	X	X
30518	Lim5 domain of PINCH1 protein	X	X
30519	NMR Solution structure of GIIIC	X	X
30521	Solution NMR structure of spider toxin analogue [E17K]ProTx-II	X	X
30522	Solution NMR structure of spider toxin analogue [F5A,M6F,T26L,K28R]GpTx-1	X	X
30544	NMR solution structure of Protonectin (Agelaia pallipes pallipes) interacting with SDS micelles: an antimicrobial peptide with anticancer activity on breast cancer cells	X	X
30548	RNA Duplex containing the internal loop 5'-UUCG/3'-GCUU	X			X
30566	hGRNA4-28_3s	X	X
30567	NMR Structure of the DNA binding domain of EhMybS3	X	X
30568	SOLUTION STRUCTURE OF CN29, A TOXIN FROM CENTRUROIDES NOXIUS SCORPION VENOM	X	X
30585	Solution structure of MLL4 PHD6 domain in complex with histone H4K16ac peptide	X	X
30586	Syn-safencin	X	X
30587	Syn-safencin 24	X	X
30588	Syn-safencin 56	X	X
30597	Wasabi Receptor Toxin	X	X
30599	Solution structure of VEK50RH1/AA	X	X
30600	Solution structure of truncated peptide from PAMap53	X	X
30603	Solution structure of VEK50 in the bound form with plasminogen kringle 2	X	X
30604	Solution NMR structure of a quiet outer membrane protein G Nanopore (OmpG mutant: Delta-L6-D215)	X	X
30605	SOLUTION STRUCTURE OF THE COMPLEX OF MUTANT VEK50[RH1/AA] AND PLASMINOGEN KRINGLE 2	X	X
30606	SOLUTION STRUCTURE OF THE COMPLEX OF MUTANT VEK50[RH2/AA] AND PLASMINOGEN KRINGLE 2	X	X
30630	Solution structure of OlvA(BCS)	X	X
30631	Solution structure of OlvA(BC)	X	X
30641	Backbone-modified variant of zinc finger 2 from the transcription factor Sp1 DNA binding domain: D-Pro in the metal-binding turn	X	X
30642	Backbone-modified variant of zinc finger 2 from the transcription factor Sp1 DNA binding domain: Aib in the metal-binding turn	X	X
30643	Backbone-modified variant of zinc finger 2 from the transcription factor Sp1 DNA binding domain: Orn in the metal-binding turn	X	X
30644	Backbone-modified variant of zinc finger 2 from the transcription factor Sp1 DNA binding domain: altered helix, loop, turn, and sheet	X	X
30673	Backbone-modified variant of zinc finger 2 from the transcription factor Sp1 DNA binding domain: BTD in the metal-binding turn	X	X
30674	Zinc finger 2 from the transcription factor Sp1 DNA binding domain	X	X
30681	3D structure of the leiomodin/tropomyosin binding interface	X	X
30683	Solution structure of the cyclic peptide 3.1B	X	X
30686	Solution structure of AGL55-Kringle 2 complex	X	X
30687	Solution structure of KTI55-Kringle 2 complex	X	X
30719	NMR solution structure of tamapin, mutant K20A	X	X
30720	Solution structure of antifungal plant defensin PvD1	X	X
30734	NMR-driven structure of KRAS4B-GTP homodimer on a lipid bilayer nanodisc	X	X
30735	NMR-driven structure of KRAS4B-GDP homodimer on a lipid bilayer nanodisc	X	X
30753	Solution NMR structure of de novo designed TMB2.3	X	X
30763	Solution NMR Structure of DE NOVO DESIGNED Rossmann 2x3 Fold Protein r2x3_168, Northeast Structural Genomics Consortium (NESG) Target OR386	X	X
30765	Structural characterization of the type III secretion system pilotin-secretin complex InvH-InvG by NMR spectroscopy	X	X
30768	Structure of the Self-Association Domain of Swallow	X	X
30769	Structure of HIV-1 Vpr in complex with the human nucleotide excision repair protein hHR23A	X	X
30770	Ablb 1b isoform active state	X	X
30771	Abl isoform 1b inactive1 state	X	X
30772	Abl 1b isoform inactive2 state	X	X
30773	Intrinsically disordered bacterial polar organizing protein Z, PopZ, interacts with protein binding partners through an N-terminal Molecular Recognition Feature	X	X
30774	NMR structure of the cNTnC-cTnI chimera bound to calcium desensitizer W7	X	X
30775	Solution NMR structure of neuroVAL, a derived peptide from wasp	X	X
30776	Solution NMR structure of protonectin, a peptide from wasp	X	X
30777	Solution structure of a reconstructed XCL1 ancestor	X	X
30778	Solution NMR structure of protonectin-F, a derived peptide from wasp	X	X
30779	NMR structure of the Streptococcus pyogenes NAD+-glycohydrolase translocation domain	X	X
30783	NMR Solution Structure of plant defensin AtD90	X	X
30784	NMR Solution Structure of plant defensin SlD26	X	X
30786	Solution NMR structure of human Brd3 ET domain with MLV IN C-terminal Tail Peptide (TP) complex	X	X
30789	Solution NMR structure of Prochlorosin 2.11 (Pcn2.11) produced by Prochlorococcus MIT 9313	X	X
30790	Solution NMR structure of human Brd3 ET complexed with NSD3(148-184) peptide	X	X
30791	Solution NMR structure and dynamics of human Brd3 ET in complex with MLV IN CTD	X	X
30792	Peptide from stony coral Heliofungia actiniformis: Hact-1	X	X
30793	Solution structure of lantibiotic from Paenibacillus kyungheensis	X	X
30796	Solution NMR Structure of the Coiled-coil BRCA1-PALB2 Heterodimer	X	X
30797	Dengue 5'UTR SLA	X			X
30798	Solution Structure of the Dysferlin C2A Domain in its Calcium-free State	X	X
30800	Solution Structure of the Corynebacterium diphtheriae SpaA Pilin-Signal Peptide Complex	X	X
30801	NMR solution structures of tirasemtiv drug bound to a fast skeletal troponin C-troponin I complex	X	X
30802	Solution NMR Structure of DE NOVO DESIGNED Rossmann 3x3 Fold Protein r3x3_bp3, Northeast Structural Genomics Consortium (NESG) Target OR689	X	X
30807	The structure of anti-CRISPR AcrIE2	X	X
30808	Solution structure of the PHD1 domain of histone demethylase KDM5A	X	X
30809	Solution structure of the PHD1 domain of histone demethylase KDM5A in complex with a histone H3(1-10) peptide	X	X
30811	Solution structure of the alpha-conotoxin analogue [2-8]-alkyne Vc1.1	X	X
30812	Solution NMR structure of CDHR3 extracellular domain EC1	X	X
30813	NMR Solution Structure of Acyclotide ribe 31	X	X
30814	Solution Structure of the Dysferlin C2A Domain in its Calcium-bound State	X	X
30816	Au1 Domain of VEGF Readthrough Element	X			X
30817	Ax1 Domain of VEGF Readthrough Element	X			X
30818	Ax2 Domain of VEGF Readthrough Element	X			X
30819	NMR Structure of a tRNA 2'-phosphotransferase from Runella slithyformis	X	X
30820	NMR Structure of a tRNA 2'-phosphotransferase from Runella slithyformis in complex with NAD+	X	X
30824	Protein complex	X	X
30826	NMR solution structure of Nak1 from the Necator americanus hookworm	X	X
30827	Solution NMR structure of the dimeric form of the cyclic plant protein PDP-23 in H2O	X	X
30828	Solution NMR structure of the monomeric form of the cyclic plant protein PDP-23 in CD3CN/H2O	X	X
30829	Solution NMR structure of the cyclic plant protein PDP-23 in SDS micelles	X	X
30830	Solution NMR structure of the cyclic plant protein PDP-23 in DPC micelles	X	X
30834	NMR solution structure of Nav1.5 DIV S3b-S4a paddle motif in DPC micelle	X	X
30839	Connecting hydrophobic surfaces in cyclic peptides increases membrane permeability	X	X
30840	Connecting hydrophobic surfaces in cyclic peptides increases membrane permeability	X	X
30842	SARS-CoV-2 spike Protein TM domain	X	X
30843	Aspartimidylated Lasso Peptide Lihuanodin	X	X
30844	High resolution NMR solution structure of a de novo designed minimal thioredoxin fold protein	X	X
30845	The haddock model of GDP KRas in complex with promazine using chemical shift perturbations and intermolecular NOEs	X	X
30846	Structural characterization of two b-KTx scorpion toxins. One of them blocks human KCNQ1 potassium channels	X	X
30847	NMR structure of Beta-KTx14.3	X	X
30848	NMR Solution Structure of [T20K]kalata B1	X	X
30849	Omega ester peptide pre-fuscimiditide	X	X
30851	Aspartimidylated omega ester peptide fuscimiditide	X	X
30852	[2]Catenane From MccJ25 Variant G12C G21C	X	X
30853	Denv1 5'UTR Stem3	X			X
30854	NMR solution structure of PsDef2 defensin from P. sylvestris	X	X
30855	Structure of the HIV-1 gp41 transmembrane domain and cytoplasmic tail	X	X
30856	Model of the HIV-1 gp41 membrane-proximal external region, transmembrane domain and cytoplasmic tail	X	X
30857	Structure of Nedd4L WW3 domain	X	X
30858	Structure of Nedd4L WW3 domain	X	X
30866	Structure of the cryptic HMA domain of the human copper transporter ATP7A	X	X
30867	Structural studies about ScnTx neurotoxin using Solution NMR 2D and 3D	X	X
30868	Solution structure of the HIV-1 PBS-segment	X			X
30870	Jug R 2 Leader Sequence Residues 1-57	X	X
30871	Jug r 2 Leader Sequence Residues 69-111	X	X
30873	Structure of Hact-SCRiP1	X	X
30874	Structure and Interactions of DED1 of human cFLIP	X	X
30876	Solution NMR structure of an avian defensin, AvBD3, from mallard	X	X
30878	Structural and functional studies about scorpine showed the presence of blocking channel and cytolytic activities as well as two different structural domains	X	X
30879	Structural and functional studies about scorpine showed the presence of blocking channel and cytolytic activities as well as two different structural domains	X	X
30880	NMR structure of the Human T-cell leukemia virus 1 matrix protein	X	X
30888	NMR Structure of GCAP5	X	X
30890	Solution NMR structure of de novo designed protein 0515	X	X
30896	Structure of Hact-4	X	X
30899	Solution NMR structure of HDMX in complex with Zn and MCo-52-2	X	X
30901	Rules for designing protein fold switches and their implications for the folding code	X	X
30902	Rules for designing protein fold switches and their implications for the folding code	X	X
30904	Rules for designing protein fold switches and their implications for the folding code	X	X
30907	Solution Structure of Berberine Bound to a dGMP Fill-in G-Quadruplex in the PDGFR-b Promoter	X		X
30909	Fusion Peptide of SARS-CoV-2 Spike Rearranges into a Wedge Inserted in Bilayered Micelles	X	X
30910	Anaplastic lymphoma kinase (ALK) extracellular ligand binding region 673-1025	X	X
30911	AUGalpha - FAM150B - ALKL2 77-152	X	X
30912	AUGbeta - FAM150A - ALKL1 60-128	X	X
30913	NMR structure of EpI[Y(SO)315Y]-OH	X	X
30915	NMR structure of native PnIA	X	X
30916	NMR structure of native AnIB	X	X
30917	NMR structure of AnIB-OH	X	X
30918	NMR structure of AnIB[Y(SO3)16Y]-NH2	X	X
30919	NMR structure of AnIB[Y(SO3)16Y]-OH	X	X
30920	NMR structure of native EpI	X	X
30921	NMR structure of EpI-OH	X	X
30922	NMR structure of EpI-[Y(SO3)15Y]-NH2	X	X
30925	NMR Solution structure of Se0862	X	X
30926	Solution NMR structure of peptidase domain from Clostridium thermocellum PCAT1	X	X
30927	SDE2-apo	X	X
30928	Solution structure of peptide toxin MIITX2-Mg1a from the venom of the Australian giant red bull ant Myrmecia gulosa	X	X
30931	Membrane bound structure of HR1 domain of SARS-CoV-2 spike protein	X	X
30932	Heterogeneous-backbone proteomimetic analogue of the disulfide-rich venom peptide lasiocepsin	X	X
30933	Solution NMR Structure of [Ala19]Crp4	X	X
30934	Solution NMR Structure of [D-Ala19]Crp4	X	X
30935	NMR Solution structure of linear [T20K]kalataB1	X	X
30938	hyen D solution structure	X	X
30939	Structures of the Intracellular Domain and Transmembrane Domain of the Human alpha7 Nicotinic Acetylcholine Receptors	X	X
30942	An RNA aptamer that decreases flavin redox potential	X			X
30943	Solution structure of first cyclization domain (Cy1) from yersiniabactin synthetase	X	X
30946	NMR Solution Structure of hGal(2-12)KK, a solubility-tagged truncation of the human neuropeptide galanin	X	X
30947	NMR Solution Structure of hGal(1-12)KK, a solubility-tagged truncation of the human neuropeptide galanin	X	X
30948	NMR Solution Structure of hGal(1-12)KK, a solubility-tagged truncation of the human neuropeptide galanin	X	X
30949	NMR Solution Structure of Cter 27	X	X
30950	Solution NMR structure of substrate bound peptidase domain from PCAT1	X	X
30956	Solution structure of the zinc finger domain of murine MetAP1, complexed with ZNG N-terminal peptide	X	X
30960	Solution NMR Structure of Immunoglobulin-like Domain of Human Neuregulin-1	X	X
30961	Solution structure of spider toxin Ssp1a	X	X
30970	NMR structure of a designed cold unfolding four helix bundle	X	X
30975	Truncated Ac-AIP-2	X	X
30976	The peptide Lt-MAP4 is an analog derived from the Ltc-3a. The primary sequence of the parental peptide was used as template for rational design, using the amino acid residues for modification of charge and hydrophobicity.	X	X
30977	NMR structure of crosslinked cyclophilin A	X	X
30978	Structural characterization of the biological synthetic peptide pCEMP1	X	X
30979	Chickpea (Cicer arientinum) nodule-specific cysteine-rich peptide NCR13: Solution NMR structure of the isomer with C4:C10, C15:C30, and C23:C28 disulfide bonds	X	X
30980	B Domain of Staphylococcal protein A: Native backbone	X	X
30981	Backbone-modified variant of the B domain of Staphylococcal protein A: beta3-residues in helix 2	X	X
30982	Backbone-modified variant of the B domain of Staphylococcal protein A: Aib residues in helix 2	X	X
30983	Backbone-modified variant of the B domain of Staphylococcal protein A: beta3-residues in helix 3	X	X
30984	Backbone-modified variant of the B domain of Staphylococcal protein A: Aib residues in helix 3	X	X
30985	Solution structure of the phosphatidylinositol 3-phosphate binding domain from the Legionella effector SetA	X	X
30986	NMR solution structure of the phosphorylated MUS81-binding region from human SLX4	X	X
30987	Disulfide-rich venom peptide lasiocepsin: P20A mutant	X	X
30988	Heterogeneous-backbone proteomimetic analogue of the disulfide-rich venom peptide lasiocepsin: native loop	X	X
30989	Heterogeneous-backbone proteomimetic analogue of the disulfide-rich venom peptide lasiocepsin: beta-3-Lys modified loop	X	X
30990	Heterogeneous-backbone proteomimetic analogue of the disulfide-rich venom peptide lasiocepsin: D-Ala modified loop	X	X
30991	Structural of the globular isoform of the novel conotoxin PnID derived from Conus pennaceus	X	X
30992	Structure of the globular isoform of the novel conotoxin PnID derived from Conus pennaceus	X	X
30993	Solution structure for Bartonella henselae BamE, a component of the beta-barrel assembly machinery complex. Seattle Structural Genomics Center for Infectious Disease target BaheA.17605.a	X	X
30994	Iturin from Bacillus subtilis ATCC 19659	X	X
31005	NMR structure of the cNTnC-cTnI chimera bound to W8	X	X
31006	NMR structure of the cNTnC-cTnI chimera bound to W6	X	X
31007	Evolution avoids a pathological stabilizing interaction in the immune protein S100A9	X	X
31011	Solution NMR structure of hexahistidine tagged QseM (6H-QseM)	X	X
31017	NMR solution structure of the De novo designed small beta-barrel protein 29_bp_sh3	X	X
31018	NMR solution structure of the De novo designed small beta-barrel protein 33_bp_sh3	X	X
31020	GFP Nanobody NMR Structure	X	X
31029	NMR Structure of Ac-hGal(17-30)NH2, an N-terminally acetylated fragment of the C-terminus of human galanin	X	X
31030	Site 2 insulin receptor binding peptide IM459N21	X	X
31031	NMR Structure of Streptococcal Protein GB1 Backbone Modified Variant: beta-ACPC24, beta-3-Lys28, beta-3-Lys31, beta-ACPC35	X	X
31032	NMR Solution Structure of C-terminally amidated, Full-length Human Galanin	X	X
31034	Preligand association structure of DR5	X	X
31036	Aspartimidylated Graspetide Amycolimiditide	X	X
31037	Antimicrobial lasso peptide cloacaenodin	X	X
31055	NMR solution structure of lambda-MeuKTx-1	X	X
31058	Alpha7 nicotinic acetylcholine receptor intracellular and transmembrane domains bound to ivermectin in a desensitized state	X	X
31066	NMR Solution Structure of LvIC analogue	X	X
34026	NMR solution structure of human FNIII domain 2 of NCAM	X	X
34034	A two-quartet G-quadruplex formed by human telomere in KCl solution at neutral pH	X		X
34035	A two-quartet G-quadruplex formed by human telomere in KCl solution at pH 5.0	X		X
34053	Structure of a stable G-hairpin	X		X
34055	C-terminal domain structure of VSG M1.1	X	X
34060	NMR solution structure of Harzianin HK-VI in DPC micelles	X	X
34065	NMR solution structure of Harzianin HK-VI in SDS micelles	X	X
34066	NMR solution structure of Harzianin HK-VI in trifluoroethanol	X	X
34070	Biosynthetic engineered A22S-B3K-B31R human insulin monomer structure in water/acetonitrile solutions.	X	X
34071	2'F-ANA/DNA Chimeric TBA Quadruplex structure	X		X
34074	HYL-20	X	X
34075	HYL-20k	X	X
34081	Solution structure of TDP-43 (residues 1-102)	X	X
34083	G-quadruplex formed within promoters of Plasmodium falciparum B var genes	X		X
34084	G-quadruplex formed within promoters of Plasmodium falciparum B var genes - form I	X		X
34086	Solution structure of a human G-Quadruplex hybrid-2 form in complex with a Gold-ligand	X		X
34087	Biosynthetic engineered A21K-B31K-B32R human insulin monomer structure in water/acetonitrile solution	X	X
34089	Sigma1.1 domain of sigmaA from Bacillus subtilis	X	X
34090	Peptide-membrane interaction between targeting and lysis	X	X
34091	Peptide-membrane interaction between targeting and lysis	X	X
34092	Peptide-membrane interaction between targeting and lysis	X	X
34098	Structure of Tau(254-290) bound to F-actin	X	X
34099	Structure of Tau(292-319) bound to F-actin	X	X
34118	An i-motif containing the neutral cytidine protonated analogue pseudoisocytidine	X		X
34120	Solution structure of the C-terminal domain of S. aureus Hibernating Promoting Factor (CTD-SaHPF)	X	X
34129	Structure of Tau(254-268) bound to F-actin	X	X
34130	NMR assignment and structure of a peptide derived from the fusion peptide of HIV-1 gp41 in the presence of dodecylphosphocholine micelles	X	X
34134	NMR assignment and structure of a peptide derived from the fusion peptide of HIV-1 gp41 in the presence of dodecylphosphocholine micelles	X	X
34135	M2 G-quadruplex dilute solution	X		X
34136	M2 G-quadruplex 20 wt% ethylene glycol	X		X
34137	M2 G-quadruplex 10 wt% PEG8000	X		X
34145	G-quadruplex of Human papillomavirus type 52	X		X
34160	Putative active dimeric state of GHR transmembrane domain	X	X
34162	Structure of minimal i-motif domain	X		X
34164	Putative inactive (dormant) dimeric state of GHR transmembrane domain	X	X
34168	G-quadruplex structure of DNA oligonucleotide containing GGGGCC repeats linked to ALS and FTD	X		X
34171	NMR derived model of the 5'-splice site of SMN2 in complex with the 5'-end of U1 snRNA	X			X
34178	Solid-state MAS NMR structure of the HELLF prion amyloid fibrils	X	X
34191	solution NMR structure of EB1 C terminus (191-260)	X	X
34199	Specific phosphorothioate substitution within domain 6 of a group II intron ribozyme leads to changes in local structure and metal ion binding	X			X
34221	The 1,8-bis(aminomethyl)anthracene and Quadruplex-duplex junction complex	X		X
34231	Solution Structure of p300Taz2-p63TA	X	X
34233	Solution structure of p300Taz2-p73TA1	X	X
34236	Solution structure of mule deer prion protein with polymorphism S138	X	X
34240	Protein environment affects the water-tryptophan binding mode. Molecular dynamics simulations of Engrailed homeodomain mutants	X	X
34271	Structural insights into AapA1 toxin	X	X
34276	Tc-DNA/RNA duplex	X		X	X
34277	tc-DNA/tc-DNA duplex	X		X
34280	Tc-DNA/DNA duplex	X		X
34281	Solution structure of the hazel allergen Cor a 1.0401	X	X
34285	Solution structure of the capsid domain from the activity-regulated cytoskeleton-associated protein, Arc	X	X
34302	The major G-quadruplex form of HIV-1 LTR	X		X
34309	Yeast V-ATPase transmembrane helix 7 NMR structure in DPC micelles	X	X
34314	Peptide-membrane interaction between targeting and lysis	X	X
34315	Peptide-membrane interaction between targeting and lysis	X	X
34316	Peptide-membrane interaction between targeting and lysis	X	X
34339	Structure determination of N-terminal fragment of UL49.5 protein from bovine herpesvirus 1 by NMR spectroscopy and molecular dynamics	X	X
34347	Assessment of a large enzyme-drug complex by proton-detected solid-state NMR without deuteration	X	X
34353	TINA-conjugated antiparallel DNA triplex	X		X
34360	Solution NMR of synthetic analogues of nisin and mutacin ring A and ring B - Nisin Ring B (Lan8,11) analogue	X	X
34363	Solution NMR of synthetic analogues of nisin and mutacin ring A and ring B - Mutacin I Ring B, major conformer	X	X
34365	Solid-state NMR structure of outer membrane protein AlkL in DMPC lipid bilayers	X	X
34369	Solution NMR of synthetic analogues of nisin and mutacin ring A and ring B - Mutacin I Ring B, minor conformer	X	X
34370	Solution NMR of synthetic analogues of nisin and mutacin ring A and ring B - Nisin Ring B	X	X
34371	Solution NMR of synthetic analogues of nisin and mutacin ring A and ring B - Mutacin I Ring A truncated analogue	X	X
34372	Solution NMR of synthetic analogues of nisin and mutacin ring A and ring B - Mutacin I Ring A	X	X
34373	Solution NMR of synthetic analogues of nisin and mutacin ring A and ring B - Mutacin I Ring A (Ser2, Ala5, Ala8) analogue	X	X
34374	Solution NMR of synthetic analogues of nisin and mutacin ring A and ring B - nisin ring A	X	X
34386	SC14 G-hairpin	X		X
34400	RW16 peptide	X	X
34411	Winter flounder 1a in SDS micelles	X	X
34412	Winter flounder 3 in SDS micelles	X	X
34413	Winter flounder 4 in SDS micelles	X	X
34414	a9 PEPTIDE	X	X
34416	Winter flounder 1 in SDS micelles	X	X
34440	Solution structure of the amyloid beta-peptide (1-42)	X	X
34446	Bam_5924 docking domain	X	X
34451	Solution structure of MacpD, a acyl carrier protein, from Pseudomonas fluorescens involved in Mupirocin biosynthesis.	X	X
34467	Pre-folded structures govern folding pathways of human telomeric G-quadruplexes	X		X
34469	Solution Structure of Docking Domain Complex of Pax NRPS: PaxC NDD - PaxB CDD	X	X
34470	Solution structure of PD-i6 peptide inhibitor of the human PD-1 extracellular domain	X	X
34474	Solution structure of PD-i3 peptide inhibitor of the human PD-1 extracellular domain	X	X
34476	Solution structure of antimicrobial peptide, crabrolin Plus in the presence of Lipopolysaccharide	X	X
34480	Solution structure of Legionella pneumophila NttA	X	X
34482	Constitutive decay element CDE2 from human 3'UTR	X			X
34483	Constitutive decay element CDE1 from human 3'UTR	X			X
34484	Constitutive decay element CDE2 from human 3'UTR	X			X
34491	Cortistatin analog with improved immunoregulatory activity	X	X
34494	Rhodospirillum rubrum oxidized CooT solution structure	X	X
34495	Rhodospirillum rubrum reduced CooT solution structure	X	X
34526	Solution structure of unliganded MLKL executioner domain	X	X
34527	Structure of the cysteine-rich domain of PiggyMac, a domesticated PiggyBac transposase involved in programmed genome rearrangements	X	X
34528	Solution structure of MLKL executioner domain in complex with a covalent inhibitor	X	X
34529	G-quadruplex with a G-A bulge	X		X
34534	Spor protein DedD	X	X
34537	TFIIS N-terminal domain (TND) from human LEDGF/p75	X	X
34538	TFIIS N-terminal domain (TND) from human IWS1	X	X
34539	TFIIS N-terminal domain (TND) from human PPP1R10	X	X
34540	TFIIS N-terminal domain (TND) from human MED26	X	X
34541	TFIIS N-terminal domain (TND) from human IWS1	X	X
34552	Structure-function analyses of dual-BON domain protein DolP identifies phospholipid binding as a new mechanism for protein localisation to the cell division site	X	X
34555	Structural evolution of the tissue-specific U2AF2 paralog and alternative splicing factor LS2	X	X
34556	Structural evolution of the tissue-specific U2AF2 paralog and alternative splicing factor LS2	X	X
34557	Solution structure of the TAF4-RST domain	X	X
34560	Solution structure of U1-A RRM2 (190-282)	X	X
34572	Solution structure of the fluorogen-activating protein FAST in complex with the ligand N871b	X	X
34573	Solution structure of the fluorogen-activating protein FAST in the apo state	X	X
34575	Solution structure of a non-covalent extended docking domain complex of the Pax NRPS: PaxA T1-CDD/PaxB NDD	X	X
34576	Solution structure of the Pax NRPS docking domain PaxB NDD	X	X
34577	Dynamic complex between all-D-enantiomeric peptide D3 with wild-type amyloid precursor protein 672-726 fragment (amyloid beta 1-55)	X	X
34578	Dynamic complex between all-D-enantiomeric peptide D3 with L723P mutant of amyloid precursor protein (APP) 672-726 fragment (amyloid beta 1-55)	X	X
34582	Solution structure of A. thaliana core TatA in DHPC micelles	X	X
34585	Solution Structure of RoxP	X	X
34586	NMR structure of an optimized version of the first TPR domain of the human SPAG1 protein	X	X
34587	deoxyxylose nucleic acid hairpin	X		X
34588	deoxyxylose nucleic acid hairpin	X		X
34589	Solution structure of the chloroplast outer envelope channel OEP21	X	X
34594	Solution structure of DNA duplex containing a 2'-deoxy-2'2'-difluorodeoxycytidine (gemcitabine) modification	X		X
34595	Solution structure of DNA:RNA hybrid containing a 2'-deoxy-2'2'-difluorodeoxycytidine (gemcitabine) modification	X		X	X
34596	Solution structure of DNA duplex containing a 7,8-dihydro-8-oxo-1,N6-ethenoadenine base modification that induces exclusively A->T transversions in Escherichia coli	X		X
34598	Tick salivary protein BSAP1	X	X
34599	Solution structure of DNA:RNA hybrid duplex	X		X	X
34600	N-terminal C2H2 Zn-finger domain of Clamp	X	X
34602	NMR structure of Rv1813c from Mycobacterium tuberculosis	X	X
34603	Solution structure of MLKL executioner domain in complex with a fragment	X	X
34604	Solution structure of MLKL executioner domain in complex with a fragment	X	X
34605	Solution structure of MLKL executioner domain in complex with a fragment	X	X
34606	cytoplasmic domain of Vibrio cholerae ToxR	X	X
34607	periplasmic domain of Vibrio cholerae ToxR	X	X
34608	Calmodulin extracts the Ras family protein RalA from lipid bilayers by engagement with two membrane targeting motifs	X	X
34609	NMR structure of GIPC1-GH2 domain	X	X
34610	Solution structure of toll like receptor 1 (TLR1) TIR domain	X	X
34611	Three-quartet c-kit2 G-quadruplex stabilized by a pyrene conjugate	X		X
34613	Solution structure of Boskar4; a de novo designed G-CSF agonist	X	X
34614	BacSp222 bacteriocin: succinyl-K20 form	X	X
34616	The structure of an i-motif/duplex junction at neutral pH	X		X
34617	Solution NMR Structure of the Neh1 Domain of Human Nuclear factor erythroid 2-related factor 2 (NRF2)	X	X
34621	NMR structure of the Bak transmembrane helix in DPC micelles	X	X
34622	NMR structure of the Bak transmembrane helix in lipid nanodiscs	X	X
34623	A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine	X		X
34624	A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine	X		X
34625	A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine	X		X
34626	A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine	X		X
34627	Solution structure of Legionella pneumophila LspC	X	X
34628	NMR solution structure of SNX9 SH3 - EEEV nsP3 peptide complex	X	X
34629	EB1 bound to MACF peptide	X	X
34630	The NMR structure of the Zf-GRF domains from the mouse Endonuclease VIII-LIKE 3 (mNEIL3)	X	X
34632	NMR SOLUTION STRUCTURE OF [Pro3,DLeu9]TL	X	X
34633	Solution structure of antimicrobial peptide cathelicidin-1 PcDode from sperm whale Physeter catodon	X	X
34634	NMR Solution Structure of Peptide 12: First-in-class cyclic Temporin L analogue with antibacterial and antibiofilm activities	X	X
34638	Structure of the human UFC1 protein in complex with the UBA5 C-terminal UFC1-binding motif.	X	X
34640	Solution structure of human interleukin-9	X	X
34641	Solution structure of bee apamin	X	X
34642	Solution structure of the N-terminal domain of human telomeric Repeat-binding factor 2-interacting protein 1 (hRap1): implication for Rap1-TRF2 interaction in Human.	X	X
34643	Solution structure of the human SF3A1 ubiquitin-like domain	X	X
34645	Solution structures of HIV-1 and SIVmac p6 and their interaction with accessory proteins Vpr and Vpx in the presence of DPC micelles	X	X
34646	Solution structures of HIV-1 and SIVmac p6 and their interaction with accessory proteins Vpr and Vpx in the presence of DPC micelles	X	X
34647	Solution structures of HIV-1 and SIVmac p6 and their interaction with accessory proteins Vpr and Vpx in the presence of DPC micelles	X	X
34650	NMR structure of human ACE2 21-42 fragment in HFIP/water 50/50 v/v	X	X
34651	NMR structure of a peptide deriving from SARS-CoV-2 S RBD 482-506 fragment in HFIP/H2O	X	X
34652	NMR structure of a peptide deriving from SARS-CoV-2 Lineage B.1.1.7 S RBD 482-506 fragment in HFIP/H2O	X	X
34653	NMR structure of a peptide deriving from SARS-CoV-2 Lineages P.1 and B.1.351 S RBD 482-506 fragment in HFIP/H2O	X	X
34656	Structure of Insulin-like growth factor 1 receptor's transmembrane domain	X	X
34657	Structure of Insulin-like growth factor 1 receptor's transmembrane domain	X	X
34662	Structure of Insulin receptor-related receptor's transmembrane domain	X	X
34663	Solution structure of Legionella pneumophila LspD	X	X
34666	NMR Structure of RgpB C-terminal Domain	X	X
34667	NMR solution structure of BCR4	X	X
34668	Solution structure of the chimeric Nrd1-Nab3 heterodimerization domains	X	X
34669	Solution structure of the NRDI domain of Nab3	X	X
34673	Solution structure of RBM39 RRM2 bound to 5'-AGCUUUG-3	X	X		X
34675	The solution structure of hsDND1 RRM12 bound to CUUAUUUG RNA	X	X		X
34677	Solution structure of an intramolecular RNA G-quadruplex formed by the 6A mutant from a 22mer guanine-rich sequence within the 5'UTR of BCL-2 proto-oncogene	X			X
34678	Solution structure of the C terminal domain of MgtC (PA4635) from Pseudomonas aeruginosa	X	X
34679	10bp DNA/DNA duplex	X		X
34688	Two-state liquid NMR Structure of a PDZ2 Domain from hPTP1E, apo form	X	X
34693	Solution structure of the complex between plasmodial ZNHIT3 and NUFIP1 proteins	X	X
34695	Solution NMR structure of halophilic DnaE intein	X	X
34696	Llp mutant C1G, lytic conversion lipoprotein of phage T5	X	X
34697	Conformational ensemble of solnatide in solution	X	X
34700	GB1 in mammalian cells, 50 uM	X	X
34701	GB1 in mammalian cells, 10 uM	X	X
34704	Solution structure of the DNA-binding minor pilin FimT from Legionella pneumophila	X	X
34705	Hm-AMP2	X	X
34706	Hm-AMP8	X	X
34708	Structure in solution of the TANGO1 cargo-binding domain (21-131)	X	X
34709	Solution structure of homodimeric Capsid protein (residues 17-95) of Tick-borne encephalitis virus (d16-TBEVC)	X	X
34710	Solution NMR structure of N-acetylglucosaminyltransferase V (GnTV) TMD	X	X
34711	Solution NMR structure of N-acetylglucosaminyltransferase V (GnTV) G26P mutant TMD	X	X
34712	Solution NMR structure of N-acetylglucosaminyltransferase V (GnTV) G22L mutant TMD	X	X
34713	Solution NMR structure of N-acetylglucosaminyltransferase V (GnTV) G22L and G26L double mutant TMD	X	X
34714	Phen-DC3 intercalation causes hybrid-to-antiparallel transformation of human telomeric DNA G-quadruplex	X		X
34717	Structure of the ADP-ribosyltransferase TccC3HVR from Photorhabdus Luminescens	X	X
34719	Solution structure of the PulM C-terminal domain from Klebsiella oxytoca	X	X
34724	RNA binding induces an allosteric switch in Cyp33 to repress MLL1 mediated transcription regulation	X	X
34725	RNA binding induces an allosteric switch in Cyp33 to repress MLL1 mediated transcription regulation	X	X		X
34726	RNA binding induces an allosteric switch in Cyp33 to repress MLL1 mediated transcription regulation	X	X		X
34727	RNA binding induces an allosteric switch in Cyp33 to repress MLL1 mediated transcription	X	X
34728	RNA binding induces an allosteric switch in Cyp33 to repress MLL1 mediated transcription regulation	X	X
34732	Solution structure of Pi6, a low affinity blocking kappa-K+-channel peptide from the scorpion Pandinus imperator	X	X
34735	Dimeric i-motif from 2'Farabinocytidine-modified TC5	X		X
34739	NMR structure of holo-acp	X	X
34743	NMR structure of holo-acp	X	X
34744	NMR structure of holo-acp	X	X
34758	Human HSP90 alpha ATP Binding Domain, ATP-lid open conformation, R60A	X	X
34759	Human HSP90 alpha ATP Binding Domain, ATP-lid closed conformation, R46A	X	X
34767	NMR Structure of Big-defensin 5 from oyster Crassostrea gigas	X	X
34772	An i-motif domain able to undergo pH-dependent conformational transitions (acidic structure)	X		X
34774	An i-motif domain able to undergo pH-dependent conformational transitions (neutral structure)	X		X
34785	SH3 domain solved by the exact solid-state method from the Bruker Dynamics Center using the combined correction method with PDB 2NUZ	X	X
36016	Structure of roseltide rT1	X	X
36019	Solution structure of rattusin	X	X
36020	Structure of two CCTG repeats	X		X
36022	Structure of two TTTA repeats	X		X
36023	NMR structure of SLBA, a chimera of SFTI	X	X
36024	NMR structure of TIBA, a chimera of SFTI	X	X
36025	Solution structure of Tilapia Piscidin 4 (TP4) from Oreochromis niloticus	X	X
36037	Solution structure of a histone binding domain	X	X
36038	VG13P structure in LPS	X	X
36040	Morintides mO1	X	X
36041	Highly disulfide-constrained antifeedant jasmintides from Jasminum sambac flowers	X	X
36045	Solution structure of E.coli HdeA	X	X
36047	Solution NMR structure of peptide toxin SsTx from Scolopendra subspinipes mutilans	X	X
36048	Solution NMR Structure of DNA Mismatch Repair Protein MutT (Family Nudix Hydrolase) from Methicillin Resistant Staphylococcus aureus 252	X	X
36049	NMR structure of the SARS Coronavirus E protein pentameric ion channel	X	X
36057	Solution structure of a novel antimicrobial peptide, P1, from jumper ant Myrmecia pilosula	X	X
36059	Solution structure of musashi1 RBD2 in complex with RNA	X	X		X
36060	Solution Structure of the N-terminal Domain of TDP-43	X	X
36062	N-terminal Zinc Finger of Synaptotagmin-like Protein 4	X	X
36064	Solution structure of heterodimeric coiled-coil domain of Drosophila GABAB receptor 1 and 2	X	X
36066	Disulfide-constrained Wound Healing Peptide Derived from Pereskia bleo	X	X
36068	Vaccatide: Antifungal Glutamine-rich 8C-Hevein-like Peptide, vH1	X	X
36069	Esculentin-1a(1-21)NH2	X	X
36070	NMR solution structure of the aromatic mutant H43W H67F cytochrome b5	X	X
36071	NMR solution structure of the aromatic mutant H43F H67F cytochrome b5	X	X
36072	C-terminal zinc finger of RING finger protein 141	X	X
36073	TK9 NMR structure in DPC micelle	X	X
36074	TK9 NMR structure in SDS micelle	X	X
36075	The PHD finger of human Kiaa1045 protein	X	X
36079	Beta-Ginkgotides: Hyperdisulfide-constrained peptides from Ginkgo biloba	X	X
36080	NMR Structure and Localization of a Large Fragment of the SARS-CoV Fusion Protein: Implications in Viral Cell Fusion	X	X
36084	Solution structure of C-terminal domain of TRADD	X	X
36086	Solution structure of the major fish allergen parvalbumin Sco j 1 derived from the Pacific mackerel	X	X
36097	Structure of FLN IG21 domain in complex with C-terminal peptide of beta-2	X	X
36101	Solution structure of the complex between UVSSA acidic region and TFIIH p62 PH domain	X	X
36103	Pholiota squarrosa lectin trimer	X	X
36105	Solution structure of arenicin-3 derivative N6	X	X
36106	Solution structure of arenicin-3 derivative N1	X	X
36107	Solution structure of arenicin-3 derivative N2	X	X
36109	NMR-Based Model of the 22 Amino Acid Peptide in Polysialyltransferase Domain (PSTD) of the Polysialyltransferase ST8Sia IV	X	X
36110	NMR-Based Model of the 22 Amino Acid Peptide in Polysialyltransferase Domain (PSTD) of the Polysialyltransferase ST8Sia IV in the Presence of Polysialic Acid (PolySia)	X	X
36111	Solution structure of yeast Fra2	X	X
36112	NMR structure of the domain 5 of the E. coli ribosomal protein S1	X	X
36117	SOLUTION STRUCTURE OF HUMAN MOG1	X	X
36119	Solution Structure of the DISC1/Ndel1 complex	X	X
36136	Designed protein dRafX6	X	X
36146	mBjAMP1 structure	X	X
36147	solution structure of SMAP-18	X	X
36148	solution structure of G2,7,13A SMAP-18 analogue	X	X
36157	Nukacin ISK-1 in active state	X	X
36158	Nukacin ISK-1 in inactive state	X	X
36159	Solution structure for the 1:1 complex of a platinum(II)-based tripod bound to a hybrid-1 human telomeric G-quadruplex	X		X
36160	Solution structure for the unique dimeric 4:2 complex of a platinum(II)-based tripod bound to a hybrid-1 human telomeric G-quadruplex	X		X
36161	Solution structure of the SBDbeta domain of yeast Ssa1	X	X
36165	Solution structure of integrin b2 monomer tranmembrane domain in bicelle	X	X
36170	NMR structure of IRD7 from Capsicum annum.	X	X
36171	NMR structure of IRD12 from Capsicum annum.	X	X
36172	NMR structure of p75NTR transmembrane domain in complex with NSC49652	X	X
36176	Solution Structure of the N-terminal Domain of the Yeast Rpn5	X	X
36179	Solution structure of centrin4 from Trypanosoma brucei	X	X
36180	Solution Structure of Thioredoxin-Like Effector Protein (TRX3) from Edwardsiella tarda	X	X
36181	Solution structure of peptidyl-prolyl cis/trans isomerase domain of Trigger Factor in complex with MBP	X	X
36185	Solution structure of RRM domian of La protein from Trypanosoma brucei	X	X
36186	Solution Structure of the DNA complex of the C-terminal Domain of Rok	X	X	X
36187	Solution Structure of the DNA-Binding Domain of Rok	X	X
36207	The NMR Structure of the Polysialyltranseferase Domain (PSTD) in Polysialyltransferase ST8siaIV	X	X
36220	Solution structure of the N-terminal domain of the anti-sigma factor RsgI1 from Clostridium thermocellum	X	X
36221	Solution structure of the Sigma-anti-sigma factor complex RsgI1N-SigI1C from Clostridium thermocellum	X	X
36228	Three-dimensional Solution NMR Structure of KYE28-PEG48 in Microgel	X	X
36244	Solution structure of the Rho GTPase binding domain (RBD) of ELMO1	X	X
36263	Structure of anti-prion RNA aptamer	X			X
36264	Solution structure of the intermembrane space domain of the mitochondrial import protein Tim21 from S. cerevisiae	X	X
36273	NMR solution structure of Roseltide rT7	X	X
36284	Structure of the beta2 adrenergic receptor in the full agonist bound state	X	X
36288	Solution structure of Gaussia Liciferase by NMR	X	X
36293	membrane-bound PD-L1-CD	X	X
36294	membrane-bound Bax helix2-helix5 domain	X	X
36309	Solution structure of Taf14ET-Sth1EBMC	X	X
36327	Solution NMR structure of NF1; de novo designed protein with a novel fold	X	X
36328	Solution NMR structure of NF2; de novo designed protein with a novel fold	X	X
36329	Solution NMR structure of NF7; de novo designed protein with a novel fold	X	X
36330	Solution NMR structure of NF5; de novo designed protein with a novel fold	X	X
36331	Solution NMR structure of NF6; de novo designed protein with a novel fold	X	X
36332	Solution NMR structure of NF4; de novo designed protein with a novel fold	X	X
36333	Solution NMR structure of NF8 (knot fold); de novo designed protein with a novel fold	X	X
36334	Solution NMR structure of NF3; de novo designed protein with a novel fold	X	X
36335	Solution NMR structure of fold-0 Chantal; de novo designed protein with an asymmetric all-alpha topology	X	X
36336	Solution NMR structure of fold-C Rei; de novo designed protein with an asymmetric all-alpha topology	X	X
36337	Solution NMR structure of fold-Z Gogy; de novo designed protein with an asymmetric all-alpha topology	X	X
36338	Solution NMR structure of fold-K Mussoc; de novo designed protein with an asymmetric all-alpha topology	X	X
36339	Solution NMR structure of fold-U Nomur; de novo designed protein with an asymmetric all-alpha topology	X	X
36341	N-terminal domain (NTD) Solution structure of aciniform spidroin (AcSpN) from Nephila antipodiana.	X	X
36342	The NMR structure of the BEN domain from human NAC1	X	X
36345	Solution structure of recombinant APETx1	X	X
36368	Solution structure of the C-terminal domain of Mycobacterium Tuberculosis ribosome maturation factor protein RimM	X	X
36378	NMR solution structures of the DNA minidumbbell formed by 5'-mCTTGXmCTTG-3'	X		X
36379	NMR solution structures of the DNA minidumbbell formed by two CmCTG repeats at pH 5	X		X
36380	NMR solution structures of the DNA minidumbbell formed by two CCTG repeats at pH 5	X		X
36385	Solution structure of Gaussia Liciferase by NMR	X	X
36405	Solution structure of RPB6, common subunit of RNA polymerases I, II, and III	X	X
36411	Aptamer enhancing peroxidase activity of myoglobin	X		X
36422	T-hairpin structure found in the RNA element involved in the piRNA biogenesis	X			X
36445	Solution structure of the chimeric peptide of the first SURP domain of Human SF3A1 and the interacting region of SF1.	X	X
36447	NMR structure of the zeta-subunit of the F1F0-ATPase from Sinorhizobium meliloti	X	X
36471	solution structure of an anti-CRISPR protein	X	X
50000	PPARg LBD bound to the inverse agonist T0070907 and NCoR corepressor peptide	X	X
50004	Backbone 1H, 13C, and 15N Chemical Shift Assignments for human Leptin	X	X
50007	Backbone 1H, 13C, and 15N Chemical Shift Assignments for proIAPP in DPC Micelles	X	X
50009	Backbone and methyl assignment of bacteriorhodopsin incorporated into nanodiscs	X	X
50012	Assignment of 15N labelled IMP13 metallo beta-lactamase (apo-state)	X	X
50013	Assignment of 15N-labelled IMP13 metallo beta-lactamase bound to hydrolysed ertapenem	X	X
50014	ctSpp2(208-254) backbone assignment	X	X
50015	Assignment of Titin domain I83	X	X
50018	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP017	X			X
50019	CproIAPP in DPC at pH 4.5	X	X
50020	Structural and biophysical characterization of the type VII collagen vWFA2 subdomain leads to identification of two binding sites and helps understanding the consequences of autoimmunity against type VII collagen	X	X
50027	The unusual structure of Ruminococcin C1 antimicrobial peptide confers activity against clinical pathogens	X	X
50028	HIV-1 gp41 Membrane Proximal External Region-Transmembrane Domain (MPER-TMD) Peptide in LMPG micelle	X	X
50029	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP015	X			X
50036	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP016	X			X
50037	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP018	X			X
50038	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP019	X			X
50039	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP020	X			X
50040	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP021	X			X
50041	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP022	X			X
50042	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP023GC	X			X
50043	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP023GU3	X			X
50044	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP024	X			X
50045	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP025	X			X
50046	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP026	X			X
50047	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP027	X			X
50048	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP028	X			X
50049	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest01	X			X
50050	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest02	X			X
50051	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest03	X			X
50052	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest04	X			X
50053	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest05	X			X
50054	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest06	X			X
50055	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest07	X			X
50056	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest08	X			X
50057	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest09	X			X
50058	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest10	X			X
50059	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest11	X			X
50060	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest12	X			X
50061	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest13	X			X
50062	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest14	X			X
50063	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest15	X			X
50064	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest16	X			X
50065	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest17	X			X
50066	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest18	X			X
50067	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA Rest19	X			X
50068	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA HP-GU	X			X
50069	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA PL01	X			X
50070	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA PL02	X			X
50071	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA PL03	X			X
50072	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA PL04	X			X
50073	1H, 13C, and 15N Chemical Shift Assignments for hairpin RNA UU1	X			X
50088	Structure and function of the bacterial toxin phenomycin	X	X
50095	1H, 15N chemical shift assignments of the imino groups of yeast tRNAPhe: influence of the post-transcriptional modifications	X			X
50096	1H, 15N chemical shift assignments of the imino groups of yeast tRNAPhe: influence of the post-transcriptional modifications	X			X
50097	1H, 15N chemical shift assignments of the imino groups of yeast tRNAPhe: influence of the post-transcriptional modifications	X			X
50104	Backbone 1H, 13C, and 15N Chemical Shift Assignments of human Grb2 N-terminal SH3 domain in complex with Sos1-derived peptide	X	X
50106	Backbone 1H, 13C, and 15N Chemical Shift Assignments of human Grb2 N-terminal SH3 domain conjugated with Sos1-derived modified peptide	X	X
50110	Sequential solid-state NMR assignment of Snu13p in Snu13p:Rsa1p:Hit1p complex	X	X
50113	Influenza A virus M2 cytoplasmic tail at pH 7.2	X	X
50115	Backbone 13C, and 15N Chemical Shift Assignments for ChiZ N-terminal Domain	X	X
50119	Intramolecular synergy enhances the microtubule end-binding affinity of EB1	X	X
50120	Intramolecular synergy enhances the microtubule end-binding affinity of EB1	X	X
50124	Complete sequential assignment of the protein K1-CanA from Pyrodictium abyssi	X	X
50125	VDAC E73V assignment in DHPC7 micelles	X	X
50127	Influenza A virus M2 cytoplasmic tail at pH 5.5	X	X
50131	Backbone 1H and 15N chemical shift assignments of KL Sup35NM	X	X
50132	Backbone 1H and 15N chemical shift assignments of chimeric SC Sup35NM, 5MT-A	X	X
50133	Backbone 1H and 15N chemical shift assignments of chimeric SC Sup35NM, 5MT-B	X	X
50134	Backbone 1H and 15N chemical shift assignments of chimeric SC Sup35NM, 4MT-A	X	X
50139	Backbone 1H,13C, and 15N Chemical Shift Assignments for the S. typhimurium tryptophan synthase alpha subunit	X	X
50151	Partial backbone resonance assignments for Human DND1-RRM2	X	X
50156	Backbone assignment of DUSP22	X	X
50161	Backbone 1H, 13C, and 15N Chemical Shift Assignments for hyen D	X	X
50162	hyen L	X	X
50163	hyen E	X	X
50164	hyen M	X	X
50165	hyen C	X	X
50166	P2MIN	X	X
50172	Rab1b bound to GTP	X	X
50173	Rab1b bound to GDP	X	X
50174	Rab1b bound to GTP (AMPylation at Y77)	X	X
50175	Rab1b bound to GDP (AMPylation at Y77)	X	X
50176	Rab1b bound to GTP (Phosphocholination at S76)	X	X
50177	Rab1b bound to GDP (Phosphocholination at S76)	X	X
50178	Cdc42 bound to GTP	X	X
50179	Cdc42 bound to GDP	X	X
50180	Cdc42 bound to GTP (AMPylation at T35)	X	X
50181	Cdc42 bound to GDP (AMPylation at T35)	X	X
50182	Cdc42 bound to GTP (AMPylation at Y32)	X	X
50183	Cdc42 bound to GDP (AMPylation at Y32)	X	X
50195	Skp_A108L_monomer	X	X
50198	1H, 15N Resonance Assignments of VAMP2(1-96) in SH-SY5Y Cells	X	X
50199	1H, 15N Resonance Assignments of VAMP2(1-96) in HEK-293T Cells	X	X
50212	Backbone 1H, 13C and 15N resonance assignments of 116 kDa Mycobacterium tuberculosis inorganic pyrophosphatase hexamer	X	X
50218	UvrD_CTD	X	X
50219	Mfd_RID	X	X
50233	Model-free analysis of 15N spin-relaxation data for TRBP2-dsRBD1	X	X
50234	15N-spin relaxation data for TRBP2-dsRBD1 dynamics in presence of D10-RNA	X	X		X
50239	Molecular Basis for the Adaptive Evolution of Environment Sensing by H-NS Proteins	X	X
50240	Molecular Basis for the Adaptive Evolution of Environment Sensing by H-NS Proteins	X	X
50251	Heme-bound REV-ERBb ligand binding domain (LBD)	X	X
50256	hCPEB3	X	X
50259	1H, 13C and 15N Resonance Assignments of the Transactivation domain of the Human Forkhead Transcription Factor FOXO4	X	X
50270	Cre Recombinase Catalytic Domain	X	X
50274	Orb2A Prion Like Domain	X	X
50277	Backbone assignments of Ca 2+ /calmodulin-dependent protein kinase 1D	X	X
50278	Canonical and modified dsDNA 12mers	X		X
50297	ScCM:Apo state, ScCM:YY state, and ScCM:WW state methyl axis order paramaters for Ile and Thr residues.	X	X
50300	Sequence-specific resonance assignments of the Chlamydomonas reinhardtii SAS-6 N-terminal domain, F145E variant	X	X
50302	Human beta-2 microglobulin D76N variant	X	X
50308	Sequence-specific resonance assignments of the human SAS-6 F131D head domain	X	X
50312	13C and 15N Chemical Shift Assignments for human A117V variant Y145Stop Prion Protein Amyloid Fibrils	X	X
50313	13C and 15N Chemical Shift Assignments for human M129V variant Y145Stop Prion Protein Amyloid Fibrils	X	X
50315	ABD	X	X
50316	ABD12	X	X
50317	ABD23	X	X
50318	ABD1	X	X
50319	ABD2	X	X
50320	ABD3	X	X
50321	ABD2'	X	X
50322	ABD23ss	X	X
50323	ABD23ac	X	X
50324	Assigned backbone chemical shifts of DEPTOR-PDZ	X	X
50325	Backbone chemical shift assignment of the FRB domain of mTOR	X	X
50326	Backbone chemical shift assignment of the linker region of DEPTOR	X	X
50329	NPAT	X	X
50331	CXCL8-CXCR1 N-domain solution NMR structure	X	X
50332	Backbone relaxation rates for apo form of the solute binding protein PiuA	X	X
50333	Backbone relaxation rates for the solute binding protein PiuA bound to Ga(III) 4-LICAM	X	X
50335	FLASH_1923	X	X
50336	yarp	X	X
50339	Assignment of base 15N and 1H chemical shifts for <5_SL5B+C>	X			X
50340	Assignment of base 15N and 1H chemical shifts for 5_SL5stem	X			X
50341	Assignment of base 15N and 1H chemical shifts for <3_s2m>	X			X
50342	Assignment of base 1H and 15N chemical shifts for 3_SL1	X			X
50343	Assignment of base 1H and 15N chemical shifts for 3_SL2	X			X
50344	Assignment of base 1H and 15N chemical shifts for 5_SL2+3	X			X
50346	Assignment of base 15N and 1H chemical shifts for 5_SL5a	X			X
50347	Assignment of anomeric protons and base 1H, 13C and 15N chemical shifts for 5_SL4	X			X
50348	Assignment of base imino 1H and 15N chemical shifts for PK	X			X
50349	Assignment of base 15N and 1H chemical shifts for <5_SL1>	X			X
50350	Assignment of base 15N and 1H chemical shifts for 3_SL3base	X			X
50351	Assignment of base 15N, 13C and 1H chemical shifts for 5_SL6	X			X
50352	Assignment of base 15N and 1H chemical shifts for 5_SL8	X			X
50353	1H, 13C, 15N chemical shift assignment of NTD MaSp2 from Nephila clavipes	X	X
50366	hCEACAM1 N-terminal IgV domain N97A mutant	X	X
50368	hCEACAM1 N-terminal IgV domain	X	X
50372	1H and 13C chemical shifts for a peptide encompassing residues 391-409 of CB1 receptor in DPC micelles	X	X
50373	1H and 13C chemical shifts for a peptide encompassing residues 391-409 of CB1 receptor in 30% TFE	X	X
50374	1H and 13C chemical shifts for a peptide encompassing residues 391-409 of CB1 receptor in aqueous solution	X	X
50375	1H and 13C chemical shifts for a peptide encompassing residues 63-76 of beta-arrestin1 in DPC micelles	X	X
50376	1H and 13C chemical shifts for a peptide encompassing residues 63-76 of beta-arrestin 1 in 30% TFE	X	X
50377	1H and 13C chemical shifts for a peptide encompassing residues 63-76 of beta-arrestin 1 in aqueous solution	X	X
50378	M2, M2-L1, M2-L3, M2-L1L3 G-quadruplexes + Trisubstituted Naphtalene Diimide NDI-5	X		X
50379	N SARS-CoV-2 SR-rich motif (182-197)	X	X
50382	1H and 13C chemical shifts for a mixture of a CB1-derived peptide and a beta-arrestin1-derived peptide in aqueous solution	X	X
50383	1H and 13C chemical shifts for a mixture of a CB1-derived peptide and a beta-arrestin1-derived peptide in 30% TFE	X	X
50384	1H and 13C chemical shifts for a mixture of a CB1-derived peptide and a beta-arrestin1-derived peptide in DPC micelles	X	X
50387	1H, 13C, and 15N backbone chemical shift assignments of the macrodomain of SARS-CoV-2 non-structural protein 3b	X	X
50388	1H, 13C, and 15N backbone chemical shift assignments of the macrodomain of SARS-CoV-2 non-structural protein 3b bound to ADPr	X	X
50389	Backbone Assignments of the Rec3 domain of CRISPR-Cas9 for S. pyogenes	X	X
50391	DedD	X	X
50392	1H, 13C, and 15N backbone chemical shift assignments of coronavirus-2 non-structural protein Nsp10	X	X
50405	WT1(-KTS) backbone and side chain 13C, 15N and 1H assignments	X	X
50407	V98A EcRNHI* (Cys-free) 15N-1H Backbone Chemical Shifts	X	X
50408	V98A EcRNHI 15N-1H Backbone Chemical Shifts	X	X
50409	SoRNHI 15N-1H Backbone Chemical Shifts	X	X
50410	NMR signal assignments and backbone dynamics of the apo-C-terminal domain of orange carotenoid protein from cyanobacteria	X	X
50415	Chemical shift assignment of cyclorasin 9A5 in water	X				X
50416	Chemical shift assignment of cyclorasin 9A5 in DMSO	X				X
50417	Chemical shift assignment of cyclorasin 9A54 in water	X				X
50418	Chemical shift assignment of cyclorasin 9A54 in DMSO	X				X
50425	Influenza A matrix protein 1	X	X
50430	Monomeric ETV6 PNT domain with a V112E mutation	X	X
50431	ETV6 PNT Domain with an V112E PNT domain complexed to an unlabelled A93D PNT domain	X	X
50432	ETV6 PNT Domain with an A93D PNT domain complexed to an unlabelled V112E PNT domain	X	X
50433	Monomeric ETV6 PNT domain with an A93D mutation	X	X
50434	Backbone assignments of AEG12	X	X
50445	Backbone resonance assignment of dopamine N-acetyltransferase (Dat)	X	X
50446	1H, 13C and 15N Backbone Chemical Shift Assignments of SARS-CoV-2 Nsp3a	X	X
50448	1H-13C-15N Sars Unique Domain CoV-2 (nsp3c) N-terminal domain	X	X
50449	Backbone Chemical Shift Assignments, Chemical shift perturbation and PRE data for XcpH soluble domain from P. aeruginosa	X	X
50450	1H, 13C and 15N backbone resonance assignments for isolated PDZ1 domain of the DegP serine protease from E. coli	X	X
50451	DegP-PDZ2	X	X
50452	DegP-PDZ1PDZ2-25C	X	X
50453	DegP-PDZ1PDZ2-50C	X	X
50463	L-Phenylseptin	X	X
50465	1H, 13C and 15N chemical shift assignments of the human Death-associated protein 1 (DAP-1)	X	X
50469	A28	X	X
50470	Backbone 1H, 13C, and 15N Chemical Shift Assignment for Human Atg3 without N-terminal 25 resides	X	X
50472	Methyl assignments of Hsp90 FL AIM LV pro-R labeled	X	X
50477	Backbone 1H, 13C, and 15N Chemical Shift Assignments of co-activator nuclear receptor interacting domain TIF2 NRID	X	X
50479	1H, 15N, and 13C resonance assignments for human Atg3 with deletion of residues 90-190	X	X
50480	1H, 13C, and 15N resonance assignment for human Atg3 with deletion of 90 to 190 residues in bicelles	X	X
50481	1H, 13C, and 15N backbone resonance assignments of human Atg3 P21A with deletion of 90 to 190 residues in ficelle	X	X
50482	RelAdd_homodimer T1, T2 and NOE	X	X
50486	1H and 13C chemical shifts for hECP30 in aqueous solution	X	X
50487	1H and 13C chemical shifts for Orn analogue of hECP30 in aqueous solution	X	X
50488	1H and 13C chemical shifts for [DOrn1,DPro2] analogue of hECP30 in aqueous solution	X	X
50489	1H and 13C chemical shifts for [DPro2]-Orn analogue of hECP30 in aqueous solution	X	X
50490	1H and 13C chemical shifts for hECP30 in DPC micelles	X	X
50491	1H and 13C chemical shifts for Orn analogue of hECP30 in DPC micelles	X	X
50492	1H and 13C chemical shifts for [DOrn1,DPro2] analogue of hECP30 in DPC micelles	X	X
50493	1H and 13C chemical shifts for [DPro2]-Orn analogue of hECP30 in DPC micelles	X	X
50494	RelA-p50 heterodimer	X	X
50495	RelAdd_mutant	X	X
50509	Backbone and sidechain assignments of RRM1 domain of human RBM6	X	X
50513	Backbone chemical shift assignments for the Betacoronavirus SARS-CoV-2 non-structural protein Nsp9	X	X
50515	NMR assignments of the Fc fragment of mouse immunoglobulin G2b glycoprotein non-galactosylated (G0) glycoform	X	X			X
50516	Nsp3c SUD-M	X	X
50517	Nsp3c SUD-C	X	X
50519	hTS diligand backbone assignments	X	X
50520	hTS apo backbone and ILVM methyl assignments	X	X
50521	hTS dUMP backbone and ILVM methyl assignments	X	X
50522	NMR assignment of Fc fragment of mouse immunoglobulin G2b glycoprotein galactosylated (G2) glycoform	X	X			X
50525	transmembrane domain of PD-L1	X	X
50527	Backbone chemical shift assignments for the C-terminal domain of wild type human prion protein (residues 125-230) at 16deg C, pH 7.	X	X
50528	Backbone chemical shift assignments for the C-terminal domain of T183A human prion protein (residues 125-230) at 16deg C, pH 7.	X	X
50537	Backbone Assignments for the Human Interleukin-17A Homodimer	X	X
50538	Backbone Assignments for the Human Interleukin-17F Homodimer	X	X
50539	Mechanistic basis for ubiquitin modulation of a protein energy landscape	X	X
50540	Backbone Assignments for the Human Interleukin-17AF Heterodimer	X	X
50542	Alpha-endosulfine (ENSA)	X	X
50545	1H, 13C and 15N NMR chemical shift assignment of A. thaliana RCD1 RST 487-589	X	X
50548	1H, 13C, and 15N NMR chemical shift assignment of the complex formed by the first EPEC EspF repeat and N-WASP GTPase binding domain	X	X
50549	Chemical shift assignment of End Binding Protein 1	X	X
50553	15N relaxation measurements of an FG Nucleoporin in crowded conditions	X	X
50555	Backbone assignment of B-domain of bacterial Fatty acid kinase bound to palmitic acid	X	X
50556	A121I-FakB1 bound to palmitic acid	X	X
50557	SARS-CoV-2 nucleoprotein 175-263	X	X
50567	Structure of PCSK9 antagonist P9-38	X	X
50569	1H and 15N assignments for 14-residue peptide after cleavage by MPro	X	X
50574	1H, 15N and 13C sequence-specific backbone assignment of the MAP Kinase Binding Domain of Dual Specificity Phosphatase 1	X	X
50592	Slow disulfide bridge formation in the folded CH2 domain	X	X
50594	NMR resonance assignments for a docking domain pair with an attached thiolation domain from the PAX peptide-producing NRPS from Xenorhabdus cabanillasii	X	X
50598	peptide containing C-terminal Asp for random coil chemical shifts at pH 2.3 and 7.4 under denaturing conditions	X	X
50599	reference peptide including N-terminal Pro at pH values of 2.3 and 7.4 under denaturing conditions	X	X
50600	reference peptide containing Asp-Pro at the pH values of 2.3 and 7.4 under denaturing conditions	X	X
50601	Reference peptide containing iso-aspartate at the pH values of 2.3 and 7.4 under denaturing conditions	X	X
50606	NMR chemical shifts of Ly29-43C-C peptide	X	X
50607	Ly29-43 C,C	X	X
50608	Chemical shifts of nAchR loop C fragment mLs202-114C,C	X	X
50609	chemical shifts of the nAchR loop C fragment 202-214 stabilized by disulfides	X	X
50625	A (3+1) hybrid G-quadruplex containing right loop progression	X		X
50629	Hinge region of the Trypanosoma brucei PKA regulatory subunit (TbPKAr)	X	X
50630	Hinge region of the Trypanosoma brucei PKA regulatory subunit	X	X
50631	Hinge region of the Trypanosoma brucei PKA regulatory subunit	X	X
50632	Hinge region of the Trypanosoma brucei PKA regulatory subunit	X	X
50639	Chemical shift assignment of cyclorasin 12A in DMSO	X				X
50640	1H, 13C, 15N Chemical Shift Assignments for the A45E mutant of Myristoylated HIV-1 Matrix	X	X
50641	1H, 13C, 15N Chemical Shift Assignments for the Q63R mutant of Myristoylated HIV-1 Matrix	X	X
50642	1H, 13C, 15N Chemical Shift Assignments for the L75G mutant of Myristoylated HIV-1 Matrix	X	X
50643	1H, 13C, 15N Chemical Shift Assignments for the T70R mutant of Myristoylated HIV-1 Matrix	X	X
50644	Chemical shift assignment of cyclorasin 9A12 in DMSO	X				X
50645	Chemical shift assignment of cyclorasin 9A44d in DMSO	X				X
50646	Chemical shift assignment of cyclorasin 12A in water	X				X
50647	Chemical shift assignment of cyclorasin 9A12 in water	X				X
50648	Chemical shift assignment of cyclorasin 9A44d in water	X				X
50649	1H, 13C, and 15N backbone chemical shift assignments of yeast sulfhydryl oxidase Erv1	X	X
50650	human Angiogenin pH 6.3 35oC	X	X
50651	NMR assignment of T35S mutant of K-Ras4b(1-169) bound to GppNHp	X	X
50652	NMR assignment of T35S/Q61L mutant of human K-Ras4b(1-169) bound to GppNHp	X	X
50653	5_SL1	X			X
50654	5_SL2+3	X			X
50657	5_SL4	X			X
50658	5_SL5b+c	X			X
50659	5_SL5stem	X			X
50660	5_SL6	X			X
50661	5_SL8	X			X
50662	PK	X			X
50663	3_SL1	X			X
50664	3_SL3base	X			X
50665	3_s2m	X			X
50666	5_SL7	X			X
50667	att HP	X			X
50668	5_SL5a	X			X
50669	3_SL2	X			X
50670	5_SL1234	X			X
50671	5_SL5	X			X
50672	3_SL1+2	X			X
50673	5_UTR	X			X
50674	3_UTR	X			X
50681	1H, 13C, 15N reduced mitoNEET assignment	X	X
50682	1H, 13C, 15N oxidized mitoNEET assignment	X	X
50683	Resonance assignment of human STIM1 CC3 fragment	X	X
50686	Backbone chemical shift assignment, R1 and R2 relaxation rates of R272E/K273E mutant of deubiquitinase A	X	X
50687	SARS CoV-2 Non structural protein 2 C-terminal instrinsically disordered region (Nsp2 CtIDR)	X	X
50689	Chemical shift assignments of the Campylobacter jejuni helical cell shape determining protein Pgp2 in its apo form	X	X
50696	CD11b I-domain	X	X
50709	RGG Mini	X	X
50710	RGG FUS	X	X
50711	1H, 13C, and 15N chemical shift assignments of the N-terminal fragment of PaaR2 regulator encoded on the cryptic prophage CP933-P in Escherichia coli O157:H7	X	X
50712	1H, 13C and 15N backbone resonance assignment of HIV-1 Gag(276-432) encompassing the C-terminal domain of the capsid protein, the spacer peptide 1 and the nucleocapsid protein	X	X
50725	backbone assignments of SARS-CoV-2 Nsp9	X	X
50730	Backbone and heme resonance assignment of PpcAF6L mutant from G.metallireducens	X	X
50731	Backbone and heme resonance assignment of PpcAW45M mutant from G.metallireducens	X	X
50732	Backbone and heme resonance assignment of PpcAF6LW45M mutant from G.metallireducens	X	X
50737	Smad4 interdomain linker	X	X
50738	Smad2 interdomain linker	X	X
50739	Backbone 1H, 13C, and 15N Chemical Shift assignments for the +7K+12D mutant of hnRNPA1-LCD	X	X
50747	1H, 13C, 15N backbone NMR resonance assignments of Psb28 in complex with the C-terminal peptide of CP47	X	X
50749	Ligand-induced structural transition combined with paramagnetic ions facilitate unambiguous NMR assignments of methyl groups in crowded spectra	X	X
50751	Resonance assignment of Decorin binding protein A from European species Borrelia afzelii	X	X
50752	Backbone chemical shift assignments of PSD-95 N-terminal domain	X	X
50754	Backbone and side-chain resonance assignments of the A2 domain of mouse von Willebrand factor	X	X
50766	Backbone resonance assignments of LINE-1 retrotransposable element ORF1 protein N-terminal region.	X	X
50771	The 1H, 15N, and 13C resonance assignments of the N-terminal domain of the nucleocapsid protein from the Middle East Respiratory Syndrome Coronavirus	X	X
50772	The 1H, 15N, and 13C resonance assignments of the N-terminal domain of the nucleocapsid protein from the Middle East Respiratory Syndrome Coronavirus	X	X
50773	Backbone 1H, 15N assignment of 15N-labeled oncogenic mutant human KRas4B-G12V(1-169) bound to GTP at physiological pH	X	X
50774	Full assignment of 13C,15N-labeled Mg2+-free oncogenic mutant human KRas4B-G12C(1-169) bound to GDP in open conformation at physiological pH	X	X
50781	Backbone 1H, 13C, and 15N chemical shift assignments for ClpX residues 1-55	X	X
50783	NMR chemical shift assignments of a module of unknown function in cellulosomal secondary scaffoldin ScaF from Clostridium thermocellum	X	X
50784	MqsA residues 1-76	X	X
50787	Backbone chemical shift assignments of saccharomyces cerevisiae Ess1 Prolyl-isomerase C120S	X	X
50789	1H, 13C and 15N chemical shift assignments of the C-terminal domain of human UDP-Glucuronosyltransferase 2B7 (UGT2B7)	X	X
50793	ular mechanisms underlying the role of the centriolar CEP164-TTBK2 complex in ciliopathies	X	X
50794	NMR assignment of the Feline Immunodeficiency Virus p24 capsid	X	X
50798	GHR-TMD in DHPC micelles	X	X
50799	Backbone chemical shift assignment of the alpha-crystallin domain of the Small heat shock protein, IbpB from E. coli	X	X
50801	Backbone 1H, 13C, and 15N Chemical Shift Assignment for Brd3-BD1	X	X
50802	Backbone 1H, 13C, and 15N Chemical Shift Assignment for Brd3-BD1 bound to inhibitor PCC	X	X
50803	Chemical shift assignment of NDRG1-C, the C-terminal domain of NDRG1	X	X
50808	Backbone and sidechain 1H, 13C, and 15N Chemical Shift assignments for nanobody Nb23	X	X
50809	SARS-Cov-2 spike receptor binding domain	X	X
50811	NMR resonance assignment of the green kiwi fruit allergen Act d 8.0101	X	X
50812	NMR resonance assignment of the golden kiwi fruit allergen Act c 8.0101	X	X
50813	Interactions of SARS-CoV-2 envelope protein with amilorides correlate with antiviral activity	X	X
50814	1H, 13C and 15N Backbone Chemical Shift Assignments of the SH3 domain of the JNK-interacting protein 1	X	X
50815	1H, 13C and 15N Backbone Chemical Shift Assignments of the A541L SH3 variant of the JNK-interacting protein 1	X	X
50816	1H, 13C and 15N Backbone Chemical Shift Assignments of the V517A SH3 variant of the JNK-interacting protein 1	X	X
50817	1H, 13C and 15N Backbone Chemical Shift Assignments of the Y526A SH3 variant of the JNK-interacting protein 1	X	X
50818	1H, 13C and 15N Backbone Chemical Shift Assignments of the H493A SH3 variant of the JNK-interacting protein 1	X	X
50819	N-terminal domain of p50 subunit of NF-kappaB	X	X
50830	N-terminal module of SMARCC1/BAF155	X	X
50852	Sequential backbone assignment of mature a-Synuclein fibrils prepared from a-helical intermediate species	X	X
50853	Heme chemical shifts assignment of the PpcBF6L from Geobacter sulfurreducens	X	X
50855	Heme chemical shifts assignment of the PpcEF6L from Geobacter sulfurreducens	X	X
50865	Complex of the CBP TAZ1 domain and a CITED2-HIF-1alpha fusion peptide	X	X
50866	CITED2-HIF-1alpha fusion peptide	X	X
50867	Complex of the CBP TAZ1 domain and a CITED2-HIF-1alpha fusion peptide (L63A)	X	X
50868	SOCS2-SH2_GHRpY	X	X
50869	SOCS2-SH2_GHRpY_F3	X	X
50870	NUDT9 - ADPR complex	X	X
50886	Exenatide peptide	X	X
50887	Backbone Assignments of HNH Nuclease from G. stearothermophilus Cas9	X	X
50888	1H 15N 13C chemical shift assignment of the construct of human ataxin-3 including residues 182-291	X	X
50891	NMR backbone chemical shift assignments of the mitochondrial membrane protein MPV17 labeled with MMTS in DPC micelles	X	X
50897	hDVL2 DEP (401-510)	X	X
50898	hDVL2 DEP domain (401-510) S418E mutant	X	X
50903	TCPTP residues 1-302	X	X
50904	TCPTP residues 303-387	X	X
50905	TCPTP residues 303-387 RK variant	X	X
50907	Rules for designing protein fold switches and their implications for the folding code	X	X
50909	Rules for designing protein fold switches and their implications for the folding code	X	X
50910	Rules for designing protein fold switches and their implications for the folding code	X	X
50912	Structure of the transmembrane domain of the CD28 dimer	X	X
50919	Assignment of MIL(ProS)V(ProS)A methyl group-labelled MNV P-domain	X	X
50920	1H, 13C, and 15N Chemical Shift Assignments of cAMP-Binding Domains A and B of the PKA Regulatory Subunit	X	X
50942	NMR backbone resonance assignment of the pro-apoptotic Bak in its apo state	X	X
50944	Backbone and nearly complete side-chain chemical shift assignments of the human Uncharacterized protein CXorf51A	X	X
50945	Metallo-b-lactamase inhibitor phosphonamidate monoesters	X	X
50946	Structure of Alpha-1-acid Glycoprotein bound to UCN-01 and complete backbone assignments and NMR	X	X
50955	Backbone Chemical Shift Assignments of human glutathione peroxidase 4 (GPx4)	X	X
50956	Side chain 1H, 13C, 15N chemical shift assignments of lysine residues in delta+PHS/V66K staphylococcal nuclease selectively labeled with SAIL Lysine	X	X
50957	1H, 15 N, and 13 C resonance assignments of the SH3-like tandem domain of human KIN17 protein	X	X
50959	Resonance assignment of Mg-bound CorA in DMPC	X	X
50960	The N-terminal region of human p53 (residues 1-312)	X	X
50961	1H, 15N and 13C chemical shift assignments of the PYK2(728-839) polypeptide	X	X
50964	yRad6	X	X
50968	KR-12	X	X
50969	SARS-CoV macro domain ADPr bound	X	X
50970	MERS-CoV macro domain free state	X	X
50971	MERS-CoV MD ADPr	X	X
50972	1H,13C, 15N chemical shift assignment of NTD MaSp1 from Triconephila clavipes	X	X
50978	TC-KKA	X	X
50979	Helix19-6	X	X
50980	AMTC31-6	X	X
50981	AMTC26-4	X	X
50982	AMTC27-6	X	X
50983	AMTC24-5	X	X
50985	1H, 13C and 15N Chemical Shift Assignments of the R957C mutant from Arkadia (RNF111) E3 RING domain in solution	X	X
50986	Proton NMR chemical shifts of GGCCTG2	X		X
50987	Proton NMR chemical shifts of GGCCTG3	X		X
50988	Proton NMR chemical shifts of GGCCTG3-T2	X		X
50989	Proton NMR chemical shifts of GGCCTG4	X		X
50993	SARS-CoV macro domain in the free state	X	X
51011	1H, 15N, 13C resonance assignment of the N-terminal domain (1-285) of yeast Atg9	X	X
51012	Backbone resonance assignments of KRAS Q61H mutant bound to GDP	X	X
51020	1H, 13C and 15N NMR assignments of an engineered Methyl CpG binding domain (MBD) protein	X	X
51021	NMR resonance assignments of the monomer of RNase P protein from Thermotoga maritima	X	X
51023	FLN5 A3A3	X	X
51024	S64V-EmrE, drug free, pH 5.0	X	X
51025	S64V-EmrE with harmane, pH 5.6	X	X
51026	S64V-EmrE with TPP, pH 5	X	X
51027	E14Q-EmrE drug free, low pH	X	X
51028	FLN5 A3A3E6	X	X
51035	loxP spacer 12-mer	X		X
51037	loxP spacer 22-mer	X		X
51039	1H, 13C, 15N Chemical Shift Assignments for ERD14 K-segment B	X	X
51040	Backbone 1H, 13C, and 15N Chemical Shift Assignments for ERD14 K-segment A	X	X
51041	Backbone 1H, 13C, and 15N Chemical Shift Assignments for ERD14 K segment C	X	X
51042	Backbone 1H, 13C, and 15N Chemical Shift Assignments for S100A4 C-terminal peptide	X	X
51047	lox4 spacer 16-mer	X		X
51048	Backbone chemical shift assignments for the post-fusion six-helix bundle (6HB) state of SARS-CoV-2 S2 protein	X	X
51051	S. cerevisiae SERF	X	X
51065	Assignment of S100A8/S100A9 in Human Calprotectin in the Absence of Ca(II) Ions	X	X
51066	Assignment of S100A8/S100A9 in Human Calprotectin in complex with Ca(II) Ions	X	X
51072	15N, 13C, and 1H resonance assignments of Jarastatin a disintegrin of Bothrops jararaca.	X	X
51073	The 1H, 15N, and 13C resonance assignments of the truncated Dengue Virus capsid protein with the deletion of the intrinsically disordered N-terminal region	X	X
51075	FLN5 filamin domain side-chain chemical shift assignments	X	X
51076	Methyl side-chain chemical shift assignments for ribosomal protein bL12	X	X
51079	Structural effects of m6A modification of the Xist A repeat AUCG tetraloop and its recognition by YTHDC1	X			X
51081	FOXO4 (aa 14-217)	X	X
51083	Backbone and Sidechain 1H, 13C, and 15N Chemical Shift Assignments for Domain 3 of Heligmosomoides polygyrus protein Transforming Growth Factor Beta Mimic 1 (TGM-1 D3)	X	X
51084	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Domain 3 of Heligmosomoides polygyrus protein Transforming Growth Factor Beta Mimic 1 (TGM-1 D3) as bound to Transforming Growth Factor Beta Receptor 2 (TbRII)	X	X
51085	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Transforming Growth Factor Beta Receptor 2 (TbRII) as bound to Domain 3 of Heligmosomoides polygyrus protein Transforming Growth Factor Beta Mimic 1 (TGM-1 D3)	X	X
51086	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Transforming Growth Factor Beta Receptor 1 (TbRI) as bound to Domain 2 of Heligmosomoides polygyrus protein Transforming Growth Factor Beta Mimic 1 (TGM-1 D2)	X	X
51090	Sequence-specific 1H, 15N, and 13C chemical shift assignment of the acidic domain of the human oncoprotein MDMX	X	X
51103	TIA-1 prion-like domain, relaxation data	X	X
51106	1H, 13C and 15N resonance assignments of the first BIR domain of cellular inhibitor of apoptosis protein 1	X	X
51107	1H,15N and 13C backbone chemical shift assignment of Spy29-124	X	X
51108	1H,15N and 13C backbone chemical shift assignment of Spy1-124	X	X
51109	1H,15N and 13C backbone chemical shift assignment of Spy29-124 in complex with Im7A3	X	X
51110	Backbone 1H, 15N Chemical Shift Assignments for RGL1-Ras-association domain	X	X
51117	Backbone resonance assignments and relaxation rates of the zinc finger domain of murine methionine amino peptidase 1	X	X
51118	Backbone resonance assignments of the zinc finger domain of murine methionine amino peptidase 1 in complex with ZNG peptide	X	X
51119	Backbone relaxation rates of the fusion of ZNG peptide with the zinc finger domain of murine methionine amino peptidase 1	X	X
51120	Single residue switches of aggregation in the N-terminal 'master controller' region of alpha-synuclein	X	X
51121	Single residue switches of aggregation in the N-terminal 'master controller' region of alpha-synuclein	X	X
51127	A functional SNP regulates E-cadherin expression by dynamically remodeling the 3D structure of a promoter-associated non-coding RNA transcript	X			X
51128	1H, 13C, and 15N resonance assignment of mouse lipocalin-type prostaglandin D synthase/PGJ2 complex.	X	X
51132	1H, 15N and 13C sequence-specific backbone assignment of RRP1B PP1 binding domain	X	X
51133	Backbone 1H, 13C and 15N Chemical Shift Assignments for Stress Granule Key Component G3BP1 RRM domain	X	X
51147	Backbone NMR assignments of the human TRPV4 intrinsically disordered N-terminus	X	X
51155	Unmodified siRNA	X				X
51156	Backbone NMR resonance assignments of the nucleotide binding domain of the Bacillus subtilis ABC multidrug transporter BmrA in the ADP-bound state	X	X
51159	Backbone chemical shift assignments of Horcolin	X	X
51162	N88R CtRNHI	X	X
51163	R88N EcRNHI	X	X
51164	Assignment of tRNAIle from Escherichia coli	X			X
51169	Solution NMR resonance assignment of PD-L1	X	X
51172	Backbone NMR assignments of the chicken TRPV4 intrinsically disordered N-terminus	X	X
51174	Molecular Dynamics-Assisted Optimization of Protein NMR Relaxation Analysis	X	X
51175	NMR assignments for the C-terminal domain of human RIPK3	X	X
51183	Reduced Human Amylin HNz-PEGylated	X	X
51186	Backbone chemical shifts of PreS domain from hepatitis B virus envelope protein	X	X
51192	Hydrogen exchange rates of human DHFR	X	X
51193	Backbone resonance assignments of transmembrane domain of SARS-CoV-2 spike protein	X	X
51194	Hydrogen exchange rates of human DHFR L80F	X	X
51195	Hydrogen exchange rates of human DHFR D153V	X	X
51204	Musashi-1 C terminal deltaSeq1	X	X
51205	Musashi-1 C terminal deltaSeq1	X	X
51206	Musashi-1 C terminal deltaSeq1	X	X
51207	Musashi-1 C terminal deltaSeq1	X	X
51208	Musashi-2 C terminal	X	X
51209	Backbone and sidechain 1H, 15N and 13C resonance assignments of the free tandem zinc finger domain of the tristetraprolin family member from Selaginella moellendorffii	X	X
51210	Backbone and sidechain 1H, 15N and 13C resonance assignments of the RNA bound tandem zinc finger domain of the tristetraprolin family member from Selaginella moellendorffii	X	X		X
51222	Calmodulin bound to the beta-subunit of the retinal cyclic nucleotide-gated cation channel	X	X
51223	1H15N HSQC chemical shifts and Relaxation Parameters for Y99C MIF Homotrimers	X	X
51224	1H15N HSQC chemical shifts and Relaxation Parameters for Y99C MIF Mixed Trimers	X	X
51226	Backbone and side-chain chemical shift assignment of mycobacterial antitoxin MazE6 from MazEF6 TA system.	X	X
51227	Backbone and side-chain chemical shift assignment of N-terminal domain (nMazE6) of mycobacterial antitoxin MazE6 from MazEF6 TA system	X	X
51230	CI2 backbone and methyl assignment	X	X
51231	1H, 13C, and 15N Chemical Shift Assignments for amyloidogenic PAP(85-120) peptide	X	X
51234	CI2 I57V backbone and methyl assignment	X	X
51235	CI2 L49I backbone and methyl assignment	X	X
51236	CI2 L49I/I57V backbone and methyl assignment	X	X
51237	Resonance assignments of a phsophomimetic of the C-terminal domain of the P protein of the Nishigahara strain of rabies virus	X	X
51255	Larp1	X	X
51257	Denatured State Backbone Assignments for UBA(1) from HHR23A in Guanidine Hydrochloride Solutions	X	X
51258	Backbone and sidechain assignments of Actophorin protein from Entamoeba histolytica	X	X
51260	Denatured State Backbone Assignments for Helix 1 from HHR23A Ubiquitin-Associated Domain 1 in Guanidine Hydrochloride Solutions	X	X
51262	histone H3 H4 N-tail in nucleosome	X	X
51264	solution structure of conotoxin vt1.27	X	X
51265	solution structure of conotoxin mr1.7	X	X
51268	Backbone chemical shift assignment of the SARS-CoV-2 receptor binding domain	X	X
51281	Salp15 NMR backbone assignment	X	X
51283	Backbone 1H, 13C, and 15N Chemical Shift Assignments for vRAGE(23-125)	X	X
51289	Calmodulin	X	X
51294	Backbone assignment of Hepatitis B virus core protein Cp149 dimer by solution NMR at pH 7.5	X	X
51301	Backbone and side chain resonance assignment of the intrinsically disordered human DBNDD1 protein	X	X
51314	human FUS 454-526	X	X
51315	human methylated FUS 454-526	X	X
51316	b2-adrenergic receptor C-terminal domain	X	X
51317	C-terminal domain of the Growth Hormone Secretagogue Receptor type 1a	X	X
51318	C-terminal domain of the Vasopressin V2 receptor	X	X
51324	NMR Parameters of the Reduced, Unfolded Short Isoform of Hypogastrura harveyi "snow flea" Antifreeze Protein	X	X
51333	Structural insights into the mechanism of p53 regulation by MDM2 acidic domain	X	X
51334	MDM2AD	X	X
51335	MDM2 AD in complex with p53 DBD	X	X
51337	5caC-containing dsDNA 12mers at three pH conditions	X		X
51338	Chemical shift assignment of Sa1_V90T at 5 degrees Celsius	X	X
51339	Chemical shift assignment of Sa1_V90T at 30 degrees Celsius	X	X
51340	Backbone and side chain solution NMR assignment of truncated form of small hepatitis D virus antigen Delta60-S-HDAg	X	X
51351	1H, 13C and 15N resonance assignments of TSR3 domain of human Thrombospondin-1	X	X
51353	Backbone NMR assignment of the human TRPV1 ion channel N-terminal intrinsically disordered region	X	X
51354	Backbone NMR assignment of the human TRPV2 ion channel N-terminal intrinsically disordered region	X	X
51355	Backbone and side-chain NMR assignment of the human TRPV3 ion channel N-terminal intrinsically disordered region	X	X
51356	1H, 13C and 15N resonance assignments of fucosylated TSR3 domain of human Thrombospondin-1	X	X
51358	1H, 13C and 15N resonance assignments of diglycosylated TSR3 domain of human Thrombospondin-1	X	X
51359	Backbone resonance assignments of the N-terminal domain of Sam68	X	X
51360	Backbone resonance assignments of the C-terminal domain of Sam68	X	X
51363	15N-1H chemical shifts for the unphosphorylated murine Syk tandem SH2 domains (Ser 8 to Gln 264)	X	X
51365	15N-1H chemical shifts for the unphosphorylated murine Syk tandem SH2 domains (Ser 8 to Gln 264) complexed with ITP peptide	X	X
51366	15N-1H chemical shifts for the unphosphorylated murine Syk tandem SH2 domains (Ser 8 to Gln 264) complexed with N-IHP peptide	X	X
51367	15N-1H chemical shifts for the unphosphorylated murine Syk tandem SH2 domains (Ser 8 to Gln 264) complexed with C-IHP peptide	X	X
51368	15N-1H chemical shifts for the murine Syk tandem SH2 domains phosphorylation mimic construct (tSH2-PM, Ser 8 to Gln 264 with Y130E)	X	X
51369	15N-1H chemical shifts for the murine Syk tandem SH2 domains phosphorylation mimic construct (tSH2-PM, Ser 8 to Gln 264 with Y130E) complexed with ITP peptide	X	X
51370	15N-1H chemical shifts for the murine Syk tandem SH2 domains phosphorylation mimic construct (tSH2-PM, Ser 8 to Gln 264 with Y130E) complexed with N-IHP peptide	X	X
51371	15N-1H chemical shifts for the murine Syk tandem SH2 domains phosphorylation mimic construct (tSH2-PM, Ser 8 to Gln 264 with Y130E) complexed with C-IHP peptide	X	X
51372	15N-1H chemical shifts for the murine Syk tandem SH2 domains flexible linker construct [tSH2-FX, Ser 8 to Gln 264 with interdomain residues 119-162 replaced by a 20-amino-acid flexible linker (GGS)3GS(GGS)3]	X	X
51373	15N-1H chemical shifts for the murine Syk tandem SH2 domains flexible linker construct [tSH2-FX, Ser 8 to Gln 264 with interdomain residues 119-162 replaced by a 20-amino-acid flexible linker (GGS)3GS(GGS)3] complexed with ITP peptide	X	X
51374	15N-1H chemical shifts for the murine Syk tandem SH2 domains flexible linker construct [tSH2-FX, Ser 8 to Gln 264 with interdomain residues 119-162 replaced by a 20-amino-acid flexible linker (GGS)3GS(GGS)3] complexed with N-IHP peptide	X	X
51375	15N-1H chemical shifts for the murine Syk tandem SH2 domains flexible linker construct [tSH2-FX, Ser 8 to Gln 264 with interdomain residues 119-162 replaced by a 20-amino-acid flexible linker (GGS)3GS(GGS)3] complexed with C-IHP peptide	X	X
51376	Backbone chemical shifts of Spd1	X	X
51388	1H and 13C chemical shifts for a peptide encompassing residues 2-19 of the human formin INF2 in 30% TFE	X	X
51389	1H and 13C chemical shifts for a peptide encompassing residues 2-19 of the human formin INF2 in aqueous solution	X	X
51398	PARP14 macro domain 2 free form	X	X
51399	PARP14 macro domain 2 ADPr bound	X	X
51400	1H, 13C, and 15N Chemical Shift Assignments for amyloidogenic SEM1(68-85) peptide	X	X
51403	Backbone chemical shifts of VN NS1 W182A effector domain	X	X
51404	Backbone chemical shifts of PR8 NS1 W187A effector domain	X	X
51405	NMR resonance assignments of the DNA binding domain of mouse Junctophilin-2	X	X
51406	1H, 13C, and 15N Chemical Shift Assignments for amyloidogenic SEM1(68-107) peptide	X	X
51407	1H and 13C chemical shifts for a peptide encompassing residues 2-36 of the human formin INF2 in aqueous solution	X	X
51408	1H and 13C chemical shifts for a peptide encompassing residues 2-36 of the human formin INF2 in 30% TFE	X	X
51410	Bicelle-bound conformation of HIV-1 gp41 ectodomain	X	X
51413	Bromodomain Interactions with Acetylated Histone 4 Peptides in the Tandem Domain BRD4 -- Effects on Domain Dynamics and Internal Flexibility	X	X
51414	Bromodomain Interactions with Acetylated Histone 4 Peptides in the Tandem Domain BRD4 -- Effects on Domain Dynamics and Internal Flexibility	X	X
51415	Bromodomain Interactions with Acetylated Histone 4 Peptides in the Tandem Domain BRD4 -- Effects on Domain Dynamics and Internal Flexibility	X	X
51416	Bromodomain Interactions with Acetylated Histone 4 Peptides in the Tandem Domain BRD4 -- Effects on Domain Dynamics and Internal Flexibility	X	X
51417	Bromodomain Interactions with Acetylated Histone 4 Peptides in the Tandem Domain BRD4 -- Effects on Domain Dynamics and Internal Flexibility	X	X
51418	Bromodomain Interactions with Acetylated Histone 4 Peptides in the Tandem Domain BRD4 -- Effects on Domain Dynamics and Internal Flexibility	X	X
51420	Backbone 1H, 13C, and 15N Chemical Shift Assignments for EZH2 loop at 310K and 278K	X	X
51421	Backbone 1H, 13C, and 15N Chemical Shift Assignments for T345D mutant of EZH2 loop	X	X
51422	1H, 13C and 15N backbone chemical shifts for human calmodulin in aqueous solution	X	X
51423	Backbone resonance assignments and relaxation rates for the apo form of the solute binding domain of the ergothioneine transporter EgtU	X	X
51424	Backbone resonance assignments and relaxation rates for the ergothioneine-bound form of the solute binding domain of the ergothioneine transporter EgtU	X	X
51427	B-Myb association with DNA is mediated by its negative regulatory domain and Cdk phosphorylation	X	X
51433	Variant 8 CTD	X	X
51434	ILV methyl chemical shift assignments for apo COQ8A-Ndel250	X	X
51435	ILV chemical shift assignments for COQ8A in the presence of 1 mM 2-propylphenol	X	X
51436	ILV methyl chemical shift assignments for COQ8A in the presence of 1 mM 2-propylphenol and 1 mM Triton X-100	X	X
51440	Identification and characterization of an RRM-containing, RNA binding protein in Acinetobacter Baumannii	X	X
51444	Isoleucine d1-methyl chemical shift assignments for FhaC in lipid nanodiscs	X	X
51447	Calmodulin bound to the C-terminal calmodulin-binding site of the beta-subunit of the retinal cyclic nucleotide-gated cation channel	X	X
51451	1H, 13C Chemical Shift Assignments for 13C Methionine Labeled ACKR3 in complex with CXCL12	X	X
51452	1H, 13C Chemical Shift Assignments for 13C Methionine Labeled ACKR3 in complex with VUN701	X	X
51453	1H, 13C Chemical Shift Assignments for 13C Methionine Labeled ACKR3 in complex with LIH383	X	X
51454	1H, 13C Chemical Shift Assignments for 13C Methionine Labeled ACKR3 in complex with CCX777	X	X
51455	Near complete backbone assignment of a C145A variant of the main protease from SARS-CoV-2	X	X
51456	Near complete backbone assignment of a C145A variant of the main protease from SARS-CoV-2 complexed with native N-terminal substrate SAVLQSGFRK	X	X
51470	apo macro domain of Hepatitis E virus	X	X
51471	ADPr bound macro domain of Hepatitis E virus	X	X
51472	Backbone amide chemical shifts for PBRM1-BD2	X	X
51478	Relaxation peaklist data of TcART	X	X
51479	Androgen Receptor AF1star	X	X
51481	Chemical Shift Assignments of CT-IC 216-260	X	X
51483	Solid-state NMR assignment of fibrils formed by tau(297-391)	X	X
51485	Chemical shift assignments of the C-terminal domain of AKAP5 (AKAP79), residues 300-427	X	X
51495	Backbone and side chain NMR assignment of the heme-nitric oxide/oxygen binding (H-NOX) domain from Nostoc punctiforme	X	X
51500	Miro2 N-terminal GTPase domain bound to GTP	X	X
51504	Assignment of 1-44 residues of nucleocapsid protein of SARS-CoV-2	X	X
51515	Partial assignment of SARS-COV-2 main protease R298A mutant	X	X
51516	1H, 13C, 15N NMR assignment of Engrailed2 homeodomain in anionic bicelles	X	X
51522	Region of Trak2 that interacts with Miro2 N-terminal GTPase	X	X
51526	Backbone chemical shifts of calcium-loaded human calmodulin at pH 7 and 37degC	X	X
51527	Calcium-loaded human calmodulin in complex with the antagonist calmidazolium	X	X
51528	1H and 13C chemical shifts of a peptide derived from the membrane proximal external region of HIV-1 gp41 in DPC micelles	X	X
51529	Relaxation parameters of calcium loaded human calmodulin at pH 7.0 and 37degC (600 MHz)	X	X
51530	Relaxation parameters of calcium loaded human calmodulin in complex with the antagonist calmidazolium at pH 7.0 and 37degC (600 MHz)	X	X
51531	1H and 13C chemical shifts of a peptide derived from the membrane proximal external region of HIV-1 gp41 in 25% HFIP	X	X
51533	Sequential NMR assignment of human protein DPCD	X	X
51536	1H and 13C chemical shifts for retroenantio crotalicidin in DPC micelles	X	X
51537	1H and 13C chemical shifts for retroenantio Ctn[15-34] in DPC micelles	X	X
51540	Proteolytic processing induces a conformational switch required for antibacterial toxin delivery	X	X
51547	Near complete 1H, 15N and 13C resonance assignments of the MBD double mutant	X	X
51548	Near complete 1H, 15N and 13C resonance assignments of the wild-type MBD from MeCP2	X	X
51598	SNAP25a (Rattus norvegicus)	X	X
51603	Backbone 1H, 15N, 13C chemical Shift Assignments for the wild-type human MDMX acidic domain, residues 170-260	X	X
51604	Backbone 1H, 15N, 13C chemical Shift Assignments for the mutant human MDMX acidic domain, residues 170-260 W200S/W201G	X	X
51605	Backbone 1H, 15N, 13C chemical Shift Assignments for the mutant human MDMX acidic domain, residues 170-260 W239S/W240S	X	X
51610	EcFTSZ_TEDOR_DNP	X	X
51611	1H, 13C and 15N Backbone Chemical Shift Assignments of NUT7	X	X
51612	Uracil-DNA glycosylase efficiency is modulated by substrate rigidity	X		X
51614	FUS ZnF Domain	X	X
51618	Bivalirudin in H2O	X	X
51619	RR14	X	X
51620	NMR assignment of NTD (44 - 180) of Nucleocapsid Protein of SARS-CoV-2	X	X
51625	Backbone 1H, 13C, and 15N chemical shift assignments for the N-terminal fragment of human YY1	X	X
51627	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the C-terminal Rec domain (apo state) of the hybrid Histidine Kinase CckA (CckARec) from Caulobacter crescentus.	X	X
51628	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the C-terminal Rec domain (BeF3- bound state) of the hybrid Histidine Kinase CckA (CckARec) from Caulobacter crescentus.	X	X
51631	1H,13C,15N Backbone and side-chain assignments of tandem RRM domains of Npl3	X	X
51632	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Alpha-synuclein linker region mutant "3AE" bound to SDS micelles	X	X
51633	Backbone 1H, 13C, and 15N Chemical Shift Assignments for Alpha-synuclein linker region mutant "4G" bound to SDS micelles	X	X
51637	1H-15N chemical shifts of PHDvC5HCH of NSD2 methyltransferase	X	X
51638	Backbone assignment of cJun TAD 1-151	X	X
51639	Solid State MAS NMR chemical shift assignment of KR2 in DMPC/DMPA proteoliposomes	X	X
51654	Backbone N and HN Chemical Shift Assignments for RBPMS-A (1-122)	X	X
51659	Backbone Chemical Shift Assignments of human glutathione peroxidase 4 (GPx4)	X	X
51703	Recombinant Expression and Chemical Amidation of Isotopically Labeled Native Melittin	X	X
51719	Design and characterization of a protein fold switching network	X	X
51728	Apo-state enNTS1DM4	X	X
51735	NT8-13 bound enNTS1DM4	X	X
51736	SR142948A bound enNTS1DM4	X	X
51737	13CH3-methionine assignments of ML314 bound enNTS1DM4	X	X
51738	NT8-13 & ML314 bound enNTS1DM4	X	X
51742	[D-Cys5,D-Lys16]-STp(5-17), native form	X	X
51743	[D-Cys5,Asp7,Val8,D-Lys16]-STp(5-17), native form	X	X
51779	Bacillus subtilis SepF protein assembly (wild type)	X	X
51786	Rec114:Mei4 minimal structured complex at pH 6.1	X	X
51787	Rec114:Mei4 minimal structured complex at pH 7.4	X	X
51815	Chemical shifts of HLA-B*0702 in complex with acute myeloid leukemia phosphoneoantigen pMLL747-755	X	X
51819	The RRM-mediated RNA binding activity in T. brucei RAP1 is essential for VSG monoallelic expression	X	X
51831	Backbone assignment of STIM1 CC3 double mutant (L416S + L423S)	X	X
51871	1H, 13C, and 15N backbone NMR resonance assignments of TANGO1 (30-139) from Drosophila melanogaster	X	X