BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Query Grid

Select desired data type(s) and optionally limit polymer type(s). You can select multiple values by holding the "control" key (Windows, Linux) or "option" key (MacOS) while clicking. All data type selections are applied using a logical AND operator. Polymer selection join type can be selected. Click a column header to sort by that column.

 

Number of entries returned: 499

Download all matching entries in NMR-STAR as a compressed file or download the results displayed on this page in CSV format.

BMRB IDSystem NameAny chemical shiftsProteinDNARNAOther
410314mer DNA duplex containing the operator sequence BS2468X
4104BS2 operator DNA complexed with the Antennapedia Homeodomain456XX
4141vnd/NK-2 homeodomain DNA complex1313XX
4165Tn916 integrase DNA complex978XX
4170DNA-duplex-6GP131X
4172Rev-erb beta response element296X
4176DNA dodecamer123X
4187Sigma-K RNA Polymerase Promoter Consensus Sequence204X
4235DNA decamer91X
4240Duplex DNA (5'-D(GP*GP*TP*CP*AP*CP*GP*AP*G)-3') (DOT)(5'-D(CP*TP*CP*GP*GP*GP*AP*CP*C)-3')109X
4243DNA (5'-D(TCCCGTTTCCA)-3')94X
4244alphaT decamer duplex103X
42478mer chimeric hybrid RNA/RNA-DNA duplex with tRNA-DNA junction145XX
4248Lymphoid enhancer-binding factor1212XX
4256Mbp1(2-124)690XX
4258MCB12T94X
4359Pbx1 homeodomain219XX
4361chromomycin-DNA complex239XX
4362chromomycin-DNA complex263XX
4368A35T vnd/NK2 mutant homeodomain890XX
4372apt117X
4392DNA minor groove binder91X
4400H-y5 Triple Helix247X
4409DNA (5'-D(*CP*GP*CP*AP*(HYD)TP*+TP*AP*CP*GP*C)- 3')163X
4412DNA (5'-D(*CP*GP*CP*AP*TP*+TP*AP*CP*GP*C)- 3')169X
4415DNA dodecamer duplex215X
4416Cis-syn thymine cyclobutane dimer215X
4488DNA decamer165X
45365'-D(*AP*GP*GP*AP*TP*CP*CP*TP*UP*TP*TP*GP*GP*AP*TP*CP*CP*T)-3'197X
45425'-D(*AP*GP*GP*AP*TP*CP*CP*TP*TP*TP*UP*GP*GP*AP*TP*CP*CP*T)-3'206X
4547DNA/RNA184XX
45505'-D(*GP*CP*GP*TP*TP*AP*AP*CP*GP*C)-3'83X
4555SRY-14mer duplex269X
4556SRY-8mer duplex151X
4576a3T3 hybrid104X
4609T-tetrad telomere repeats59X
46105'-D(*AP*GP*GP*GP*T)-3'29X
46125'-D(*TP*GP*GP*GP*CP*GP*GP*T)-3'62X
4618DNA104X
4646DNA161X
4647HPRT Gene Mutation Hotspot with a BPDE2(10R) Adduct195X
4687cyclic oligonucleotide d88X
4692TELOMERE FRAGMENT266X
4694cyclic oligonucleotide d89X
4708WT1 zinc finger domain DNA complex443XX
4710WT1 zinc finger domain416XX
4733bulge DNA 12/14mer203X
4734High mobility group protein of Drosophila complexed to a bulge DNA581XX
4746D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND COBALT214XX
4749DNA THREE-WAY JUNCTION282X
4753D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND ZINC238XX
4813LAC REPRESSOR HP62/DNA COMPLEX830XX
48355'-D(*GP*CP*GP*TP*TP*AP*AP*CP*GP*C)-3'82X
5032AFX in complex with DNA297XX
5134dAAUAA DNA Bulge: 5'-D(*GP*CP*AP*TP*CP*GP*AP*AP*UP*AP*AP*GP*CP*TP*AP*CP*G)-3'275X
5135dAATAA DNA Bulge: 5'-D(*GP*CP*AP*TP*CP*GP*AP*AP*TP*AP*AP*GP*CP*TP*AP*CP*G)-3'267X
51645'-D(P*CP*CP*AP*TP*AP*AP*TP*TP*TP*AP*CP*C)-3' duplex232X
5167AT-Rich DNA with the GAA-Hairpin Loop252X
5232Cdc13 DNA-binding domain /telomeric ssDNA complex2245XX
52435'-D(*CP*AP*CP*TP*AP*CP*TP*CP*TP*TP*TP*GP*TP*AP*GP*TP*G)-3'363X
52455'-D(*TP*GP*TP*TP*TP*GP*GP*C)-3'122X
52525'-D(*CP*CP*AP*CP*GP*CP*GP*TP*GP*G)-3'82X
52535'-D(*CP*CP*AP*TP*GP*CP*GP*TP*GP*G)-3'88X
52825'-D(*GP*CP*GP*AP*AP*GP*C)-3'118X
53395'-D(*CP*GP*TP*AP*CP*G)-3'45X
5345LACTOSE OPERON REPRESSOR/DNA Complex1803XX
5349Extended PBX Homeodomain-DNA complex1184XX
5361TELOMERE REPEAT BINDING FACTOR 1/DNA Complex908XX
5363hERR2-DNA complex1276XX
5370beta alanine linked polyamide bound to purine tract DNA217X
53858oxoG:G mismatch116X
5517B-MybR2R31015XX
5562CCGCGG49X
5634SS1167X
5635SS2165X
5636SS3167X
5637SS4165X
5638SS5163X
5639SS6165X
5640SS7163X
5641SS8165X
5642SS9167X
5643SS10165X
5644SS11167X
5645SS12165X
5646SS13163X
5647SS14165X
5648SS15163X
5649SS16165X
56715'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3'22X
5681CYCLIC OLIGONUCLEOTIDE D(CGCTCATT)99X
5714Synthetic DNA duplex with an AG mismatch219X
5716CK14 DNA 14-MER DUPLEX200X
5717XBY6 DNA 14-MER DUPLEX100X
5718XBY2 DNA 14-MER DUPLEX198X
5730Benzo[a]Pyrene Adducted Adenine in a DNA duplex220X
57375'-D(*TP*TP*AP*GP*GP*GP*T)-3'63X
57395'-D(*AP*CP*AP*TP*CP*XP*AP*TP*CP*T)-3'191X
57755'-R(*AP*AP*AP*GP*GP*AP*GP*GP*A)-3'/5'-D(*CP*CP*UP*CP*CP*UP*U)-3'147XX
5776sPrODN1:RNA152XX
5777PODN:RNA157XX
5781Propynyl DNA.RNA hybrid175XX
5791Lactose operon repressor761XX
59275'-D(*CP*GP*CP*TP*AP*AP*CP*AP*GP*GP*C)-3'197X
5979DNA229X
5993DNA duplex118X
6009Thrombin-binding DNA aptamer176X
61865'-D(P*TP*GP*AP*TP*CP*A)-3'47X
6273GTTCACAGAAC DNA hairpin111X
6274GTACACAGTAC DNA hairpin101X
6276Metal-response element-binding transcription factor-1 complex with MRE DNA769XX
63075'-D(*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*G)-3'178X
6319nkx2.5 homeodomain plus NK2 specific domain in DNA bound state558XX
6353RFC p140 375-480 BRCT region : DNA complex1182XX
6430HIV-1 integrase inhibitor, 93del163X
6445Metal-response element-binding transcription factor-1 complex with MRE DNA (22bp)820XX
65375'-d(CTAACAGAATG)-3'/5'-d(CATTCAGTTAG)-3'/Naphthyridine-Azaquinolone1/Naphthyridine-Azaquinolone2164X
6605NMR ensemble Ada Protein1273XX
6877HPV-16 E2C-DNA complex664XX
6906Bicoid Homeodomain Bound to DNA864XX
6975Bcl2MidG4Pu23-G15T G16T199X
7097brinker CG9653-PA/DNA Complex912XX
7105SRY.B in complex with 16-mer DNA2275XX
7319polyermase beta in complex with substrate DNA1311XX
7354LAC REPRESSOR876XX
7377CzrA745XX
110455'-D(*DTP*DAP*DCP*DG)-3' 10 structures37XX
110465'-D(*DTP*DAP*DCP*DG)-3' 10 structures37XX
110475'-D(*DTP*DAP*DCP*DG)-3' 10 structures37XX
110485'-D(*DTP*DAP*DCP*DG)-3' 10 structures37XX
11437Propylene-DNA213X
11438Protein211X
11528METALLO-BASE-PAIRED DNA220X
11608DNA CONTAINING METALLO-BASE-PAIR244X
15026Nar1IQ3 Duplex204X
15027Nar1 Duplex203X
15033cyclic octamer67X
15083SIGMA-54 RPON DOMAIN-DNA COMPLEX948XX
15213IntCB-DNA complex392XX
15223AB G alpha228X
15224AB G beta228X
15227duplex DNA containing an abasic site with opposite T (alpha anomer)225X
15228duplex DNA containing an abasic site with opposite T (beta anomer)225X
15238Ab C alpha205X
15239Ab C beta204X
15360DNA 12mer288X
15376modified DNA duplex185X
15527Mbp1 14368X
15533wt1-zf14-14mer236XX
156135'-D(*(DA)P*(DA)P*(DT)P*(DC)P*(DT)P*(DT)P*(DT)P*(DA)P*(DA)P*(DA)P*(DG)P*(DA)P*(DT)P*(DT))-3'121X
158605'-D(*DTP*DTP*DAP*DAP*DTP*DTP*DTP*(D33)*(D33)*(D33)*DAP*DAP*DAP*DTP*DTP*DAP*DA)-3'502X
15898DNA GAAA tetraloop121X
160545'-D(TP*CP*GP*TP*TP*GP*CP*T)-3'83X
160555'-D(P*TP*CP*GP*TP*TP*GP*CP*T)-3'79X
1613834-MER, SILVER ION332X
162125'-D(TP*CP*GP*TP*TP*GP*CP*T)-3'81X
162225'-D(*DCP*DTP*DAP*DTP*(FAG)P*DAP*DTP*DTP*DCP*DA)-3'220X
162235'-D(*DCP*DTP*(FAG)P*DA)-3'46X
162255'-D(*DGP*DTP*DGP*DCP*DGP*(TG)P*DGP*DTP*DTP*DTP*DGP*DT)-3'251X
162265'-D(*DGP*DTP*DGP*DCP*DGP*(TG)P*DGP*DTP*DTP*DTP*DGP*DT)-3'230X
16280d(GAGCTC)235X
162811:1 complex35X
16282d(AGAGCTCT)255X
16286d(CGAGCTCG)253X
162872:1 complex46X
162881:2 complex41X
16289d(GCTATAGC)255X
162901:1 complex42X
162912:1 complex40X
162922:1 complex43X
163565'-D(*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*(INO)P*GP*GP*TP*TP*AP*GP*GP*GP*T)-3'210X
16449XPF DNA complex707XX
16485THAP RRM11337XX
16577Homeodomain DNA complex423XX
16812MED1:DNA complex509XX
168345'-D(*DGP*DCP*DGP*DAP*DGP*(6MT)P*DTP*DCP*DTP*DGP*DCP*DG)-3'137X
16936MBD2 bound to a methylated DNA959XX
1712925-mer DNA oligomer418X
17130zif268-12bpDNA339XX
17229ZNF DNA153XX
173795'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*A)-3', 2-CARBOXYQUINOXALINE197X
17397RET oncogene209X
17409triazole-linked DNA duplex306X
17422Cidofovir DNA duplex166X
17423Control DNA duplex157X
17452Pitx2HD786XX
17535DNA/RNA hybrid183XX
17562N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenal147X
17580Myc G-quadruplex161X
17592Anabaena Sensory Rhodopsin Transducer with DNA492XX
17655Human Telomeric DNA189X
17697G-quadruplex127X
17708N-myc130X
17709N-myc115X
17729C-Terminal domain of Ler847XX
17732Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA815XX
17746(5'S)-8,5'-Cyclo-2'-deoxyguanosine in DNA160X
17786(5'S)-8,5'-cyclo-2'-deoxyguanosine167X
17787(5'S)-8,5'-cyclo-2'-deoxyguanosine164X
17788gamma-hydroxy-1,N2-propano-2'-deoxyguanosine adduct187XX
17789(5'S)-8,5'-cyclo-2'-deoxyadenosine171X
17790(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct137X
17791(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct131X
17814DNA Containing an Aristolactam II-dA Lesion82X
17859DNA duplex Containing an Unnatural, Hydrophobic Base Pair155X
17885DNA dodecamer73X
17887alpha anomeric lesion251X
17980G-quadruplexes159X
18015PITX2833XX
18040DNA 1222X
18050DNA 1188X
18199DNA 148X
18209DNA molecule G3ATG3ACACAG4ACG3153X
18279human CEB25 minisatellite G-quadruplex314X
184272'F-ANA and ANA self-complementary duplex79X
18430Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine149X
18452Synthetic cyclic oligonucleotide116XX
1845311 mer oligonucleotide-B150X
1845411 mer oligonucleotide-B150X
18462Kaiso2059XX
18496YdbC:dT19G1 complex1055XX
18524DNA OUH455X
18625Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'200X
18626Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin175X
1863811 mer oligonucleotide-B142X
18639Duplex DNA Containing a b-Carba-Fapy-dG Lesion150X
18640Duplex DNA Containing a b-Carba-Fapy-dG Lesion150X
18690MOMERIC PIL-E G-QUADRUPLEX DNA188X
18699DIMERIC PIL-E G-QUADRUPLEX DNA134X
18724G-quadruplex DNA171X
18762N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene140X
18780DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link81X
18781DNA80X
18835dodecamer duplex109X
18862Parallel human telomeric quadruplex containing 2'F-ANA substitutions111X
18881d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid385XX
18902major G-quadruplex202X
18907Duplex DNA225X
18935African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNA1212XX
18973DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion199X
18979DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer199X
18981DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion206X
18984DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer202X
18985DNA 1202X
19017Bulges in G-quadruplexes183X
19035G-rich VEGF aptamer with LNA modifications189X
19138ED Complex633XX
19158DNA (5'-D(*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*TP*GP*GP*G)-3')367X
19159d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex450X
19222Four dodecamers that together cover 39 bp of the 5' half of the strong nucleosome positioning sequence 601264X
19276d[CGCGAAGCATTCGCG] hairpin139X
19277d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid240X
19278d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid266X
19279d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid245X
19280d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid263X
19281d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid260X
19367complex formed by the region 2 of E. coli sigmaE and its cognate -10 non template element TGTCAAA1104XX
19375N2-dG IQ at G3 in NarI sequence213X
19381DNA/RNA (5'-D(*TP*TP*G)-R(P*(LG))-D(P*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3')186X
19386parallel-stranded G-quadruplex in DNA poly-G stretches164X
19387intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative233X
19389stacked dimeric G-quadruplex134X
19391MBD3814XX
19402antiparallel (2+2) G-quadruplex229X
19435Complex between DNA quadruplex (human telomere) and DD-bisRuthenium ligand196X
19440N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNA174X
19441spermine modified DNA duplex178X
19448dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence196X
19511homeodomain transcription factor Gbx1816XX
19540MyT1 F4F5 - DNA complex217XX
19571d(GGGTTTTGGGTGGGTTTTGGG) quadruplex345X
19572quadruplex d(TGGGTTTGGGTTGGGTTTGGG)180X
19592Molecular Binding of TFF1 Estrogen Response Element287X
19594G-quadruplex bound to the bisquinolinium compound Phen-DC3168X
19620DNA duplex containing N3T-ethylene-N1I116X
19653RRM domain from C. elegans SUP-12 + GGTGTGC DNA1250XX
19659RHB Modified duplex201X
19661SHB modified duplex198X
19695N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA137X
19696N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA140X
19728A tetrahelical DNA fold adopted by alternating GGG and GCG tracts112X
19734fd bacteriophage44XX
19745DNA (28-MER)212X
19747M13 bacteriophage291XX
19784G-triplex truncated-TBA194X
19805The dsDNA in intact bacteriophage T753X
19853AGA modified161X
19861AGT FAPY Modified duplex140X
19862AGC FAPY modified duplex Major isomer133X
19863AG(7-deaza)G FAPY modified duplex128X
19886CGACGCGTCG98X
19888CGACGCGTCG with 5,6,7,8-TETRAHYDROBIOPTERIN82X
19889CGACTAGTCG with AIK-18/51-196X
19890CGACTAGTCG dimer82X
19912DNA duplex163X
19917DNA dodecamer containing the 5-hydroxycytosine70X
19925DNA dodecamer with A:C mismatch72X
19939MBD4 methyl-cytosine binding domain bound to methylated DNA892XX
19957DNA-MC11054XX
25092MazE-DNA binding126XX
25099Hs2 dimer100X
25107DNA-quercetin61X
25110left-handed G-quadruplex267X
25369DNA Dodecamer with 8-oxoguanine at 10th Position160X
25378A G-quadruplex structure232X
25407DNA complex of the C-Terminal domain of MvaT750XX
25528DNA Dodecamer with 8-oxoguanine at 4th Position162X
25531N2-dG IQ at G1 in NarI sequence156X
25582Protein and DNA complex209XX
25596G-quadruplex166X
25651active G-quadruplex motif from AGRO100247X
25672N-(2'deoxyguanosin-8-yl)-3-aminobenzanthrone DNA adduct184X
25686G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome209X
25701EcoRV dimer with cognate DNA787XX
25723Universal Base oligonucleotide with UB at point 5152X
25724Control DNA oligonucleotide for the universal base149X
25746DNA G-quadruplex114X
25752EcoRV dimer with cognate DNA and Lu3+779XX
25759Quercetin complexed with c-myc G-quadruplex DNA57X
25840Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC51X
25882dsDNA-lomaiviticin A complex163X
25888F1F2-DNA complex1564XX
25890DNA free340X
25891PARP-1 F1F2F3-DNA complex1018XX
25894PARP-1 F1F2F3-WGR-DNA complex888XX
25903Glucose in a DNA double helix212X
25906Glucose as a nuclease mimic in DNA235X
25915Photoswitchable G-quadruplex82X
26620Barnase-dCGAC438XX
26731Paired domain of Pax5 in complex with DNA694XX
26808Egr-1 DNA complex1017XX
26978MeCP2-DNA643XX
27053KRAS oncogene promoter region218X
27144c-Myc Pu22207X
27173KRAS promoter region351X
27364Kaiso-MeCG2 complex222XX
27366KaisoE535Q-MeCG2 complex222XX
27367KaisoE535A-MeCG2 complex222XX
27368Kaiso-MeKBS complex228XX
27369KaisoE535Q-MeKBS complex228XX
27370KaisoE535A-MeKBS complex228XX
27371Kaiso-MeKBSsemi complex228XX
27372Kaiso-MeKBShemi complex228XX
27404hFEN1-336-K93A-DNA544XX
27409DNA polymerase beta116XX
27410DNA polymerase beta ternary complex116XX
27560protein-gapped DNA complex304XX
27561protein-gapped DNA-nucelotide complex304XX
27652NZ118 tetramer111X
27828d(CGATATCG)2 : free form50X
27829d(CGATATCG)2 : C-1305 complex100X
27958spin labled DNA duplex618X
28081Trimolecular G-quadruplex203X
30012DNA (5'-D(*AP*GP*GP*GP*CP*GP*GP*TP*GP*TP*GP*GP*GP*AP*AP*TP*AP*GP*GP*GP*AP*A)-3')218X
30015DNA (5'-D(*CP*GP*CP*TP*CP*(RIB)P*CP*AP*CP*GP*C)-3'), DNA (5'-D(*GP*CP*GP*TP*GP*GP*GP*AP*(8OG)P*CP*G)-3')190X
30016DNA (5'-D(*CP*GP*CP*TP*CP*(RIB)P*CP*AP*CP*GP*C)-3'), DNA (5'-D(*GP*CP*(8OG)P*TP*GP*GP*GP*AP*GP*CP*G)-3')187X
30038DNA200X
30044DNA Dodecamer with 8-oxoguanine at 10th Position200X
30045DNA (5'-D(*GP*GP*GP*TP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*AP*GP*GP*G)-3')210X
30052DNA (5'-D(*CP*GP*(RSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(RSG)P*CP*CP*G)-3')162X
30053DNA (5'-D(*CP*GP*GP*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*GP*CP*CP*G)-3')172X
30054DNA (5'-D(*CP*GP*(SSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(SSG)P*CP*CP*G)-3')130X
30055DNA (5'-D(*GP*GP*TP*TP*TP*GP*GP*TP*TP*TP*TP*GP*GP*TP*TP*TP*GP*G)-3')193X
30056DNA (5'-D(*GP*GP*TP*TP*TP*GP*GP*TP*TP*TP*TP*GP*GP*TP*TP*GP*G)-3')161X
30058DNA (25-MER)256X
30105DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')144XX
30111DNA (5'-D(*AP*TP*CP*CP*GP*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')145X
30112DNA (5'-D(*TP*TP*AP*GP*GP*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')145X
30113DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')144XX
30114DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')144XX
30115DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')144XX
30116DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')144XX
30117DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')144XX
30148DNA (5'-D(*CP*GP*(5CM)P*GP*AP*AP*TP*TP*CP*GP*CP*G)-3')192X
30151DNA (5'-D(*CP*GP*(5CM)P*GP*AP*AP*TP*TP*CP*GP*CP*G)-3')190X
30191DNA Dodecamer with 5-methylcytosine190X
30198DNA (5'-D(*CP*GP*CP*(8OG)P*AP*AP*TP*TP*(DMC)P*GP*CP*G)-3')170X
30250DNA (5'-D(*CP*GP*(DMC)P*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')170X
30251DNA (5'-D(*CP*GP*(DMC)P*GP*AP*AP*TP*TP*(DMC)P*(8OG)P*CP*G)-3')176X
30252DNA (5'-D(*CP*GP*CP*(8OG)P*AP*AP*TP*TP*(DMC)P*GP*CP*G)-3')172X
30253DNA (5'-D(*GP*CP*AP*TP*CP*GP*AP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*AP*AP*TP*CP*GP*AP*TP*GP*C)-3')300X
30254DNA (5'-D(*CP*GP*AP*TP*TP*TP*TP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*AP*AP*AP*AP*AP*AP*TP*CP*G)-3')308X
30255DNA (5'-D(*CP*GP*AP*TP*TP*TP*TP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*(M1A)P*AP*AP*AP*AP*AP*TP*CP*G)-3')305X
30328DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')176X
30329DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')174X
30335DNA (5'-D(*CP*CP*AP*AP*GP*AP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*TP*CP*TP*TP*GP*G)-3')131X
30336DNA (5'-D(*CP*CP*AP*AP*GP*AP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*TP*CP*TP*TP*GP*G)-3')132X
30402DNA (26-MER)269X
30473Sp1 transcription factor duplex 5'-d(GGGGCGGGG)244X
30484Sp1 transcription factor duplex 5'-d(GGGGCGGGA)138X
30485Sp1 transcription factor duplex 5'-d(TGGGCGGGG)133X
30506Sp1 transcription factor duplex 5'-d(TGGGCGGGA)139X
30552DNA (27-MER)292X
30577DNA (5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*A)-3')203X
30688DNA (5'-D(*(3D1)P*AP*GP*GP*GP*AP*GP*GP*GP*CP*GP*GP*CP*GP*GP*GP*AP*CP*A)-3')171X
30759DNA TATGTCTAAGTTCATCTA, DNA TAGATGAACXTAGACATA196X
30803Myc2345234X
30804Myc2345+NSC85697228X
30805Myc2345 T23205X
34025DNA (5'-D(*TP*AP*GP*GP*GP*AP*GP*GP*GP*TP*AP*GP*GP*GP*AP*GP*GP*GP*T)-3')138X
34034DNA (5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*G)-3')182X
34035DNA (5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*G)-3')172X
34051DNA (5'-D(*GP*CP*GP*AP*GP*GP*GP*AP*GP*CP*GP*AP*GP*GP*G)-3')137X
34053DNA (5'-D(*GP*TP*GP*TP*GP*GP*GP*TP*GP*TP*G)-3')109X
34054DNA (5'-D(*GP*CP*GP*AP*GP*GP*GP*AP*GP*CP*GP*AP*GP*GP*G)-3')103X
34056DNA (5'-D(*GP*CP*GP*AP*GP*GP*GP*AP*GP*CP*IP*AP*GP*GP*G)-3')79X
34062G-quadruplex formed by a human telomeric sequence modified with 2'-fluoro-2'-deoxyriboguanosine243X
34063Artificial quadruplex with propeller, diagonal and lateral loop184X
34071DNA (5'-D(*GP*GP*(FT)P*TP*GP*GP*TP*GP*TP*GP*GP*TP*TP*GP*G)-3')146X
34083UpsB-Q-1, DNA (34-MER)301X
34084UpsB-Q-1 DNA (34-MER)305X
34086DNA (26-MER)250X
34118DNA (5'-D(*TP*(DCP)P*CP*GP*TP*TP*TP*CP*(PSC)P*GP*T)-3')75X
34135DNA (5'-D(*TP*AP*GP*GP*GP*AP*CP*GP*GP*GP*CP*GP*GP*GP*CP*AP*GP*GP*GP*T)-3')182X
34136DNA (5'-D(*TP*AP*GP*GP*GP*AP*CP*GP*GP*GP*CP*GP*GP*GP*CP*AP*GP*GP*GP*T)-3')184X
34137DNA (5'-D(*TP*AP*GP*GP*GP*AP*CP*GP*GP*GP*CP*GP*GP*GP*CP*AP*GP*GP*GP*T)-3')184X
34145G-quadruplex of Human papillomavirus type 52248X
34157DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')482X
34158DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')431X
34159DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')484X
34162DNA (5'-D(*TP*(DCP)P*GP*TP*TP*CP*(DCP)P*GP*TP*TP*TP*TP*TP*CP*GP*TP*TP*CP*CP*GP*T)-3')116X
34168DNA (5'-D(*GP*GP*GP*GP*CP*CP*GP*GP*GP*GP*CP*CP*GP*GP*GP*GP*CP*CP*GP*GP*(BGM)P*G)-3')176X
34172ECF RNA polymerase sigma-E factor,ECF RNA polymerase sigma factor SigW,ECF RNA polymerase sigma-E factor/DNA Complex1256XX
34174artificial quadruplex with propeller, diagonal, and lateral loop191X
34186cmbr-481317158X
34210DNA (5'-D(*GP*GP*GP*AP*TP*GP*GP*GP*AP*CP*AP*CP*AP*GP*(GFL)P*GP*GP*AP*CP*GP*GP*G)-3')167X
34221DNA (27-MER)219X
34244DNA (5'-D(*CP*GP*TP*CP*TP*CP*AP*TP*GP*AP*TP*AP*CP*G)-3') major292X
34245DNA (5'-D(*CP*GP*TP*CP*TP*CP*AP*TP*GP*AP*TP*AP*CP*G)-3') minor150X
34269DNA (5'-D(*GP*GP*CP*GP*AP*GP*GP*AP*GP*GP*GP*GP*CP*GP*TP*GP*GP*CP*CP*GP*GP*C)-3')193X
34276Tc-DNA/RNA duplex349XX
34277tc-DNA/tc-DNA duplex190X
34280Tc-DNA/DNA duplex293X
34290functional pRN1 primase/DNA Complex1330XX
34291functional pRN1 primase/DNA Complex1186XX
34296DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')200X
34297DNA (5'-D(*GP*GP*GP*TP*AP*GP*GP*GP*AP*GP*CP*GP*GP*GP*AP*GP*AP*GP*GP*G)-3')156X
34302DNA (28-MER)229X
34328DNA (5'-*(DC5)P*GP*AP*TP*(P)P*TP*AP*(Z)P*AP*TP*CP*(DG3))-3')181X
34331hTel-oxoG10165X
34332hTel-oxoG21157X
34353TINA-conjugated antiparallel DNA triplex178X
34378Kiteplatinated DNA oligomer200X
34386DNA (5'-D(*GP*TP*GP*TP*GP*TP*GP*GP*GP*TP*GP*TP*GP*T)-3')135X
34389DNA (25-MER)136X
34390DNA (25-MER)164X
34397DNA (5'-(*(DC5)P*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*(DG3))-3')214X
34398DNA (5'-D(*CP*GP*TP*CP*TP*CP*AP*TP*GP*AP*TP*AP*CP*G)-3')304X
34403F1415149X
34431KRAS32R G9T469X
34435VK2217X
34436GCn126X
34438GCnCG145X
34441KRAS32R G25T304X
34444F1415137X
34445F1415156X
34467human telomeric G-quadruplexes50X
34499DNA (5'-D(*GP*GP*GP*AP*TP*GP*GP*GP*AP*CP*AP*CP*AP*(GF2))-R(P*(LCG))-D(P*GP*GP*AP*CP*GP*GP*G)-3')134X
34502DNA (5'-D(*GP*GP*GP*AP*TP*GP*GP*GP*AP*CP*AP*CP*AP*(GF2))-R(P*(LCG))-D(P*GP*GP*AP*CP*GP*GP*G)-3')149X
34516DNA (5'-D(*GP*GP*GP*TP*GP*GP*GP*AP*AP*GP*GP*GP*TP*GP*GP*GP*A)-3')153X
34524DNA (36-MER)285X
34525DNA (35-MER)237X
34529DNA (5'-D(*TP*GP*GP*GP*AP*GP*GP*GP*AP*GP*CP*GP*GP*GP*AP*GP*TP*GP*GP*G)-3')185X
34533DNA (36-MER)242X
34542bcl2ex-oxoG19180X
34543bcl2ex166X
34571DNA (5'-D(*GP*GP*TP*CP*TP*GP*AP*GP*GP*GP*AP*GP*AP*GP*GP*GP*GP*CP*TP*GP*GP*GP*T)-3')170X
34579DNA (5'-D(*CP*AP*CP*GP*CP*CP*GP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*CP*GP*GP*CP*GP*TP*G)-3')265X
34580DNA (5'-D(*CP*AP*CP*GP*CP*CP*GP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*CP*GP*GP*CP*GP*(SGT)P*G)-3')285X
34581DNA (5'-D(*CP*AP*CP*GP*CP*CP*GP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*CP*GP*GP*CP*GP*TP*G)-3')235X
34587DNA (5'-D(*AP*GP*CP*AP*AP*TP*CP*CP*(XC)P*(XC)P*(XC)P*(XC)P*GP*GP*AP*TP*TP*GP*CP*T)-3')252X
34588deoxyxylose nucleic acid hairpin233X
34594DNA (5'-D(*CP*GP*TP*AP*(FFC)P*G)-3')120X
34595DNA (5'-D(*CP*TP*AP*(FFC)P*AP*CP*GP*G)-3'), RNA (5'-R(*CP*CP*GP*UP*GP*UP*AP*G)-3')113XX
34599DNA (5'-D(*CP*TP*AP*(FFC)P*AP*CP*GP*G)-3'), RNA (5'-R(*CP*CP*GP*UP*GP*UP*AP*G)-3')121XX
34615DNA (31-MER)203X
36001Switch-activating protein 1/DNA Complex1148XX
36020DNA (5'-D(*CP*CP*TP*GP*CP*CP*TP*G)-3')82X
36022DNA (5'-D(*TP*TP*TP*AP*TP*TP*TP*A)-3')90X
36116DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3')175X
36159G-quadruplex DNA (26-MER)260X
36160G-quadruplex DNA (26-MER)262X
36168DNA (5'-D(*GP*GP*GP*TP*AP*CP*CP*CP*GP*GP*GP*TP*GP*AP*GP*GP*TP*GP*CP*GP*GP*GP*GP*T)-3')271X
36174DNA (5'-D(*CP*GP*CP*GP*AP*AP*AP*TP*TP*TP*CP*GP*CP*G)-3')258X
36186Rok/DNA Complex1409XX
50109d(GTATGGCCATAC)2 DNA duplex83X
50278dsDNA159X
50604Nucleosome Core Particle (human)72XX
50610DNA172X
50611DNA252X
50613DNA248X
50614DNA241X
50615DNA241X
50616DNA155X
50617DNA155X
50805tetrasome134XX
50806nucleosome130XX
50807hexasome231XX
50831Alkbh5 66-2921803XX