BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Query Grid

Select desired data type(s) and optionally limit polymer type(s). You can select multiple values by holding the "control" key (Windows, Linux) or "option" key (MacOS) while clicking. All data type selections are applied using a logical AND operator. Polymer selection join type can be selected. Click a column header to sort by that column.

 

Number of entries returned: 81

Download all matching entries in NMR-STAR as a compressed file or download the results displayed on this page in CSV format.

BMRB IDSystem NameCarbon shiftsNitrogen shiftsPhosphorus shiftsHydrogen shiftsOther shiftsProteinDNARNAOther
4141vnd/NK-2 homeodomain DNA complex291100189040XX
4172Rev-erb beta response element00282680X
4235DNA decamer009820X
4243DNA (5'-D(TCCCGTTTCCA)-3')0010840X
4244alphaT decamer duplex009940X
4361chromomycin-DNA complex80071520XX
4362chromomycin-DNA complex96071600XX
4415DNA dodecamer duplex00221930X
4416Cis-syn thymine cyclobutane dimer00221930X
4547DNA/RNA00161680XX
4555SRY-14mer duplex00262430X
4556SRY-8mer duplex00141370X
4646DNA00171440X
4692TELOMERE FRAGMENT00212450X
4746D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND COBALT80071270XX
4753D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND ZINC96071350XX
5134dAAUAA DNA Bulge: 5'-D(*GP*CP*AP*TP*CP*GP*AP*AP*UP*AP*AP*GP*CP*TP*AP*CP*G)-3'00272480X
5135dAATAA DNA Bulge: 5'-D(*GP*CP*AP*TP*CP*GP*AP*AP*TP*AP*AP*GP*CP*TP*AP*CP*G)-3'00262410X
52455'-D(*TP*GP*TP*TP*TP*GP*GP*C)-3'00131090X
52825'-D(*GP*CP*GP*AP*AP*GP*C)-3'3596680X
56715'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3'002200X
5681CYCLIC OLIGONUCLEOTIDE D(CGCTCATT)008910X
6009Thrombin-binding DNA aptamer00141620X
6273GTTCACAGAAC DNA hairpin00101010X
6430HIV-1 integrase inhibitor, 93del00151480X
15033cyclic octamer2004430X
15360DNA 12mer00222660X
15376modified DNA duplex00151700X
15527Mbp1 141160252270X
15898DNA GAAA tetraloop4207720X
162255'-D(*DGP*DTP*DGP*DCP*DGP*(TG)P*DGP*DTP*DTP*DTP*DGP*DT)-3'00202310X
16282d(AGAGCTCT)2007480X
16286d(CGAGCTCG)2007460X
16289d(GCTATAGC)2007480X
1712925-mer DNA oligomer1390252540X
17535DNA/RNA hybrid360161301XX
17887alpha anomeric lesion560181770X
18040DNA 100202020X
18050DNA 10091790X
18279human CEB25 minisatellite G-quadruplex560252330X
18973DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion00201790X
18979DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer00201790X
18981DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion00211850X
18984DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer00201820X
18985DNA 100201820X
19158DNA (5'-D(*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*TP*GP*GP*G)-3')00183490X
19159d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex00224280X
19222Four dodecamers that together cover 39 bp of the 5' half of the strong nucleosome positioning sequence 6010026400X
19387intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative00232100X
19440N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNA00141600X
19441spermine modified DNA duplex00141640X
19734fd bacteriophage390500XX
19784G-triplex truncated-TBA66091190X
25723Universal Base oligonucleotide with UB at point 500161360X
25724Control DNA oligonucleotide for the universal base00161330X
30038DNA00141860X
30044DNA Dodecamer with 8-oxoguanine at 10th Position00141860X
30052DNA (5'-D(*CP*GP*(RSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(RSG)P*CP*CP*G)-3')00181440X
30053DNA (5'-D(*CP*GP*GP*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*GP*CP*CP*G)-3')00161560X
30054DNA (5'-D(*CP*GP*(SSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(SSG)P*CP*CP*G)-3')00181120X
30105DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')00161280XX
30111DNA (5'-D(*AP*TP*CP*CP*GP*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')00161290X
30112DNA (5'-D(*TP*TP*AP*GP*GP*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')00161290X
30113DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')00161280XX
30114DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')00161280XX
30115DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')00161280XX
30116DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')00161280XX
30117DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')00161280XX
30253DNA (5'-D(*GP*CP*AP*TP*CP*GP*AP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*AP*AP*TP*CP*GP*AP*TP*GP*C)-3')11310221550X
30254DNA (5'-D(*CP*GP*AP*TP*TP*TP*TP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*AP*AP*AP*AP*AP*AP*TP*CP*G)-3')11510221610X
30255DNA (5'-D(*CP*GP*AP*TP*TP*TP*TP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*(M1A)P*AP*AP*AP*AP*AP*TP*CP*G)-3')11510201600X
30473Sp1 transcription factor duplex 5'-d(GGGGCGGGG)700101640X
34157DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')1070223530X
34158DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')1050223040X
34159DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')1120223500X
34328DNA (5'-*(DC5)P*GP*AP*TP*(P)P*TP*AP*(Z)P*AP*TP*CP*(DG3))-3')72011980X
34436GCn00111150X
34438GCnCG00131320X
34580DNA (5'-D(*CP*AP*CP*GP*CP*CP*GP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*CP*GP*GP*CP*GP*(SGT)P*G)-3')110162580X
34581DNA (5'-D(*CP*AP*CP*GP*CP*CP*GP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*CP*GP*GP*CP*GP*TP*G)-3')60172120X
36168DNA (5'-D(*GP*GP*GP*TP*AP*CP*CP*CP*GP*GP*GP*TP*GP*AP*GP*GP*TP*GP*CP*GP*GP*GP*GP*T)-3')110242360X