| 4141 | vnd/NK-2 Homeodomain DNA Complex Protein 1H, 13C, and 15N Chemical Shifts and
HNHA Coupling Constant | 291 | 100 | 18 | 904 | 0 | X | X | | |
| 4172 | Response Element of the Orphan Nuclear Receptor Rev-erb Beta | 0 | 0 | 28 | 268 | 0 | | X | | |
| 4235 | NMR Solution Structure of [d(GCGAATTCGC)2] | 0 | 0 | 9 | 82 | 0 | | X | | |
| 4243 | Intercalated d(TCCCGTTTCCA) dimer | 0 | 0 | 10 | 84 | 0 | | X | | |
| 4244 | NMR Solution Structure of [d(GCGAAT-3'-3'-alphaT-5'-5'-CGC)2] | 0 | 0 | 9 | 94 | 0 | | X | | |
| 4361 | Structure determination by restrained molecular dynamics using NMR pseudocontact
shifts as experimentally determined constraints | 80 | 0 | 7 | 152 | 0 | | X | | X |
| 4362 | Structure determination by restrained molecular dynamics using NMR pseudocontact
shifts as experimentally determined constraints | 96 | 0 | 7 | 160 | 0 | | X | | X |
| 4415 | Solution-state structure of a DNA dodecamer duplex containing a cis-syn thymine cyclobutane dimer. | 0 | 0 | 22 | 193 | 0 | | X | | |
| 4416 | Solution-State Structure of a DNA Dodecamer Duplex Containing a Cis-Syn Thymine
Cyclobutane Dimer. | 0 | 0 | 22 | 193 | 0 | | X | | |
| 4547 | Solution structure of a DNA.RNA hybrid containing an alpha-anomeric thymidine
and polarity reversals: d(ATGG-3'-3'-(alpha-T)-5'-5'-GCTC).r(gagcaccau) | 0 | 0 | 16 | 168 | 0 | | X | X | |
| 4555 | 31P NMR analysis of the DNA conformation induced by protein binding:SRY-DNA
complexes | 0 | 0 | 26 | 243 | 0 | | X | | |
| 4556 | 31P NMR analysis of the DNA conformation induced by protein binding:SRY-DNA
complexes | 0 | 0 | 14 | 137 | 0 | | X | | |
| 4646 | Structural NMR characterization of an 11-mer DNA Duplex Containing a
2'-deoxyaristeromycin 8-oxo-Guanine pair, nonhydrolyzable substrate analog for
the DNA repair enzyme MutY | 0 | 0 | 17 | 144 | 0 | | X | | |
| 4692 | SOLUTION STRUCTURE OF A HUMAN TELOMERE FRAGMENT | 0 | 0 | 21 | 245 | 0 | | X | | |
| 4746 | Average solution structure of d(TTGGCCAA)2 bound to Chromomycin-A3 and cobalt | 80 | 0 | 7 | 127 | 0 | | X | | X |
| 4753 | Average solution structure of d(TTGGCCAA)2 bound to Chromomycin-A3 and zinc | 96 | 0 | 7 | 135 | 0 | | X | | X |
| 5134 | Solution Structure of dAAUAA DNA Bulge | 0 | 0 | 27 | 248 | 0 | | X | | |
| 5135 | Solution Structure of dAATAA DNA Bulge | 0 | 0 | 26 | 241 | 0 | | X | | |
| 5245 | Heteroduplex of chirally pure R-methylphosphonate/DNA duplex | 0 | 0 | 13 | 109 | 0 | | X | | |
| 5282 | Refinement of d(GCGAAGC) Hairpin Structure Using One- and Two-Bonds Residual
Dipolar Couplings | 35 | 9 | 6 | 68 | 0 | | X | | |
| 5671 | Overall structure and sugar dynamics of a DNA dodecamer from homo and
heteronuclear dipolar couplings and 31P chemical shift anisotropy | 0 | 0 | 22 | 0 | 0 | | X | | |
| 5681 | DIMERIC SOLUTION STRUCTURE OF THE CYCLIC OCTAMER CD(CGCTCATT) | 0 | 0 | 8 | 91 | 0 | | X | | |
| 6009 | NMR structure of the thrombin-binding DNA aptamer stabilized by Sr2+ | 0 | 0 | 14 | 162 | 0 | | X | | |
| 6273 | 1H and 31P chemical shift assignments for the triloop DNA hairpin 5'-
GTTCACAGAAC - 3' | 0 | 0 | 10 | 101 | 0 | | X | | |
| 6430 | 1H and 31P chemical shift assignments for HIV-1 integrase inhibitor 93del | 0 | 0 | 15 | 148 | 0 | | X | | |
| 15033 | Dimeric solution structure of the cyclic octamer d(CCGTCCGT) | 20 | 0 | 4 | 43 | 0 | | X | | |
| 15360 | Solution Structures of a DNA Dodecamer Duplex | 0 | 0 | 22 | 266 | 0 | | X | | |
| 15376 | SOLUTION STRUCTURE OF A DNA DUPLEX CONTAINING THE UNIVERSAL BASE 5-NITROINDOLE-3-CARBOXAMIDE | 0 | 0 | 15 | 170 | 0 | | X | | |
| 15527 | 1H, 13C, and 31P Chemical Shift Assignments for 14-mer Base Pair Non-self Complementary DNA Duplex ( Mbp1_14) which Contains the Consensus Binding Site of the Yeast Transcription Factor Mbp-1 | 116 | 0 | 25 | 227 | 0 | | X | | |
| 15898 | H1, C13, 31P chemical shifts of dGCGAAAGC | 42 | 0 | 7 | 72 | 0 | | X | | |
| 16225 | Solution Structure of cis-5R,6S-thymine glycol opposite complementary adenine in duplex DNA | 0 | 0 | 20 | 231 | 0 | | X | | |
| 16282 | d(AGAGCTCT)2 assignments | 0 | 0 | 7 | 48 | 0 | | X | | |
| 16286 | d(CGAGCTCG)2 assignments | 0 | 0 | 7 | 46 | 0 | | X | | |
| 16289 | d(GCTATAGC)2 assignments | 0 | 0 | 7 | 48 | 0 | | X | | |
| 17129 | Chemical shifts of the 25-mer oligonucleotide encompassing the variable region of a MUC1 DNA aptamer. | 139 | 0 | 25 | 254 | 0 | | X | | |
| 17535 | DNA / RNA Hybrid containing a central stereo specific Rp borano phosphate linkage | 36 | 0 | 16 | 130 | 1 | | X | X | |
| 17887 | DNA sequence context conceals alpha anomeric lesion | 56 | 0 | 18 | 177 | 0 | | X | | |
| 18040 | DNA TT mismatch and 2,7-BisNP | 0 | 0 | 20 | 202 | 0 | | X | | |
| 18050 | Structure of a bis-naphthalene bound to a thymine-thymine DNA mismatch | 0 | 0 | 9 | 179 | 0 | | X | | |
| 18279 | human CEB25 minisatellite G-quadruplex | 56 | 0 | 25 | 233 | 0 | | X | | |
| 18973 | DNA containing a cluster of 8-oxo-guanine and abasic site lesion : alpha anomer | 0 | 0 | 20 | 179 | 0 | | X | | |
| 18979 | DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer | 0 | 0 | 20 | 179 | 0 | | X | | |
| 18981 | DNA containing a cluster of 8-oxo-guanine and THF lesion | 0 | 0 | 21 | 185 | 0 | | X | | |
| 18984 | DNA containing a cluster of 8-oxo-guanine and abasic site lesion : alpha anomer (AP6, 8OG 14) | 0 | 0 | 20 | 182 | 0 | | X | | |
| 18985 | DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer (6AP, 8OG14) | 0 | 0 | 20 | 182 | 0 | | X | | |
| 19158 | Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions | 0 | 0 | 18 | 349 | 0 | | X | | |
| 19159 | Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions | 0 | 0 | 22 | 428 | 0 | | X | | |
| 19222 | NMR Studies of DNA Support the Role of Pre-Existing Minor Groove Variations in Nucleosome Indirect Readout | 0 | 0 | 264 | 0 | 0 | | X | | |
| 19387 | Solution structure of an intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative | 0 | 0 | 23 | 210 | 0 | | X | | |
| 19440 | NMR structure of DNA duplex | 0 | 0 | 14 | 160 | 0 | | X | | |
| 19441 | NMR structure of spermine modified DNA duplex | 0 | 0 | 14 | 164 | 0 | | X | | |
| 19734 | Complete chemical shift assignment of the ssDNA in the filamentous bacteriophage fd report on its conformation and on its interface with the capsid shell | 39 | 0 | 5 | 0 | 0 | X | X | | |
| 19784 | Solution structure of the G-triplex truncated-TBA | 66 | 0 | 9 | 119 | 0 | | X | | |
| 25723 | Universal Base oligonucleotide structure | 0 | 0 | 16 | 136 | 0 | | X | | |
| 25724 | Universal base control oligonucleotide structure | 0 | 0 | 16 | 133 | 0 | | X | | |
| 30038 | Solution Structure of DNA Dodecamer with 8-oxoguanine at 4th Position | 0 | 0 | 14 | 186 | 0 | | X | | |
| 30044 | Solution Structure of DNA Dodecamer with 8-oxoguanine at 10th Position | 0 | 0 | 14 | 186 | 0 | | X | | |
| 30052 | NMR solution structure of [Rp, Rp]-PT dsDNA | 0 | 0 | 18 | 144 | 0 | | X | | |
| 30053 | Solution NMR structure of PT-free dsDNA from Streptomyces lividans | 0 | 0 | 16 | 156 | 0 | | X | | |
| 30054 | NMR solution structure of [Sp, Sp]-PT dsDNA | 0 | 0 | 18 | 112 | 0 | | X | | |
| 30105 | Structural impact of single ribonucleotides in DNA | 0 | 0 | 16 | 128 | 0 | | X | | X |
| 30111 | Structural impact of single ribonucleotides in DNA | 0 | 0 | 16 | 129 | 0 | | X | | |
| 30112 | Structural impact of single ribonucleotides in DNA | 0 | 0 | 16 | 129 | 0 | | X | | |
| 30113 | Structural impact of single ribonucleotides in DNA | 0 | 0 | 16 | 128 | 0 | | X | | X |
| 30114 | Structural impact of single ribonucleotides in DNA | 0 | 0 | 16 | 128 | 0 | | X | | X |
| 30115 | Structural impact of single ribonucleotides in DNA | 0 | 0 | 16 | 128 | 0 | | X | | X |
| 30116 | Structural impact of single ribonucleotides in DNA | 0 | 0 | 16 | 128 | 0 | | X | | X |
| 30117 | Structural impact of single ribonucleotides in DNA | 0 | 0 | 16 | 128 | 0 | | X | | X |
| 30253 | Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A2-DNA structure | 113 | 10 | 22 | 155 | 0 | | X | | |
| 30254 | Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A6-DNA structure | 115 | 10 | 22 | 161 | 0 | | X | | |
| 30255 | Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A6-DNAm1A16 structure | 115 | 10 | 20 | 160 | 0 | | X | | |
| 30473 | NMR structure for Sp1 transcription factor duplex 5'-d(GGGGCGGGG) | 70 | 0 | 10 | 164 | 0 | | X | | |
| 30940 | Hairpin near 3'-Splice Site of Influenza A Segment 7 Bound to 5-nt Oligonucleotide | 0 | 0 | 12 | 177 | 0 | | X | X | |
| 34157 | NtMe polyamide in complex with 5'CGATGTACATCG3'- hairpin polyamides studies | 107 | 0 | 22 | 353 | 0 | | X | | |
| 34158 | NtiPr polyamide in complex with 5'CGATGTACTACG3 | 105 | 0 | 22 | 304 | 0 | | X | | |
| 34159 | Im polyamide in complex with 5'CGATGTACATCG3'- hairpin polyamides studies | 112 | 0 | 22 | 350 | 0 | | X | | |
| 34328 | Dodecamer DNA containing the synthetic base pair P-Z | 72 | 0 | 11 | 98 | 0 | | X | | |
| 34436 | Guanine-rich oligonucleotide with 5'-GC end form G-quadruplex with A(GGGG)A hexad, GCGC- and G-quartets and two symmetric GG and AA base pairs | 0 | 0 | 11 | 115 | 0 | | X | | |
| 34438 | Guanine-rich oligonucleotide with 5'- and 3'-GC ends form G-quadruplex with A(GGGG)A hexad, GCGC- and G-quartets and two symmetric GG and AA base pair | 0 | 0 | 13 | 132 | 0 | | X | | |
| 34580 | Single modified phosphoryl guanidine DNA duplex, Sp diastereomer | 11 | 0 | 16 | 258 | 0 | | X | | |
| 34581 | DNA duplex with phosphoryl guanidine moiety, Rp-diastereomer | 6 | 0 | 17 | 212 | 0 | | X | | |
| 34685 | Solution structure of a lanthanide-binding DNA aptamer | 0 | 0 | 79 | 779 | 0 | | X | | |
| 34805 | Solution structure of the 8-17 DNAzyme in presence of Zn2+ | 0 | 0 | 32 | 302 | 0 | | X | | |
| 34914 | Single acyclic phosphonate nucleotide (S)-ZNA modification on DNA hairpin | 78 | 0 | 9 | 103 | 0 | | X | | |
| 34915 | Single acyclic phosphonate nucleotide (R)-ZNA modification on DNA duplex | 96 | 0 | 14 | 242 | 0 | | X | | |
| 34942 | Solution structure of a silver ion mediated DNA duplex with universal 7-deazapurine substitutions | 0 | 0 | 11 | 89 | 0 | | X | | |
| 36168 | Solution structure of G-quadruplex formed in vegfr-2 proximal promoter sequence | 11 | 0 | 24 | 236 | 0 | | X | | |
| 50610 | T9 DNA | 0 | 0 | 88 | 84 | 0 | | X | | |
| 50611 | U9 DNA | 0 | 0 | 88 | 164 | 0 | | X | | |
| 50613 | U8 DNA | 0 | 0 | 88 | 160 | 0 | | X | | |
| 50614 | dhU3 DNA | 0 | 0 | 77 | 164 | 0 | | X | | |
| 50615 | DDD DNA | 0 | 0 | 77 | 164 | 0 | | X | | |
| 50616 | A3T3 DNA | 0 | 0 | 77 | 78 | 0 | | X | | |
| 50617 | MeC9 DNA | 0 | 0 | 77 | 78 | 0 | | X | | |
| 52355 | 8-17 DNAzyme in presence of various metal ions | 0 | 0 | 180 | 2071 | 0 | | X | | |