BMRB Query Grid

Select desired data type(s) and optionally limit polymer type(s). You can select multiple values by holding the "control" key (Windows, Linux) or "option" key (MacOS) while clicking. All data type selections are applied using a logical AND operator. Polymer selection join type can be selected. Click a column header to sort by that column.

 

Number of entries returned: 432

Download all matching entries in NMR-STAR as a compressed file or download the results displayed on this page in CSV format.

BMRB IDEntry TitlePDB structureProteinDNARNAOther
4141vnd/NK-2 Homeodomain DNA Complex Protein 1H, 13C, and 15N Chemical Shifts and HNHA Coupling Constant1NK2 XX
4172Response Element of the Orphan Nuclear Receptor Rev-erb Beta1BN9 X
4176NMR Solution Structure of a DNA Dodecamer Containing Single G:T Mismatches1BJD X
4187Nuclear Magnetic Resonance Structure of d(GCATATGATAG).d(CTATCATATGC): A Consensus Sequence for Promoters Recognized by Sigma-K RNA Polymerase1SKP X
4235NMR Solution Structure of [d(GCGAATTCGC)2]1BWT X
4243Intercalated d(TCCCGTTTCCA) dimer1C11 X
4244NMR Solution Structure of [d(GCGAAT-3'-3'-alphaT-5'-5'-CGC)2]1BX5 X
4248LEF1 HMG Domain (From Mouse), Complexed with DNA (15bp), NMR, 12 Structures2LEF XX
4372Solution Structure of a Quadraplex Forming DNA and Its Intermediate1C32 1C34 X
4392Binding of AR-1-144, a tri-imidazole DNA minor groove binder, to CCGG sequence analyzed by NMR spectroscopy1B0S 1CYZ X
4400Structure and Mechanism of Formation of the H-y5 ismomer of an Intramolecular DNA Triple Helix.1B4Y X
4409DNA DECAMER DUPLEX CONTAINING T-T DEWAR PHOTOPRODUCT1QKG X
4412DNA DECAMER DUPLEX CONTAINING T5-T6 PHOTOADDUCT1QL5 X
4415Solution-state structure of a DNA dodecamer duplex containing a cis-syn thymine cyclobutane dimer.1TTD X
4416Solution-State Structure of a DNA Dodecamer Duplex Containing a Cis-Syn Thymine Cyclobutane Dimer.1COC X
4488DNA decamer duplex containing T-T (6-4) photoadduct1CFL X
4536Structural basis for uracil DNA glycosylase interaction with uracil: NMR study1DGO X
4542Solution structure of a uracil containing hairpin DNA1QE7 X
4547Solution structure of a DNA.RNA hybrid containing an alpha-anomeric thymidine and polarity reversals: d(ATGG-3'-3'-(alpha-T)-5'-5'-GCTC).r(gagcaccau)1C2Q XX
4550NMR structure of the palindromic DNA decamer d(GCGTTAACGC)21CQO X
4609NMR observation of T-tetrads in a parallel stranded DNA quadruplex formed by Saccharomyces cerevisiae telomere sequence1EMQ X
4610NMR Observation of A-tetrad in a DNA Quadruplex1EVM X
4612NMR observation of a novel C-tetrad in a DNA quadruplex1EVO X
4618The Solution Structure of [d(CGC)r(aaa)d(TTTGCG)]2: Hybrid Junctions Flanked by DNA Duplexes1DXN X
4646Structural NMR characterization of an 11-mer DNA Duplex Containing a 2'-deoxyaristeromycin 8-oxo-Guanine pair, nonhydrolyzable substrate analog for the DNA repair enzyme MutY1FYI X
4647HPRT Gene Mutation Hotspot with a BPDE2(10R) Adduct1FYY X
4692SOLUTION STRUCTURE OF A HUMAN TELOMERE FRAGMENT1EL2 X
5134Solution Structure of dAAUAA DNA Bulge1JS7 1JS5 X
5135Solution Structure of dAATAA DNA Bulge1JRW 1JRV X
5164NMR Structure of a Parallel Stranded DNA Duplex at Atomic Resolution1JUU X
5167NMR Structure of an AT-Rich DNA with the GAA-Hairpin Loop1JVE X
52321H, 13C, and 15N resonance assignments of the DNA-binding domain of the essential protein Cdc13 complexed with single-stranded telomeric DNA1KXL XX
5243Solution Structure of the 17mer TF1 Binding Site1IR5 X
5245Heteroduplex of chirally pure R-methylphosphonate/DNA duplex1K1R X
5252Structural Differences in the NOE-derived Structure of G-T Mismatched DNA relative to Normal DNA are Correlated with Differences in (13)C Relaxation-based Internal Dynamics1KKV X
5253Structural Differences in the NOE-derived Structure of G-T Mismatched DNA relative to Normal DNA are Correlated with Differences in (13)C Relaxation-based Internal Dynamics1KKW X
5282Refinement of d(GCGAAGC) Hairpin Structure Using One- and Two-Bonds Residual Dipolar Couplings1KR8 1PQT X
5339NMR minimized average structure of d(CGTACG)21K2K X
5345Assignment of lac repressor headpiece complexed of its natural operator1L1M XX
5349PBX Homeodomain-DNA complex1LFU XX
5361Solution Structure of the DNA Complex of Human TRF11IV6 XX
53631H, 13C, and 15N Chemical shifts for hERR2 Protein, 1H chemical shifts for DNA1LO1 XX
5370Structure of a Beta-Alanine-Linked Polyamide Bound to a Full Helical Turn of Purine Tract DNA in the 1:1 Motif1LEJ X
5385Chemical shift assignments for the 8OG:G mismatched duplex1N2W X
5517NMR studies of the DNA-binding domain of B-Myb1A5J XX
5562NMR conformational study of proposed quadruplex hexanucleotide d(CCGCGG)2 in solution1N1K X
5671Overall structure and sugar dynamics of a DNA dodecamer from homo and heteronuclear dipolar couplings and 31P chemical shift anisotropy1NAJ X
5681DIMERIC SOLUTION STRUCTURE OF THE CYCLIC OCTAMER CD(CGCTCATT)1N96 X
57141H Chemical shift assignments of the major conformation of a 11-mer DNA duplex containing an AG Mismatch1ONM X
5716CHEMICAL SHIFTS OF THE CK14 DNA DUPLEX: A PORTION OF THE KNOWN NF-kB SEQUENCE CK11K8J 1K8N 1K8L X
5717NMR STRUCTURE OF THE CK14 DNA DUPLEX: A PORTION OF THE KNOWN NF-kB SEQUENCE CK11K8J 1K8N 1K8L X
5718Chemical Shifts for the XBY2 DNA Duplex1K8J 1K8N 1K8L X
57301H Chemical Shift Assignments for a DNA Duplex with N6-Deoxyadenosine Adduct of (9S,10R)-9,10-Epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene1N8C X
5737Structure of the parallel-stranded DNA quadruplex d(TTAGGGA)4 containing the human telomeric repeat: evidence for A-tetrad formation from NMR and molecular dynamics simulation.1NP9 X
5739Mispairing of the Deoxycytosine with Deoxyadenosine 5' to the 8, 9-Dihydro-8-(N7-guanyl)-9-Hydroxy-Aflatoxin B1 Adduct : Structural study based on NMR1N1N X
57755'(dCCUCCUU)3':3'(rAGGAGGAAA)5'1NTQ XX
5776sPrODN1:RNA [5'-R(AAAGGAGGA)-3'/5'-D(CXXXXXX)-3']1NTS XX
5777PODN:RNA [5'-R(AAAGGAGGA)-3'/5'-D(XXXXXXX)-3']1NTT XX
5781The Solution Structure of a DNA.RNA Duplex Containing 5-Propynyl U and C Comparison with 5-Me Modifications1OO7 XX
5791Solution structure of a dimeric lactose DNA-binding domain complexed to a nonspecific DNA sequence1OSL XX
5927NMR Structure of a Cyclic Polyamide-DNA Complex1PQQ X
5979A parallel stranded DNA duplex with an A-G mismatch base-pair1R2L X
6009NMR structure of the thrombin-binding DNA aptamer stabilized by Sr2+1RDE X
6186Structure of DNA sequence d-TGATCA by two-dimensional nuclear magnetic resonance spec and restrained molecular dynamics1SY8 X
6307The Solution Structure of d(G3T4G4)21U64 X
69751H chemical shift assignments for Bcl2MidG42F8U X
7097DNA recognition by the Brinker nuclear repressor - an extreme case of the coupling between binding and folding2GLO XX
7354NMR STRUCTURE OF A PROTEIN-DNA COMPLEX OF AN ALTERED SPECIFICITY MUTANT OF THE LAC REPRESSOR THAT MIMICS THE GAL REPRESSOR2BJC XX
11045Mhr1p-bound ssDNA2RPD XX
11046hsRad51-bound ssDNA2RPE XX
11048RecT-bound ssDNA2RPH XX
11437DNA oligmer containing propylene cross-linked cyclic 2' -deoxyuridylate dimer2RRQ X
11438DNA oligomer containing ethylene cross-linked cyclic 2'-deoxyuridylate dimer2RRR X
11528STRUCTURE OF METALLO-DNA IN SOLUTION2RT8 X
11608SOLUTION STRUCTURE OF DNA CONTAINING METALLO-BASE-PAIR2RVP X
15083NMR Structure of the Sigma-54 RpoN Domain Bound to the-24 Promoter Element2O8K 2O9L XX
15533Structure of the Wilms' Tumor Suppressor Protein Zinc Finger Domain Bound to DNA2JPA XX
15613SOLUTION STRUCTURE OF THE BIS-C2-2-NAPHTHYLPYRROLO[2,1-c][1,4]BENZODIAZEPINE (DA046) DNA ADDUCT: THE MOLECULAR BASIS FOR DNA HELIX STABILIZATION.2K4L X
15860NMR solution structure of modified DNA containing imidazole nucleosides at acidic, neutral and basic pH2K67 2K68 2K69 X
16054Dimeric solution structure of the DNA loop d(TGCTTCGT)2K90 X
16055Dimeric solution structure of the cyclic octamer d(pCGCTCCGT)2K97 X
16138NMR solution structure of metal-modified DNA2M54 X
16212Dimeric solution structure of the DNA loop d(TCGTTGCT)2K8Z X
16222NMR Structure of Aflatoxin Formamidopyrimidine alpha-anomer in duplex DNA2KH3 X
16223Aflatoxin Formamidopyrimidine alpha anomer in single strand DNA2KH4 X
16225Solution Structure of cis-5R,6S-thymine glycol opposite complementary adenine in duplex DNA2KH6 X
16226Solution Structure of cis-5R,6S-thymine glycol opposite complementary guanine in duplex DNA2KH7 2KH8 X
16356Structure of a two-G-tetrad intramolecular G-quadruplex formed by a variant human telomeric sequence in K+ solution2KKA X
16449Structure of the XPF-single strand DNA complex2KN7 XX
16485Solution structure of the THAP zinc finger of THAP1 in complex with its DNA target2KO0 XX
16577Backbone Chemical Shift Assignments of Mouse HOXA13 DNA Binding Domain in Complex with DNA Duplex2LD5 XX
16812data-driven model of MED1:DNA complex2KAE XX
16834NMR structure of fully methylated GATC site2KAL X
16936Solution structure and dynamic analysis of chicken MBD2 methyl binding domain bound to a target methylated DNA sequence2KY8 XX
17229C-terminal zinc knuckle of the HIVNCp7 with DNA2L45 XX
17379QUI/G-quadruplex complex2L7V X
17397Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence2L88 X
17409A biocompatible backbone modification? - Structure and dynamics of a triazole-linked DNA duplex2L8I X
17422Solution Structure of a DNA Duplex Containing the Potent Anti-Poxvirus Agent Cidofovir2L8P X
17423Solution Structure of a DNA Duplex Containing the Potent Anti-Poxvirus Agent Cidofovir2L8Q X
17535DNA / RNA Hybrid containing a central stereo specific Rp borano phosphate linkage2LAR XX
17562N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenal2LBI X
17580Myc G-quadruplex formed at the 5'-end of NHEIII element2LBY X
17655Structure of Human Telomeric DNA in Crowded Solution2LD8 X
17697Structure of a dimeric all-parallel-stranded G-quadruplex stacked via the 5'-to-5' interface2LE6 X
17708Solution-state structures of monomeric and dimeric G-quadruplexes adopted by a sequence from N-myc2LED X
17709Solution-state structures of monomeric and dimeric G-quadruplexes formed by a sequence from N-myc2LEE X
17729Structure of the DNA complex of the C-Terminal domain of Ler2LEV XX
17732Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA2LEX XX
17746Oligonucleotide duplex contaning (5'S)-8,5'-cyclo-2'-deoxyguansine2LFA X
17786Structure of the duplex when (5'S)-8,5'-cyclo-2'-deoxyguanosine is placed opposite dT2LFX X
17787Structure of the duplex when (5'S)-8,5'-cyclo-2'-deoxyguanosine is placed opposite dA2LFY X
17789structure of the duplex containing (5'S)-8,5'-cyclo-2'-deoxyadenosine2LG0 X
17790Structure of the duplex containing HNE derived (6S,8R,11S) N2-dG cyclic hemiacetal when placed opposite dT2LG2 X
17791Structure of the duplex containing HNE derived (6S,8R,11S) gamma-HO-PdG when placed opposite dT2LG3 X
17814Structure of DNA Containing an Aristolactam II-dA Lesion.2LGM X
17859Solution Structure of a DNA duplex Containing an Unnatural, Hydrophobic Base Pair2LHO X
17885Solution NMR structure of a DNA dodecamer containing the 7-aminomethyl-7-deaza-2'-deoxyguanosine adduct2LIA X
17887DNA sequence context conceals alpha anomeric lesion2LIB X
17980Monomer-dimer equilibrium for 5 -5 stacking of propeller-type parallel-stranded G-quadruplexes: NMR structural study2LK7 X
18015Chemical shift assignments for the homeodomain of Pitx2 in complex with a TAATCC DNA binding site2LKX XX
18040DNA TT mismatch and 2,7-BisNP2LL9 X
18050Structure of a bis-naphthalene bound to a thymine-thymine DNA mismatch2LLJ X
18199Structural Basis for Bifunctional Zn(II) Macrocyclic Complex Recognition of Thymine Bulges in DNA. Structure of a Thymine bulge.2LO5 2LO8 2LOA X
18209Solution-state structure of an intramolecular G-quadruplex w th propeller, diagonal and edgewise loops2LOD X
18279human CEB25 minisatellite G-quadruplex2LPW X
18427Solution structure of 2'F-ANA and ANA self-complementary duplex2LSC X
18430Structure and Stability of Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine: An Oxidative Lesion Repair by NER.2LSF X
18452Solution structure of a mini i-motif2LSX XX
18453NMR structure of duplex DNA containing the -OH-PdG dA base pair: A mutagenic intermediate of acrolein2LSZ X
18454NMR structure of duplex DNA containing the -OH-PdG dA base pair: A mutagenic intermediate of acrolein2LT0 X
18462Solution NMR structure of Kaiso zinc finger DNA binding domain in complex with Kaiso binding site DNA2LT7 XX
18496Solution NMR Structure of YdbC:dT19G1 complex. Northeast Structural Genomics Consortium (NESG) Target KR1502LTT XX
18524Solution structure of a parallel-stranded oligoisoguanine DNA pentaplex formed by d(T(iG)4T) in the presence of Cs ions2LUJ X
18625NMR Structure of the Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'.2LWG X
18626NMR Structure of the Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin2LWH X
18638Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion2LWM X
18639Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion2LWN X
18640Solution Structure of Duplex DNA Containing a b-Carba-Fapy-dG Lesion2LWO X
18690MOMERIC PIL-E G-QUADRUPLEX DNA FROM NEISSERIA GONORRHOEAE2LXQ X
18699DIMERIC PIL-E G-QUADRUPLEX DNA FROM NEISSERIA GONORRHOEAE, N STRUCTURES2LXV X
18724FUC_TBA2LYG X
18762NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing2LZK X
18780DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link2LZV X
18781DNA duplex containing mispair-aligned O6G-heptylene-O6G interstrand cross-link2LZW X
18835Structure of perimidinone-derived synthetic nucleoside paired with guanine in DNA duplex2M11 X
18862Parallel human telomeric quadruplex containing 2'F-ANA substitutions2M1G X
18881NMR solution structure of the d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid2M1V XX
18902Solution structure of the major G-quadruplex formed in the human VEGF promoter: Insights into loop interactions of the parallel G-quadruplexes2M27 X
18907Solution structure of Duplex DNA2M2C X
18935African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNA2M2V 2M2W XX
18973DNA containing a cluster of 8-oxo-guanine and abasic site lesion : alpha anomer2M3P X
18979DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer2M3Y X
18981DNA containing a cluster of 8-oxo-guanine and THF lesion2M40 X
18984DNA containing a cluster of 8-oxo-guanine and abasic site lesion : alpha anomer (AP6, 8OG 14)2M43 X
18985DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer (6AP, 8OG14)2M44 X
19017Solution structure of an intramolecular propeller-type G-quadruplex containing a single bulge2M4P X
19035G-rich VEGF aptamer with LNA modifications2M53 X
19158Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions2M6V X
19159Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions2M6W X
19276Structure of d[CGCGAAGCATTCGCG] hairpin2M8Y X
19277Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid2M8Z X
19278Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid2M90 X
19279Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid2M91 X
19280Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid2M92 X
19281Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid2M93 X
19367Solution structure of the complex formed by the region 2 of E. coli sigmaE and its cognate -10 non template element TGTCAAA2MAP XX
19375NMR Structure of N2-IQ-dG at the G3 position in the NarI recognition sequence2MAV X
19381Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes2MAY X
19386parallel-stranded G-quadruplex in DNA poly-G stretches2MB2 X
19387Solution structure of an intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative2MB3 X
19389Solution structure of a stacked dimeric G-quadruplex formed by a segment of the human CEB1 minisatellite2MB4 X
19391Solution structure of MBD3 methylcytosine binding domain while bound to hydroxymethylated DNA2MB7 XX
19402Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution)2MBJ X
19435Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence2MCC X
19440NMR structure of DNA duplex2MCI X
19441NMR structure of spermine modified DNA duplex2MCJ X
19448Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence2MCO X
19511NMR Structure of the homeodomain transcription factor Gbx1 from Homo sapiens solved in the presence of the DNA sequence CGACTAATTAGTCG2ME0 XX
19540haddock model of MyT1 F4F5 - DNA complex2MF8 XX
19571Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions.2MFT X
19572Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions.2MFU X
19592Molecular Binding of TFF1 Estrogen Response Element by a DNA Bis-intercalating Anticancer Drug XR59442MG8 X
19594Solution structure of a G-quadruplex bound to the bisquinolinium compound Phen-DC32MGN X
19620Solution structure of DNA duplex containing N3T-ethylene-N1I interstrand cross-link2MH6 X
19653RRM domain from C. elegans SUP-124CH1 XX
19659Structure of Exocyclic R,R N6,N6-(2,3-Dihydroxy-1,4-butadiyl)-2'-Deoxyadenosine Adduct Induced by 1,2,3,4-Diepoxybutane in DNA2MHX X
19661Structure of Exocyclic S,S N6,N6-(2,3-Dihydroxy-1,4-butadiyl)-2'-Deoxyadenosine Adduct Induced by 1,2,3,4-Diepoxybutane in DNA2MHZ X
19695NMR studies of N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA: Impact of adduct stereochemistry, size, and local DNA structure on solution conformations2MIV X
19696Nuclear magnetic resonance studies of N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA: Impact of adduct stereochemistry, size, and local DNA structure on solution conformations2MIW X
19728A tetrahelical DNA fold adopted by alternating GGG and GCG tracts2MJJ X
19745Solution NMR structure of a mismatch DNA2MJX X
1974713C and 15N Chemical Shift Assignments for the M13 Bacteriophage2MJZ XX
19784Solution structure of the G-triplex truncated-TBA2MKM X
19853AFB1 FAPY modified AGA duplex2MMF X
19861AFB1 FAPY modified AGT duplex2MMQ X
19862E isomer of AFB1 FAPY modified AGC duplex2MMR X
19863AFB1 FAPY modified AG(7-deaza)G duplex2MMS X
19886MINOR GROOVE RECOGNITION OF DNA BY THIAZOTROPSIN ANALOGUES2MNB X
19888MINOR GROOVE RECOGNITION OF DNA BY THIAZOTROPSIN ANALOGUES2MND X
19889MINOR GROOVE RECOGNITION OF DNA BY THIAZOTROPSIN ANALOGUES2MNE X
19890MINOR GROOVE RECOGNITION OF DNA BY THIAZOTROPSIN ANALOGUES2MNF X
19912MAJOR GROOVE ORIENTATION OF THE (2S)-N6-(2-HYDROXY-3-BUTEN-1-YL)-2'-DEOXYADENOSINE DNA ADDUCT INDUCED BY 1,2-EPOXY-3-BUTENE2MNX X
19917Solution NMR structure of DNA dodecamer containing the 5-hydroxycytosine2MO2 X
19925Solution NMR structure of DNA dodecamer with A:C mismatch2MO7 X
19939Solution structure of MBD4 methyl-cytosine binding domain bound to methylated DNA2MOE XX
19957Assignment of DNA-MC1 protein complex2NBJ XX
25092truncated EcMazE-DNA complex2MRU XX
25099Dimeric structure of the Human A-box2MRZ X
25107Human Telomeric G-quadruplex DNA sequence (TTAGGGT)4 complexed with Flavonoid Quercetin2MS6 X
25110Solution structure of a left-handed G-quadruplex2MS9 X
25378A structure of G-quadruplex2MWZ X
25407Structure of the DNA complex of the C-Terminal domain of MvaT2MXF XX
25528Solution Structure of DNA Dodecamer with 8-oxoguanine at 4th Position5IV1 X
25531N2-dG-IQ modified DNA at the G1 position of the NarI recognition sequence2N0Q X
25582structure of a protein2N21 XX
25596Structure of DNA G-quadruplex adopted by ALS and FTD related GGGGCC repeat with G21 to Br-G21 substitution2N2D X
25651Isolation and structural characterization of an active G-quadruplex motif from AGRO1002N3M X
25672Base-displaced intercalated structure of the N-(2'deoxyguanosin-8-yl)-3-aminobenzanthrone DNA adduct2N4M X
25686Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome2N4Y X
25723Universal Base oligonucleotide structure2N5O X
25724Universal base control oligonucleotide structure2N5P X
25746G-quadruplex structure2N60 X
25759Solution structure for quercetin complexed with c-myc G-quadruplex DNA2N6C X
25840Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC at acidic pH2N89 X
25882Structural basis for DNA cleavage by the potent antiproliferative agent (-)-lomaiviticin A2N96 X
258881H, 13C and 15N chemical shift assignments and solution structure for PARP-1 F1F2 domains in complex with a DNA single-strand break2N8A XX
25903Glucose as non natural nucleobase2N9F X
25906Glucose as a nuclease mimic in DNA2N9H X
25915Photoswitchable G-quadruplex2N9Q X
27144DNA with compounds5W77 X
271731H, 13C, and 15N resonance assignments of a 22mer G-quadruplex forming within KRAS oncogene promoter region at physiological temperature6T51 X
27652NZ1186IMS X
30012NMR structure of a new G-quadruplex forming sequence within the KRAS proto-oncogene promoter region5I2V X
30015DNA duplex containing a ribonolactone lesion5HQF X
30016DNA duplex containing a ribonolactone lesion5HQQ X
30038Solution Structure of DNA Dodecamer with 8-oxoguanine at 4th Position5IV1 X
30044Solution Structure of DNA Dodecamer with 8-oxoguanine at 10th Position5IZP X
30045DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium5J05 X
30052NMR solution structure of [Rp, Rp]-PT dsDNA5J3F X
30053Solution NMR structure of PT-free dsDNA from Streptomyces lividans5J3G X
30054NMR solution structure of [Sp, Sp]-PT dsDNA5J3I X
30055DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTTGG) in sodium5J4P X
30056DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTGG) in sodium5J4W X
30058DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium5J6U X
30105Structural impact of single ribonucleotides in DNA5KGV XX
30111Structural impact of single ribonucleotides in DNA5KI4 X
30112Structural impact of single ribonucleotides in DNA5KI5 X
30113Structural impact of single ribonucleotides in DNA5KI7 XX
30114Structural impact of single ribonucleotides in DNA5KIB XX
30115Structural impact of single ribonucleotides in DNA5KIE XX
30116Structural impact of single ribonucleotides in DNA5KIF XX
30117Structural impact of single ribonucleotides in DNA5KIH XX
30148Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd Position5L06 X
30151Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 9th Position5L2G X
30191Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd Position and 9th position6ALT X
30198Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd Position and 9th position5TRN X
30250Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd position and 8-oxoguanine at the 10th position5UZ1 X
30251Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd and 9th position and 8-oxoguanine at the 10th position5UZ2 X
30252Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 9th position and 8-oxoguanine at the 10th position5UZ3 X
30253Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A2-DNA structure5UZD X
30254Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A6-DNA structure5UZF X
30255Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A6-DNAm1A16 structure5UZI X
30328Solution structure of a DNA dodecamer with 5-methylcytosine at the 3rd and 9th position and 8-oxoguanine at the 4th position6ALS X
30329Solution structure of a DNA dodecamer with 5-methylcytosine at the 3rd and 8-oxoguanine at the 4th position6ALU X
30335NMR and Restrained Molecular Dynamics Determination of the Structure of an Aza-Benzimidazole Derivative Complex with the DNA Minor Groove of an -AAGATA- Sequence6ASF X
30336NMR and Restrained Molecular Dynamics Determination of the Structure of an Aza-Benzimidazole Derivative Complex with the DNA Minor Groove of an -AAGATA Sequence6AST X
30402Hybrid-2 form Human Telomeric G Quadruplex in Complex with Epiberberine6CCW X
30473NMR structure for Sp1 transcription factor duplex 5'-d(GGGGCGGGG)6DM7 X
30484NMR structure for Sp1 transcription factor duplex 5'-d(GGGGCGGGA)6DVT X
30485NMR structure for Sp1 transcription factor duplex 5'-d(TGGGCGGGG)6DXM X
30506NMR structure for Sp1 transcription factor duplex 5'-d(TGGGCGGGA)6ED9 X
30552MYC Promoter G-Quadruplex with 1:6:1 loop length6NEB X
30577NMR structure of the 2:1 complex of a carbazole derivative BMVC bound to c-MYC G-quadruplex6O2L X
30688Molecular Recognition of Guanine Metabolites and Drugs by Vacancy-Bearing G-Quadruplex in the PDGFR-b Promoter6V0L X
30759Structure of a Stable Interstrand DNA Crosslink Involving an dA Amino Group and an Abasic Site6XAH X
30803Solution structure of the major MYC promoter G-quadruplex with a wild-type flanking sequence7KBV X
30804Solution structure of the major MYC promoter G-quadruplex with a wild-type flanking in complex with NSC85697, a quinoline derivative7KBW X
30805Solution structure of the major MYC promoter G-quadruplex in complex with NSC85697, a quinoline derivative7KBX X
30822Deoxyuridine in DNA Structure: Solution Structure of [d(CGUGAATTCGCG)]27KWL X
308231,N6-ethenoadnine (E) in dsDNA sequence (5'-CGCGEATTCGCG-3')7KWR X
30907Solution Structure of Berberine Bound to a dGMP Fill-in G-Quadruplex in the PDGFR-b Promoter7MSV X
30923Solution structure of the MYC promoter G-quadruplex in complex with berberine: conformer A7N7D X
30924Solution structure of the MYC promoter G-quadruplex in complex with berberine: conformer B7N7E X
30940Hairpin near 3'-Splice Site of Influenza A Segment 7 Bound to 5-nt Oligonucleotide7RQ5 XX
34025G-Quadruplex formed at the 5'-end of NHEIII_1 Element in human c-MYC promoter bound to triangulenium based fluorescence probe DAOTA-M25LIG X
34034A two-quartet G-quadruplex formed by human telomere in KCl solution at neutral pH5LQG X
34035A two-quartet G-quadruplex formed by human telomere in KCl solution at pH 5.05LQH X
34051Structure of DNA AGCGA-quadruplex adopted by 15-mer d(GCGAGGGAGCGAGGG), VK34, oligonucleotide found in regulatory region of the PLEKHG3 human gene5M1L X
34053Structure of a stable G-hairpin5M1W X
34054Structure of DNA tetrameric AGCGA-quadruplex adopted by 15-mer d(GCGAGGGAGCGAGGG), VK34, oligonucleotide found in regulatory region of the PLEKHG3 human gene5M2L X
34056Structure of DNA AGCGA-quadruplex adopted by 15-mer oligonucleotide found in regulatory region of the PLEKHG3 human gene with G11 to I11 mutation, d(GCGAGGGAGCIAGGG),VK34_I115M4W X
34062Quadruplex with flipped tetrad formed by a human telomeric sequence5MBR X
34063Quadruplex with flipped tetrad formed by an artificial sequence5MCR X
340712'F-ANA/DNA Chimeric TBA Quadruplex structure5MJX X
34083G-quadruplex formed within promoters of Plasmodium falciparum B var genes5MTA X
34084G-quadruplex formed within promoters of Plasmodium falciparum B var genes - form I5MTG X
34086Solution structure of a human G-Quadruplex hybrid-2 form in complex with a Gold-ligand5MVB X
34118An i-motif containing the neutral cytidine protonated analogue pseudoisocytidine5NIP X
34135M2 G-quadruplex dilute solution5NYS X
34136M2 G-quadruplex 20 wt% ethylene glycol5NYT X
34137M2 G-quadruplex 10 wt% PEG80005NYU X
34145G-quadruplex of Human papillomavirus type 525O4D X
34157NtMe polyamide in complex with 5'CGATGTACATCG3'- hairpin polyamides studies5ODF X
34158NtiPr polyamide in complex with 5'CGATGTACTACG35ODM X
34159Im polyamide in complex with 5'CGATGTACATCG3'- hairpin polyamides studies5OE1 X
34162Structure of minimal i-motif domain5OGA X
34168G-quadruplex structure of DNA oligonucleotide containing GGGGCC repeats linked to ALS and FTD5OPH X
34172NMR structure of the complex formed by an engineered region 2 of sigmaE in complex with GTAAAA5OR5 XX
341742'F-ANA-G modified quadruplex with a flipped tetrad5OV2 X
34186Quadruplex with flipped tetrad formed by the c-myc promoter sequence6ERL X
342102'F-araG modified quadruplex with flipped G-tract and central tetrad6F4Z X
34221The 1,8-bis(aminomethyl)anthracene and Quadruplex-duplex junction complex6FC9 X
34244Concerted dynamics of metallo-base pairs in an A/B-form helical transition (major species)6FY6 X
34245Concerted dynamics of metallo-base pairs in an A/B-form helical transition (minor species)6FY7 X
34269Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure6GH0 X
34276Tc-DNA/RNA duplex6GMY XX
34277tc-DNA/tc-DNA duplex6GN4 X
34280Tc-DNA/DNA duplex6GPI X
34290Hybrid structure of the pRN1 helix bundle domain in complex with DNA and 2 ATP molecules6GVT 6GVQ XX
34291NMR structure of the DNA-bound helix bundle domain from the functional pRN1 primase6GVU XX
34296Polyamide - DNA complex NMR structure6GZ7 X
34297Adenine-driven structural switch from two- to three-quartet DNA G-quadruplex6GZN X
34302The major G-quadruplex form of HIV-1 LTR6H1K X
34328Dodecamer DNA containing the synthetic base pair P-Z6I4O X
34331Human telomeric G-quadruplex with 8-oxo-G substitution in the central G-quartet6IA0 X
34332Human telomeric G-quadruplex with 8-oxo-G substitution in the outer G-quartet6IA4 X
34353TINA-conjugated antiparallel DNA triplex6QHI X
34378Structure of kiteplatinated dsDNA6R14 X
34386SC14 G-hairpin6R8E X
34389A quadruplex hybrid structure with lpp loop orientation and 3 syn residues6R9K X
34390A quadruplex hybrid structure with lpp loop orientation and 5 syn residues6R9L X
34397Imidazole Polyamide-DNA complex NMR structure (5'-CGATGTACATCG-3')6RIO X
34398Concerted dynamics of metallo-base pairs in an A/B-form helical transition (apo species)6RLS X
344032'-F-riboguanosine modified G-quadruplex with V-loop6RS3 X
34431NMR structure of KRAS32R G9T conformer G-quadruplex within KRAS promoter region6SUU X
34435Intercalation of heterocyclic ligand between quartets in G-rich tetrahelical structure6SX3 X
34436Guanine-rich oligonucleotide with 5'-GC end form G-quadruplex with A(GGGG)A hexad, GCGC- and G-quartets and two symmetric GG and AA base pairs6SX6 X
34438Guanine-rich oligonucleotide with 5'- and 3'-GC ends form G-quadruplex with A(GGGG)A hexad, GCGC- and G-quartets and two symmetric GG and AA base pair6SYK X
34441NMR structure of KRAS32R G25T conformer G-quadruplex within KRAS promoter region6T2G X
344442'-F-arabinoguanosine and 2'-F-riboguanosine modified hybrid type G-quadruplex with V-loop6TC8 X
344452'-F-riboguanosine and 2'-F-arabinoguanosine modified G-quadruplex with V-loop and all-syn G-tract6TCG X
34467Pre-folded structures govern folding pathways of human telomeric G-quadruplexes6TR2 X
344992'-F-riboguanosine and LNA modified hybrid type G-quadruplex with V-loop6YCV X
34502LNA modified G-quadruplex with flipped G-tract and central tetrad6YEP X
34516Parallel 17-mer DNA G-quadruplex6YY4 X
34524Structure of a parallel c-Myc modified with 3' duplex stem-loop overhang6ZL2 X
34525Structure of a parallel c-Myc modified with 5' duplex stem-loop overhang6ZL9 X
34529G-quadruplex with a G-A bulge6ZRM X
34533Structure of a parallel c-myc modified with 5' duplex stem-loop and 3' diagonal snap-back loop6ZTE X
34542Antiparallel basket-type G-quadruplex DNA structure formed in human Bcl-2 promoter containing 8-oxoG6ZX6 X
34543Antiparallel basket-type G-quadruplex DNA structure formed in human Bcl-2 promoter6ZX7 X
34565NMR structure of a DNA G-quadruplex containing two SP1 binding sites from HIV-1 promoter7ALU X
34571G-quadruplex with V-shaped loop from the first repeat of KCNN4 minisatellite7ATZ X
34579Synthetic DNA duplex dodecamer7B4Z X
34580Single modified phosphoryl guanidine DNA duplex, Sp diastereomer7B71 X
34581DNA duplex with phosphoryl guanidine moiety, Rp-diastereomer7B72 X
34587deoxyxylose nucleic acid hairpin7BFS X
34588deoxyxylose nucleic acid hairpin7BFX X
34590GA repetition with i-motif clip at 5'-end7BI0 X
34591GA attached to an i-motif clip at 3'-end7BL0 X
34592AG repetition attached to a compact i-motif clip at 3'-end7BLM X
34593AG repetition attached to an extended i-motif clip at 3'-end7BMA X
34594Solution structure of DNA duplex containing a 2'-deoxy-2'2'-difluorodeoxycytidine (gemcitabine) modification7NBK X
34595Solution structure of DNA:RNA hybrid containing a 2'-deoxy-2'2'-difluorodeoxycytidine (gemcitabine) modification7NBL XX
34596Solution structure of DNA duplex containing a 7,8-dihydro-8-oxo-1,N6-ethenoadenine base modification that induces exclusively A->T transversions in Escherichia coli7NBP X
34599Solution structure of DNA:RNA hybrid duplex7NEJ XX
34611Three-quartet c-kit2 G-quadruplex stabilized by a pyrene conjugate7NWD X
34615Hybrid-2R quadruplex-duplex with (-p-p-l) topology and 3 syn residues7O1H X
34616The structure of an i-motif/duplex junction at neutral pH7O5E X
34623A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine7OGV X
34624A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine7OHE X
34625A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine7OHJ X
34626A self-complementary DNA dodecamer duplex contaning 5-hydroxymethylcitosine7OHM X
34631G-quadruplex structure of the C. elegans telomeric repeat: A two tetrads basket type conformation stabilised by a Hoogsteen C-T base-pair7OQT X
34654Pre-catalytic complex of 10-23 DNAzyme with RNA target7PDU XX
34664Parallel Q-D hybrid with 3' duplex stem-loop as a lateral snapback loop7PNE X
34665Solution structure of 1:1 complex of an indoloquinoline derivative SYUIQ-5 to parallel quadruplex-duplex (Q-D) hybrid7PNG X
3467910bp DNA/DNA duplex7QA9 X
34685Solution structure of a lanthanide-binding DNA aptamer7QB3 X
34714Phen-DC3 intercalation causes hybrid-to-antiparallel transformation of human telomeric DNA G-quadruplex7Z9L X
34721Structure of a hybrid-type G-quadruplex with a snapback loop (hybrid 1R')7ZEK X
34722Structure of a parallel G-quadruplex with a snapback loop7ZEM X
34723Structure of a hybrid-type G-quadruplex with a snapback loop and an all-syn G-column (hybrid-1R)7ZEO X
34735Dimeric i-motif from 2'Farabinocytidine-modified TC57ZYX X
34740Solution structure of Phen-DC3 intercalating into a quadruplex-duplex hybrid8ABD X
34741Solution structure of a phenyl-indoloquinoline intercalating into a quadruplex-duplex hybrid8ABN X
34768Hairpin adopted by modified oligonucleotide A32_mod found in the promoter of AUTS2 gene.8BM4 X
34769Hairpin of adopted by oligonucleotide A36 found in the promoter of AUTS2 gene.8BM6 X
34770Hairpin adopted by oligonucleotide A38 found in the promoter of AUTS2 gene.8BM7 X
34772An i-motif domain able to undergo pH-dependent conformational transitions (acidic structure)8BQY X
34774An i-motif domain able to undergo pH-dependent conformational transitions (neutral structure)8BV6 X
34780Tetra-stranded double-ion dependent DNA (diDNA) NMR structure of telomeric C.elegans fragment8BZU X
34798Structure of an i-motif domain with the cytosine analog 1,3-diaza-2-oxophenoxacione (tC) at neutral pH8OFC X
34805Solution structure of the 8-17 DNAzyme in presence of Zn2+8OR8 X
34832Three-layered parallel G-quadruplex with snapback loop from a G-rich sequence with five G-runs8PSB X
34833Three-layered basket-type G-quadruplex from a G-rich sequence with five G-runs8PSC X
34834(3+1) hybrid G-quadruplex from a G-rich sequence with five G-runs8PSE X
34835G-quadruplex with a 1-nt V-shaped loop from a G-rich sequence with five G-runs8PSI X
34836TINA-conjugated antiparallel DNA triplex8PWR X
34845d(ATTTC)3 dimeric structure8Q5Q X
34856Formation of left-handed helices by C2'-fluorinated nucleic acids under physiological salt conditions8QDU X
34858Formation of left-handed helices by C2'-fluorinated nucleic acids under physiological salt conditions8QE4 X
34863Solution structure of a bimolecular quadruplex-duplex hybrid containing a V-shaped loop8QKX X
34867Formation of left-handed helices by C2'-fluorinated nucleic acids under physiological salt conditions8QOR X
34874Solution structure and chemical shift assignments for HMG-D Y12F mutant complexed to a 14:12 dA2 bulge DNA8R1X XX
34876Hybrid-1R G-quadruplex with a +(lpp) loop progression8R4E X
34877(3+1) hybrid-2 G-quadruplex with a -(llp) loop progression8R4W X
34880A quadruplex-duplex hybrid with a three-layered hybrid-2 G-quadruplex topology8R6D X
34881A quadruplex-duplex hybrid with a three-layered chair G-quadruplex topology8R6G X
34882A quadruplex-duplex hybrid with a three-layered hybrid-2 G-quadruplex topology complexed with Phen-DC38R6H X
34895Structure of a chair-type antiparallel quadruplex-duplex hybrid at pH 68RW2 X
34898Solution structure of a parallel stranded G-quadruplex formed in ORAI1 promoter8RZX X
34900Structure of a quadruplex-duplex hybrid with a (-pd+l) loop progression8S1W X
34914Single acyclic phosphonate nucleotide (S)-ZNA modification on DNA hairpin9F3D X
34915Single acyclic phosphonate nucleotide (R)-ZNA modification on DNA duplex9F3E X
34942Solution structure of a silver ion mediated DNA duplex with universal 7-deazapurine substitutions9GDM X
36001Structure model of a protein-DNA complex5B7J XX
36020Structure of two CCTG repeats5GWL X
36022Structure of two TTTA repeats5GWQ X
36116The structure of a chair-type G-quadruplex of the human telomeric variant in K+ solution5YEY X
36159Solution structure for the 1:1 complex of a platinum(II)-based tripod bound to a hybrid-1 human telomeric G-quadruplex5Z80 X
36160Solution structure for the unique dimeric 4:2 complex of a platinum(II)-based tripod bound to a hybrid-1 human telomeric G-quadruplex5Z8F X
36168Solution structure of G-quadruplex formed in vegfr-2 proximal promoter sequence5ZEV X
36174SOLUTION NMR STRUCTURE OF A 14-MER DOUBLE STRANDED DNA DUPLEX CGCGAAATTTCGCG5ZLD X
36186Solution Structure of the DNA complex of the C-terminal Domain of Rok5ZUX XX
36326NMR solution structure of a DNA minidumbbell containing an abasic bulge between two CCTG repeats6M6K X
36378NMR solution structures of the DNA minidumbbell formed by 5'-mCTTGXmCTTG-3'7D0X X
36379NMR solution structures of the DNA minidumbbell formed by two CmCTG repeats at pH 57D0Y X
36380NMR solution structures of the DNA minidumbbell formed by two CCTG repeats at pH 57D0Z X
36404Solution structure of the C-clamp domain from human HDBP1 in complex with DNA7DTA XX
36411Aptamer enhancing peroxidase activity of myoglobin7E5P X