Biological Magnetic Resonance Data Bank

A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Query Grid

Select desired data type(s) and optionally limit polymer type(s). You can select multiple values by holding the "control" key (Windows, Linux) or "option" key (MacOS) while clicking. All data type selections are applied using a logical AND operator. Polymer selection join type can be selected. Click a column header to sort by that column.


Number of entries returned: 353

Download all matching entries in NMR-STAR as a compressed file or download the results displayed on this page in CSV format.

BMRB IDSystem NamePDB structureProteinDNARNAOther
4141vnd/NK-2 homeodomain DNA complex1NK2 XX
4172Rev-erb beta response element1BN9 X
4176DNA dodecamer1BJD X
4187Sigma-K RNA Polymerase Promoter Consensus Sequence1SKP X
4235DNA decamer1BWT X
4243DNA (5'-D(TCCCGTTTCCA)-3')1C11 X
4244alphaT decamer duplex1BX5 X
4248Lymphoid enhancer-binding factor2LEF XX
4372apt1C32 1C34 X
4392DNA minor groove binder1B0S 1CYZ X
4400H-y5 Triple Helix1B4Y X
4409DNA (5'-D(*CP*GP*CP*AP*(HYD)TP*+TP*AP*CP*GP*C)- 3')1QKG X
4412DNA (5'-D(*CP*GP*CP*AP*TP*+TP*AP*CP*GP*C)- 3')1QL5 X
4415DNA dodecamer duplex1TTD X
4416Cis-syn thymine cyclobutane dimer1COC X
4488DNA decamer1CFL X
45505'-D(*GP*CP*GP*TP*TP*AP*AP*CP*GP*C)-3'1CQO X
4609T-tetrad telomere repeats1EMQ X
46105'-D(*AP*GP*GP*GP*T)-3'1EVM X
46125'-D(*TP*GP*GP*GP*CP*GP*GP*T)-3'1EVO X
4647HPRT Gene Mutation Hotspot with a BPDE2(10R) Adduct1FYY X
51645'-D(P*CP*CP*AP*TP*AP*AP*TP*TP*TP*AP*CP*C)-3' duplex1JUU X
5167AT-Rich DNA with the GAA-Hairpin Loop1JVE X
5232Cdc13 DNA-binding domain /telomeric ssDNA complex1KXL XX
52455'-D(*TP*GP*TP*TP*TP*GP*GP*C)-3'1K1R X
52525'-D(*CP*CP*AP*CP*GP*CP*GP*TP*GP*G)-3'1KKV X
52535'-D(*CP*CP*AP*TP*GP*CP*GP*TP*GP*G)-3'1KKW X
52825'-D(*GP*CP*GP*AP*AP*GP*C)-3'1KR8 1PQT X
53395'-D(*CP*GP*TP*AP*CP*G)-3'1K2K X
5349Extended PBX Homeodomain-DNA complex1LFU XX
5363hERR2-DNA complex1LO1 XX
5370beta alanine linked polyamide bound to purine tract DNA1LEJ X
53858oxoG:G mismatch1N2W X
5517B-MybR2R31A5J XX
5714Synthetic DNA duplex with an AG mismatch1ONM X
5716CK14 DNA 14-MER DUPLEX1K8J 1K8N 1K8L X
5730Benzo[a]Pyrene Adducted Adenine in a DNA duplex1N8C X
57375'-D(*TP*TP*AP*GP*GP*GP*T)-3'1NP9 X
57395'-D(*AP*CP*AP*TP*CP*XP*AP*TP*CP*T)-3'1N1N X
57755'-R(*AP*AP*AP*GP*GP*AP*GP*GP*A)-3'/5'-D(*CP*CP*UP*CP*CP*UP*U)-3'1NTQ XX
5781Propynyl DNA.RNA hybrid1OO7 XX
5791Lactose operon repressor1OSL XX
5979DNA1R2L X
6009Thrombin-binding DNA aptamer1RDE X
61865'-D(P*TP*GP*AP*TP*CP*A)-3'1SY8 X
63075'-D(*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*G)-3'1U64 X
6975Bcl2MidG4Pu23-G15T G16T2F8U X
7097brinker CG9653-PA/DNA Complex2GLO XX
110455'-D(*DTP*DAP*DCP*DG)-3' 10 structures2RPD XX
110465'-D(*DTP*DAP*DCP*DG)-3' 10 structures2RPE XX
110485'-D(*DTP*DAP*DCP*DG)-3' 10 structures2RPH XX
11437Propylene-DNA2RRQ X
11438Protein2RRR X
15533wt1-zf14-14mer2JPA XX
156135'-D(*(DA)P*(DA)P*(DT)P*(DC)P*(DT)P*(DT)P*(DT)P*(DA)P*(DA)P*(DA)P*(DG)P*(DA)P*(DT)P*(DT))-3'2K4L X
158605'-D(*DTP*DTP*DAP*DAP*DTP*DTP*DTP*(D33)*(D33)*(D33)*DAP*DAP*DAP*DTP*DTP*DAP*DA)-3'2K67 2K68 2K69 X
160545'-D(TP*CP*GP*TP*TP*GP*CP*T)-3'2K90 X
160555'-D(P*TP*CP*GP*TP*TP*GP*CP*T)-3'2K97 X
1613834-MER, SILVER ION2M54 X
162125'-D(TP*CP*GP*TP*TP*GP*CP*T)-3'2K8Z X
162235'-D(*DCP*DTP*(FAG)P*DA)-3'2KH4 X
16449XPF DNA complex2KN7 XX
16577Homeodomain DNA complex2LD5 XX
16812MED1:DNA complex2KAE XX
16936MBD2 bound to a methylated DNA2KY8 XX
17229ZNF DNA2L45 XX
17397RET oncogene2L88 X
17409triazole-linked DNA duplex2L8I X
17422Cidofovir DNA duplex2L8P X
17423Control DNA duplex2L8Q X
17535DNA/RNA hybrid2LAR XX
17562N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenal2LBI X
17580Myc G-quadruplex2LBY X
17655Human Telomeric DNA2LD8 X
17697G-quadruplex2LE6 X
17708N-myc2LED X
17709N-myc2LEE X
17729C-Terminal domain of Ler2LEV XX
17732Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA2LEX XX
17746(5'S)-8,5'-Cyclo-2'-deoxyguanosine in DNA2LFA X
17786(5'S)-8,5'-cyclo-2'-deoxyguanosine2LFX X
17787(5'S)-8,5'-cyclo-2'-deoxyguanosine2LFY X
17789(5'S)-8,5'-cyclo-2'-deoxyadenosine2LG0 X
17790(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct2LG2 X
17791(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct2LG3 X
17814DNA Containing an Aristolactam II-dA Lesion2LGM X
17859DNA duplex Containing an Unnatural, Hydrophobic Base Pair2LHO X
17885DNA dodecamer2LIA X
17887alpha anomeric lesion2LIB X
17980G-quadruplexes2LK7 X
18040DNA 12LL9 X
18050DNA 12LLJ X
18199DNA 12LO5 2LO8 2LOA X
18209DNA molecule G3ATG3ACACAG4ACG32LOD X
18279human CEB25 minisatellite G-quadruplex2LPW X
184272'F-ANA and ANA self-complementary duplex2LSC X
18430Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine2LSF X
18452Synthetic cyclic oligonucleotide2LSX XX
1845311 mer oligonucleotide-B2LSZ X
1845411 mer oligonucleotide-B2LT0 X
18462Kaiso2LT7 XX
18496YdbC:dT19G1 complex2LTT XX
18625Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'2LWG X
18626Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin2LWH X
1863811 mer oligonucleotide-B2LWM X
18639Duplex DNA Containing a b-Carba-Fapy-dG Lesion2LWN X
18640Duplex DNA Containing a b-Carba-Fapy-dG Lesion2LWO X
18724G-quadruplex DNA2LYG X
18762N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene2LZK X
18780DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link2LZV X
18781DNA2LZW X
18835dodecamer duplex2M11 X
18862Parallel human telomeric quadruplex containing 2'F-ANA substitutions2M1G X
18881d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid2M1V XX
18902major G-quadruplex2M27 X
18907Duplex DNA2M2C X
18935African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNA2M2V 2M2W XX
18973DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion2M3P X
18979DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer2M3Y X
18981DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion2M40 X
18984DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer2M43 X
18985DNA 12M44 X
19017Bulges in G-quadruplexes2M4P X
19035G-rich VEGF aptamer with LNA modifications2M53 X
19276d[CGCGAAGCATTCGCG] hairpin2M8Y X
19277d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid2M8Z X
19278d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid2M90 X
19279d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid2M91 X
19280d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid2M92 X
19281d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid2M93 X
19367complex formed by the region 2 of E. coli sigmaE and its cognate -10 non template element TGTCAAA2MAP XX
19375N2-dG IQ at G3 in NarI sequence2MAV X
19386parallel-stranded G-quadruplex in DNA poly-G stretches2MB2 X
19387intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative2MB3 X
19389stacked dimeric G-quadruplex2MB4 X
19391MBD32MB7 XX
19402antiparallel (2+2) G-quadruplex2MBJ X
19435Complex between DNA quadruplex (human telomere) and DD-bisRuthenium ligand2MCC X
19440N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNA2MCI X
19441spermine modified DNA duplex2MCJ X
19448dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence2MCO X
19511homeodomain transcription factor Gbx12ME0 XX
19540MyT1 F4F5 - DNA complex2MF8 XX
19592Molecular Binding of TFF1 Estrogen Response Element2MG8 X
19594G-quadruplex bound to the bisquinolinium compound Phen-DC32MGN X
19620DNA duplex containing N3T-ethylene-N1I2MH6 X
19653RRM domain from C. elegans SUP-12 + GGTGTGC DNA4CH1 XX
19659RHB Modified duplex2MHX X
19661SHB modified duplex2MHZ X
19695N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA2MIV X
19696N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA2MIW X
19728A tetrahelical DNA fold adopted by alternating GGG and GCG tracts2MJJ X
19745DNA (28-MER)2MJX X
19747M13 bacteriophage2MJZ XX
19784G-triplex truncated-TBA2MKM X
19853AGA modified2MMF X
19861AGT FAPY Modified duplex2MMQ X
19862AGC FAPY modified duplex Major isomer2MMR X
19863AG(7-deaza)G FAPY modified duplex2MMS X
19889CGACTAGTCG with AIK-18/51-12MNE X
19912DNA duplex2MNX X
19917DNA dodecamer containing the 5-hydroxycytosine2MO2 X
19925DNA dodecamer with A:C mismatch2MO7 X
19939MBD4 methyl-cytosine binding domain bound to methylated DNA2MOE XX
25092MazE-DNA binding2MRU XX
25099Hs2 dimer2MRZ X
25107DNA-quercetin2MS6 X
25110left-handed G-quadruplex2MS9 X
25378A G-quadruplex structure2MWZ X
25407DNA complex of the C-Terminal domain of MvaT2MXF XX
25528DNA Dodecamer with 8-oxoguanine at 4th Position5IV1 X
25531N2-dG IQ at G1 in NarI sequence2N0Q X
25582Protein and DNA complex2N21 XX
25596G-quadruplex2N2D X
25651active G-quadruplex motif from AGRO1002N3M X
25672N-(2'deoxyguanosin-8-yl)-3-aminobenzanthrone DNA adduct2N4M X
25686G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome2N4Y X
25723Universal Base oligonucleotide with UB at point 52N5O X
25724Control DNA oligonucleotide for the universal base2N5P X
25746DNA G-quadruplex2N60 X
25759Quercetin complexed with c-myc G-quadruplex DNA2N6C X
25840Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC2N89 X
25882dsDNA-lomaiviticin A complex2N96 X
25888F1F2-DNA complex2N8A XX
25903Glucose in a DNA double helix2N9F X
25906Glucose as a nuclease mimic in DNA2N9H X
25915Photoswitchable G-quadruplex2N9Q X
27144c-Myc Pu225W77 X
27173KRAS promoter region6T51 X
27652NZ118 tetramer6IMS X
30015DNA (5'-D(*CP*GP*CP*TP*CP*(RIB)P*CP*AP*CP*GP*C)-3'), DNA (5'-D(*GP*CP*GP*TP*GP*GP*GP*AP*(8OG)P*CP*G)-3')5HQF X
30016DNA (5'-D(*CP*GP*CP*TP*CP*(RIB)P*CP*AP*CP*GP*C)-3'), DNA (5'-D(*GP*CP*(8OG)P*TP*GP*GP*GP*AP*GP*CP*G)-3')5HQQ X
30038DNA5IV1 X
30044DNA Dodecamer with 8-oxoguanine at 10th Position5IZP X
30052DNA (5'-D(*CP*GP*(RSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(RSG)P*CP*CP*G)-3')5J3F X
30053DNA (5'-D(*CP*GP*GP*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*GP*CP*CP*G)-3')5J3G X
30054DNA (5'-D(*CP*GP*(SSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(SSG)P*CP*CP*G)-3')5J3I X
30058DNA (25-MER)5J6U X
30105DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')5KGV XX
30111DNA (5'-D(*AP*TP*CP*CP*GP*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')5KI4 X
30112DNA (5'-D(*TP*TP*AP*GP*GP*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')5KI5 X
30113DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')5KI7 XX
30114DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')5KIB XX
30115DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')5KIE XX
30116DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')5KIF XX
30117DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')5KIH XX
30148DNA (5'-D(*CP*GP*(5CM)P*GP*AP*AP*TP*TP*CP*GP*CP*G)-3')5L06 X
30151DNA (5'-D(*CP*GP*(5CM)P*GP*AP*AP*TP*TP*CP*GP*CP*G)-3')5L2G X
30191DNA Dodecamer with 5-methylcytosine6ALT X
30198DNA (5'-D(*CP*GP*CP*(8OG)P*AP*AP*TP*TP*(DMC)P*GP*CP*G)-3')5TRN X
30250DNA (5'-D(*CP*GP*(DMC)P*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')5UZ1 X
30251DNA (5'-D(*CP*GP*(DMC)P*GP*AP*AP*TP*TP*(DMC)P*(8OG)P*CP*G)-3')5UZ2 X
30252DNA (5'-D(*CP*GP*CP*(8OG)P*AP*AP*TP*TP*(DMC)P*GP*CP*G)-3')5UZ3 X
30328DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')6ALS X
30329DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')6ALU X
30335DNA (5'-D(*CP*CP*AP*AP*GP*AP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*TP*CP*TP*TP*GP*G)-3')6ASF X
30336DNA (5'-D(*CP*CP*AP*AP*GP*AP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*TP*CP*TP*TP*GP*G)-3')6AST X
30402DNA (26-MER)6CCW X
30473Sp1 transcription factor duplex 5'-d(GGGGCGGGG)6DM7 X
30484Sp1 transcription factor duplex 5'-d(GGGGCGGGA)6DVT X
30485Sp1 transcription factor duplex 5'-d(TGGGCGGGG)6DXM X
30506Sp1 transcription factor duplex 5'-d(TGGGCGGGA)6ED9 X
30552DNA (27-MER)6NEB X
34053DNA (5'-D(*GP*TP*GP*TP*GP*GP*GP*TP*GP*TP*G)-3')5M1W X
34062G-quadruplex formed by a human telomeric sequence modified with 2'-fluoro-2'-deoxyriboguanosine5MBR X
34063Artificial quadruplex with propeller, diagonal and lateral loop5MCR X
34083UpsB-Q-1, DNA (34-MER)5MTA X
34084UpsB-Q-1 DNA (34-MER)5MTG X
34086DNA (26-MER)5MVB X
34118DNA (5'-D(*TP*(DCP)P*CP*GP*TP*TP*TP*CP*(PSC)P*GP*T)-3')5NIP X
34145G-quadruplex of Human papillomavirus type 525O4D X
34159DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')5OE1 X
34172ECF RNA polymerase sigma-E factor,ECF RNA polymerase sigma factor SigW,ECF RNA polymerase sigma-E factor/DNA Complex5OR5 XX
34174artificial quadruplex with propeller, diagonal, and lateral loop5OV2 X
34186cmbr-4813176ERL X
34221DNA (27-MER)6FC9 X
34244DNA (5'-D(*CP*GP*TP*CP*TP*CP*AP*TP*GP*AP*TP*AP*CP*G)-3') major6FY6 X
34245DNA (5'-D(*CP*GP*TP*CP*TP*CP*AP*TP*GP*AP*TP*AP*CP*G)-3') minor6FY7 X
34276Tc-DNA/RNA duplex6GMY XX
34277tc-DNA/tc-DNA duplex6GN4 X
34280Tc-DNA/DNA duplex6GPI X
34290functional pRN1 primase/DNA Complex6GVT 6GVQ XX
34291functional pRN1 primase/DNA Complex6GVU XX
34296DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')6GZ7 X
34302DNA (28-MER)6H1K X
34328DNA (5'-*(DC5)P*GP*AP*TP*(P)P*TP*AP*(Z)P*AP*TP*CP*(DG3))-3')6I4O X
34331hTel-oxoG106IA0 X
34332hTel-oxoG216IA4 X
34353TINA-conjugated antiparallel DNA triplex6QHI X
34378Kiteplatinated DNA oligomer6R14 X
34389DNA (25-MER)6R9K X
34390DNA (25-MER)6R9L X
34397DNA (5'-(*(DC5)P*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*(DG3))-3')6RIO X
34403F14156RS3 X
34431KRAS32R G9T6SUU X
34435VK26SX3 X
34436GCn6SX6 X
34438GCnCG6SYK X
34441KRAS32R G25T6T2G X
34444F14156TC8 X
34445F14156TCG X
34467human telomeric G-quadruplexes6TR2 X
34524DNA (36-MER)6ZL2 X
34525DNA (35-MER)6ZL9 X
34533DNA (36-MER)6ZTE X
34579DNA (5'-D(*CP*AP*CP*GP*CP*CP*GP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*CP*GP*GP*CP*GP*TP*G)-3')7B4Z X
34580DNA (5'-D(*CP*AP*CP*GP*CP*CP*GP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*CP*GP*GP*CP*GP*(SGT)P*G)-3')7B71 X
34581DNA (5'-D(*CP*AP*CP*GP*CP*CP*GP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*CP*GP*GP*CP*GP*TP*G)-3')7B72 X
34588deoxyxylose nucleic acid hairpin7BFX X
36001Switch-activating protein 1/DNA Complex5B7J XX
36020DNA (5'-D(*CP*CP*TP*GP*CP*CP*TP*G)-3')5GWL X
36022DNA (5'-D(*TP*TP*TP*AP*TP*TP*TP*A)-3')5GWQ X
36159G-quadruplex DNA (26-MER)5Z80 X
36160G-quadruplex DNA (26-MER)5Z8F X
36186Rok/DNA Complex5ZUX XX