Biological Magnetic Resonance Data Bank

A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Query Grid

Select desired data type(s) and optionally limit polymer type(s). You can select multiple values by holding the "control" key (Windows, Linux) or "option" key (MacOS) while clicking. All data type selections are applied using a logical AND operator. Polymer selection join type can be selected. Click a column header to sort by that column.


Number of entries returned: 225

Download all matching entries in NMR-STAR as a compressed file or download the results displayed on this page in CSV format.

BMRB IDSystem NameIUPAC CS referencingProteinDNARNAOther
410314mer DNA duplex containing the operator sequence BS2XX
4104BS2 operator DNA complexed with the Antennapedia HomeodomainXXX
4141vnd/NK-2 homeodomain DNA complexXXX
4165Tn916 integrase DNA complexXXX
4248Lymphoid enhancer-binding factorXXX
4368A35T vnd/NK2 mutant homeodomainXXX
4392DNA minor groove binderXX
4400H-y5 Triple HelixXX
4576a3T3 hybridXX
5349Extended PBX Homeodomain-DNA complexXXX
5363hERR2-DNA complexXXX
5714Synthetic DNA duplex with an AG mismatchXX
5730Benzo[a]Pyrene Adducted Adenine in a DNA duplexXX
5781Propynyl DNA.RNA hybridXXX
5993DNA duplexXX
6276Metal-response element-binding transcription factor-1 complex with MRE DNAXXX
6353RFC p140 375-480 BRCT region : DNA complexXXX
6445Metal-response element-binding transcription factor-1 complex with MRE DNA (22bp)XXX
6605NMR ensemble Ada ProteinXXX
6877HPV-16 E2C-DNA complexXXX
6906Bicoid Homeodomain Bound to DNAXXX
6975Bcl2MidG4Pu23-G15T G16TXX
7097brinker CG9653-PA/DNA ComplexXXX
7105SRY.B in complex with 16-mer DNAXXX
7319polyermase beta in complex with substrate DNAXXX
110455'-D(*DTP*DAP*DCP*DG)-3' 10 structuresXXX
110465'-D(*DTP*DAP*DCP*DG)-3' 10 structuresXXX
110475'-D(*DTP*DAP*DCP*DG)-3' 10 structuresXXX
110485'-D(*DTP*DAP*DCP*DG)-3' 10 structuresXXX
15213IntCB-DNA complexXXX
15223AB G alphaXX
15224AB G betaXX
15228duplex DNA containing an abasic site with opposite T (beta anomer)XX
15238Ab C alphaXX
15239Ab C betaXX
162811:1 complexXX
162872:1 complexXX
162881:2 complexXX
162901:1 complexXX
162912:1 complexXX
162922:1 complexXX
16577Homeodomain DNA complexXXX
16812MED1:DNA complexXXX
17094DNA 1/berenil complexXX
17216PPBS/NCp7(12-55) exchangeXXX
17217SARS/dT10 complexXXX
17222operator/repressor complexXXX
17225CSD/ssDNA complexXXX
17339AREA/GATA complexXXX
17422Cidofovir DNA duplexXX
17423Control DNA duplexXX
17580Myc G-quadruplexXX
17592Anabaena Sensory Rhodopsin Transducer with DNAXXX
17655Human Telomeric DNAXX
17729C-Terminal domain of LerXXX
17732Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNAXXX
18209DNA molecule G3ATG3ACACAG4ACG3XX
184272'F-ANA and ANA self-complementary duplexXX
18452Synthetic cyclic oligonucleotideXXX
18496YdbC:dT19G1 complexXXX
1863811 mer oligonucleotide-BXX
18639Duplex DNA Containing a b-Carba-Fapy-dG LesionXX
18640Duplex DNA Containing a b-Carba-Fapy-dG LesionXX
18724G-quadruplex DNAXX
18762N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyreneXX
18780DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-linkXX
18862Parallel human telomeric quadruplex containing 2'F-ANA substitutionsXX
18881d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybridXXX
18907Duplex DNAXX
18935African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNAXXX
19017Bulges in G-quadruplexesXX
19035G-rich VEGF aptamer with LNA modificationsXX
19138ED ComplexXXX
19277d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybridXX
19279d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybridXX
19386parallel-stranded G-quadruplex in DNA poly-G stretchesXX
19389stacked dimeric G-quadruplexXX
19402antiparallel (2+2) G-quadruplexXX
19435Complex between DNA quadruplex (human telomere) and DD-bisRuthenium ligandXX
19448dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequenceXX
19511homeodomain transcription factor Gbx1XXX
19540MyT1 F4F5 - DNA complexXXX
19594G-quadruplex bound to the bisquinolinium compound Phen-DC3XX
19620DNA duplex containing N3T-ethylene-N1IXX
19695N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNAXX
19696N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNAXX
19745DNA (28-MER)XX
19853AGA modifiedXX
19861AGT FAPY Modified duplexXX
19862AGC FAPY modified duplex Major isomerXX
19863AG(7-deaza)G FAPY modified duplexXX
25092MazE-DNA bindingXXX
25099Hs2 dimerXX
25110left-handed G-quadruplexXX
25378A G-quadruplex structureXX
25582Protein and DNA complexXXX
25651active G-quadruplex motif from AGRO100XX
25686G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genomeXX
25746DNA G-quadruplexXX
25759Quercetin complexed with c-myc G-quadruplex DNAXX
25840Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dCXX
25903Glucose in a DNA double helixXX
25906Glucose as a nuclease mimic in DNAXX
25915Photoswitchable G-quadruplexXX
26731Paired domain of Pax5 in complex with DNAXXX
26808Egr-1 DNA complexXXX
27053KRAS oncogene promoter regionXX
27144c-Myc Pu22XX
27364Kaiso-MeCG2 complexXXX
27366KaisoE535Q-MeCG2 complexXXX
27367KaisoE535A-MeCG2 complexXXX
27368Kaiso-MeKBS complexXXX
27369KaisoE535Q-MeKBS complexXXX
27370KaisoE535A-MeKBS complexXXX
27371Kaiso-MeKBSsemi complexXXX
27372Kaiso-MeKBShemi complexXXX
27409DNA polymerase betaXXX
27410DNA polymerase beta ternary complexXXX
27560protein-gapped DNA complexXXX
27561protein-gapped DNA-nucelotide complexXXX
27652NZ118 tetramerXX
27958spin labled DNA duplexXX
28059CSD and ssDNA complexXXX
28081Trimolecular G-quadruplexXX
30052DNA (5'-D(*CP*GP*(RSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(RSG)P*CP*CP*G)-3')XX
30053DNA (5'-D(*CP*GP*GP*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*GP*CP*CP*G)-3')XX
30054DNA (5'-D(*CP*GP*(SSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(SSG)P*CP*CP*G)-3')XX
30058DNA (25-MER)XX
34053DNA (5'-D(*GP*TP*GP*TP*GP*GP*GP*TP*GP*TP*G)-3')XX
34083UpsB-Q-1, DNA (34-MER)XX
34084UpsB-Q-1 DNA (34-MER)XX
34086DNA (26-MER)XX
34118DNA (5'-D(*TP*(DCP)P*CP*GP*TP*TP*TP*CP*(PSC)P*GP*T)-3')XX
34145G-quadruplex of Human papillomavirus type 52XX
34221DNA (27-MER)XX
34276Tc-DNA/RNA duplexXXX
34277tc-DNA/tc-DNA duplexXX
34280Tc-DNA/DNA duplexXX
34302DNA (28-MER)XX
34353TINA-conjugated antiparallel DNA triplexXX
34467human telomeric G-quadruplexesXX
34588deoxyxylose nucleic acid hairpinXX
36020DNA (5'-D(*CP*CP*TP*GP*CP*CP*TP*G)-3')XX
36022DNA (5'-D(*TP*TP*TP*AP*TP*TP*TP*A)-3')XX
36159G-quadruplex DNA (26-MER)XX
36160G-quadruplex DNA (26-MER)XX
36186Rok/DNA ComplexXXX