BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Query Grid

Select desired data type(s) and optionally limit polymer type(s). You can select multiple values by holding the "control" key (Windows, Linux) or "option" key (MacOS) while clicking. All data type selections are applied using a logical AND operator. Polymer selection join type can be selected. Click a column header to sort by that column.

 

Number of entries returned: 471

Download all matching entries in NMR-STAR as a compressed file or download the results displayed on this page in CSV format.

BMRB IDSystem NameCarbon shiftsNitrogen shiftsPhosphorus shiftsHydrogen shiftsOther shiftsProteinDNARNAOther
410314mer DNA duplex containing the operator sequence BS21882202580X
4104BS2 operator DNA complexed with the Antennapedia Homeodomain1762302570XX
4141vnd/NK-2 homeodomain DNA complex291100189040XX
4165Tn916 integrase DNA complex2318006670XX
4170DNA-duplex-6GP0001310X
4172Rev-erb beta response element00282680X
4176DNA dodecamer0001230X
4187Sigma-K RNA Polymerase Promoter Consensus Sequence0002040X
4235DNA decamer009820X
4240Duplex DNA (5'-D(GP*GP*TP*CP*AP*CP*GP*AP*G)-3') (DOT)(5'-D(CP*TP*CP*GP*GP*GP*AP*CP*C)-3')0001090X
4243DNA (5'-D(TCCCGTTTCCA)-3')0010840X
4244alphaT decamer duplex009940X
42478mer chimeric hybrid RNA/RNA-DNA duplex with tRNA-DNA junction0001450XX
4248Lymphoid enhancer-binding factor3098808150XX
4256Mbp1(2-124)15611504190XX
4258MCB12T000940X
4359Pbx1 homeodomain71740740XX
4361chromomycin-DNA complex80071520XX
4362chromomycin-DNA complex96071600XX
4368A35T vnd/NK2 mutant homeodomain2657605490XX
4372apt0001170X
4392DNA minor groove binder000910X
4400H-y5 Triple Helix0002470X
4409DNA (5'-D(*CP*GP*CP*AP*(HYD)TP*+TP*AP*CP*GP*C)- 3')0001630X
4412DNA (5'-D(*CP*GP*CP*AP*TP*+TP*AP*CP*GP*C)- 3')0001690X
4415DNA dodecamer duplex00221930X
4416Cis-syn thymine cyclobutane dimer00221930X
4488DNA decamer0001650X
45365'-D(*AP*GP*GP*AP*TP*CP*CP*TP*UP*TP*TP*GP*GP*AP*TP*CP*CP*T)-3'0001970X
45425'-D(*AP*GP*GP*AP*TP*CP*CP*TP*TP*TP*UP*GP*GP*AP*TP*CP*CP*T)-3'0002060X
4547DNA/RNA00161680XX
45505'-D(*GP*CP*GP*TP*TP*AP*AP*CP*GP*C)-3'000830X
4555SRY-14mer duplex00262430X
4556SRY-8mer duplex00141370X
4576a3T3 hybrid0001040X
4609T-tetrad telomere repeats000590X
46105'-D(*AP*GP*GP*GP*T)-3'000290X
46125'-D(*TP*GP*GP*GP*CP*GP*GP*T)-3'000620X
4618DNA0001040X
4646DNA00171440X
4647HPRT Gene Mutation Hotspot with a BPDE2(10R) Adduct0001950X
4687cyclic oligonucleotide d000880X
4692TELOMERE FRAGMENT00212450X
4694cyclic oligonucleotide d000890X
4708WT1 zinc finger domain DNA complex22710801080XX
4710WT1 zinc finger domain222970970XX
4733bulge DNA 12/14mer0002030X
4734High mobility group protein of Drosophila complexed to a bulge DNA468004550XX
4746D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND COBALT80071270XX
4749DNA THREE-WAY JUNCTION0002820X
4753D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND ZINC96071350XX
4813LAC REPRESSOR HP62/DNA COMPLEX1696605950XX
48355'-D(*GP*CP*GP*TP*TP*AP*AP*CP*GP*C)-3'000820X
5032AFX in complex with DNA147750750XX
5134dAAUAA DNA Bulge: 5'-D(*GP*CP*AP*TP*CP*GP*AP*AP*UP*AP*AP*GP*CP*TP*AP*CP*G)-3'00272480X
5135dAATAA DNA Bulge: 5'-D(*GP*CP*AP*TP*CP*GP*AP*AP*TP*AP*AP*GP*CP*TP*AP*CP*G)-3'00262410X
51645'-D(P*CP*CP*AP*TP*AP*AP*TP*TP*TP*AP*CP*C)-3' duplex0002320X
5167AT-Rich DNA with the GAA-Hairpin Loop0002520X
5232Cdc13 DNA-binding domain /telomeric ssDNA complex823184012380XX
52435'-D(*CP*AP*CP*TP*AP*CP*TP*CP*TP*TP*TP*GP*TP*AP*GP*TP*G)-3'0003630X
52455'-D(*TP*GP*TP*TP*TP*GP*GP*C)-3'00131090X
52525'-D(*CP*CP*AP*CP*GP*CP*GP*TP*GP*G)-3'000820X
52535'-D(*CP*CP*AP*TP*GP*CP*GP*TP*GP*G)-3'000880X
52825'-D(*GP*CP*GP*AP*AP*GP*C)-3'3596680X
53395'-D(*CP*GP*TP*AP*CP*G)-3'000450X
5345LACTOSE OPERON REPRESSOR/DNA Complex458138012070XX
5349Extended PBX Homeodomain-DNA complex3178907780XX
5361TELOMERE REPEAT BINDING FACTOR 1/DNA Complex1866706550XX
5363hERR2-DNA complex3229808560XX
5370beta alanine linked polyamide bound to purine tract DNA0002170X
53858oxoG:G mismatch0001160X
5517B-MybR2R328910106250XX
5562CCGCGG000490X
5634SS17500920X
5635SS27400910X
5636SS37500920X
5637SS47400910X
5638SS57300900X
5639SS67400910X
5640SS77300900X
5641SS87400910X
5642SS97500920X
5643SS107400910X
5644SS117500920X
5645SS127400910X
5646SS137300900X
5647SS147400910X
5648SS157300900X
5649SS167400910X
5681CYCLIC OLIGONUCLEOTIDE D(CGCTCATT)008910X
5714Synthetic DNA duplex with an AG mismatch0002190X
5716CK14 DNA 14-MER DUPLEX0002000X
5717XBY6 DNA 14-MER DUPLEX0001000X
5718XBY2 DNA 14-MER DUPLEX0001980X
5730Benzo[a]Pyrene Adducted Adenine in a DNA duplex0002200X
57375'-D(*TP*TP*AP*GP*GP*GP*T)-3'000630X
57395'-D(*AP*CP*AP*TP*CP*XP*AP*TP*CP*T)-3'0001910X
57755'-R(*AP*AP*AP*GP*GP*AP*GP*GP*A)-3'/5'-D(*CP*CP*UP*CP*CP*UP*U)-3'0001470XX
5776sPrODN1:RNA0001520XX
5777PODN:RNA0001570XX
5781Propynyl DNA.RNA hybrid0001750XX
5791Lactose operon repressor1176905750XX
59275'-D(*CP*GP*CP*TP*AP*AP*CP*AP*GP*GP*C)-3'0001970X
5979DNA0002290X
5993DNA duplex0001180X
6009Thrombin-binding DNA aptamer00141620X
61865'-D(P*TP*GP*AP*TP*CP*A)-3'000470X
6273GTTCACAGAAC DNA hairpin00101010X
6274GTACACAGTAC DNA hairpin0001010X
6276Metal-response element-binding transcription factor-1 complex with MRE DNA45315801580XX
63075'-D(*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*G)-3'0001780X
6319nkx2.5 homeodomain plus NK2 specific domain in DNA bound state16913402550XX
6353RFC p140 375-480 BRCT region : DNA complex32111307480XX
6430HIV-1 integrase inhibitor, 93del00151480X
6445Metal-response element-binding transcription factor-1 complex with MRE DNA (22bp)49016501650XX
65375'-d(CTAACAGAATG)-3'/5'-d(CATTCAGTTAG)-3'/Naphthyridine-Azaquinolone1/Naphthyridine-Azaquinolone20001640X
6605NMR ensemble Ada Protein43814206930XX
6877HPV-16 E2C-DNA complex2457603430XX
6906Bicoid Homeodomain Bound to DNA3107604780XX
6975Bcl2MidG4Pu23-G15T G16T0001990X
7097brinker CG9653-PA/DNA Complex2557505820XX
7105SRY.B in complex with 16-mer DNA619163014930XX
7319polyermase beta in complex with substrate DNA77526802680XX
7354LAC REPRESSOR2487005580XX
7377CzrA36011402710XX
110455'-D(*DTP*DAP*DCP*DG)-3' 10 structures000370XX
110465'-D(*DTP*DAP*DCP*DG)-3' 10 structures000370XX
110475'-D(*DTP*DAP*DCP*DG)-3' 10 structures000370XX
110485'-D(*DTP*DAP*DCP*DG)-3' 10 structures000370XX
11437Propylene-DNA0002130X
11438Protein0002110X
11528METALLO-BASE-PAIRED DNA0002200X
11608DNA CONTAINING METALLO-BASE-PAIR0002440X
15026Nar1IQ3 Duplex0002040X
15027Nar1 Duplex0002030X
15033cyclic octamer2004430X
15083SIGMA-54 RPON DOMAIN-DNA COMPLEX2086106790XX
15213IntCB-DNA complex220860860XX
15223AB G alpha0002280X
15224AB G beta0002280X
15227duplex DNA containing an abasic site with opposite T (alpha anomer)0002250X
15228duplex DNA containing an abasic site with opposite T (beta anomer)0002250X
15238Ab C alpha0002050X
15239Ab C beta0002040X
15360DNA 12mer00222660X
15376modified DNA duplex00151700X
15527Mbp1 141160252270X
15533wt1-zf14-14mer011501210XX
156135'-D(*(DA)P*(DA)P*(DT)P*(DC)P*(DT)P*(DT)P*(DT)P*(DA)P*(DA)P*(DA)P*(DG)P*(DA)P*(DT)P*(DT))-3'0001210X
158605'-D(*DTP*DTP*DAP*DAP*DTP*DTP*DTP*(D33)*(D33)*(D33)*DAP*DAP*DAP*DTP*DTP*DAP*DA)-3'0005020X
15898DNA GAAA tetraloop4207720X
160545'-D(TP*CP*GP*TP*TP*GP*CP*T)-3'000830X
160555'-D(P*TP*CP*GP*TP*TP*GP*CP*T)-3'000790X
1613834-MER, SILVER ION0003320X
162125'-D(TP*CP*GP*TP*TP*GP*CP*T)-3'000810X
162225'-D(*DCP*DTP*DAP*DTP*(FAG)P*DAP*DTP*DTP*DCP*DA)-3'0002200X
162235'-D(*DCP*DTP*(FAG)P*DA)-3'000460X
162255'-D(*DGP*DTP*DGP*DCP*DGP*(TG)P*DGP*DTP*DTP*DTP*DGP*DT)-3'00202310X
162265'-D(*DGP*DTP*DGP*DCP*DGP*(TG)P*DGP*DTP*DTP*DTP*DGP*DT)-3'0002300X
16280d(GAGCTC)2000350X
162811:1 complex000350X
16282d(AGAGCTCT)2007480X
16286d(CGAGCTCG)2007460X
162872:1 complex000460X
162881:2 complex000410X
16289d(GCTATAGC)2007480X
162901:1 complex000420X
162912:1 complex000400X
162922:1 complex000430X
163565'-D(*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*(INO)P*GP*GP*TP*TP*AP*GP*GP*GP*T)-3'0002100X
16449XPF DNA complex1997304350XX
16485THAP RRM13518409020XX
16577Homeodomain DNA complex2117001420XX
16812MED1:DNA complex1456502990XX
168345'-D(*DGP*DCP*DGP*DAP*DGP*(6MT)P*DTP*DCP*DTP*DGP*DCP*DG)-3'0001370X
16936MBD2 bound to a methylated DNA3077005820XX
1712925-mer DNA oligomer1390252540X
17130zif268-12bpDNA175820820XX
17229ZNF DNA0001530XX
173795'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*A)-3', 2-CARBOXYQUINOXALINE0001970X
17397RET oncogene0002090X
17409triazole-linked DNA duplex94002120X
17422Cidofovir DNA duplex4001620X
17423Control DNA duplex0001570X
17452Pitx2HD2378904600XX
17535DNA/RNA hybrid360161301XX
17562N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenal0001470X
17580Myc G-quadruplex0001610X
17592Anabaena Sensory Rhodopsin Transducer with DNA306930930XX
17655Human Telomeric DNA0001890X
17697G-quadruplex0001270X
17708N-myc0001300X
17709N-myc0001150X
17729C-Terminal domain of Ler1515906370XX
17732Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA708006650XX
17746(5'S)-8,5'-Cyclo-2'-deoxyguanosine in DNA0001600X
17786(5'S)-8,5'-cyclo-2'-deoxyguanosine0001670X
17787(5'S)-8,5'-cyclo-2'-deoxyguanosine0001640X
17788gamma-hydroxy-1,N2-propano-2'-deoxyguanosine adduct0001870XX
17789(5'S)-8,5'-cyclo-2'-deoxyadenosine0001710X
17790(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct0001370X
17791(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct0001310X
17814DNA Containing an Aristolactam II-dA Lesion000820X
17859DNA duplex Containing an Unnatural, Hydrophobic Base Pair0001550X
17885DNA dodecamer000730X
17887alpha anomeric lesion560181770X
17980G-quadruplexes0001590X
18015PITX22258905190XX
18040DNA 100202020X
18050DNA 10091790X
18199DNA 1000480X
18209DNA molecule G3ATG3ACACAG4ACG30001530X
18279human CEB25 minisatellite G-quadruplex560252330X
184272'F-ANA and ANA self-complementary duplex000727X
18430Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine0001490X
18452Synthetic cyclic oligonucleotide0001160XX
1845311 mer oligonucleotide-B0001500X
1845411 mer oligonucleotide-B0001500X
18462Kaiso607164012880XX
18496YdbC:dT19G1 complex3307006550XX
18524DNA OUH130003250X
18625Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'0002000X
18626Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin0001750X
1863811 mer oligonucleotide-B0001420X
18639Duplex DNA Containing a b-Carba-Fapy-dG Lesion0001500X
18640Duplex DNA Containing a b-Carba-Fapy-dG Lesion0001500X
18690MOMERIC PIL-E G-QUADRUPLEX DNA0001880X
18699DIMERIC PIL-E G-QUADRUPLEX DNA0001340X
18724G-quadruplex DNA0001710X
18762N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene0001400X
18780DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link000810X
18781DNA000800X
18835dodecamer duplex0001090X
18862Parallel human telomeric quadruplex containing 2'F-ANA substitutions0001110X
18881d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid564102880XX
18902major G-quadruplex0002020X
18907Duplex DNA0002250X
18935African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNA57116504760XX
18973DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion00201790X
18979DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer00201790X
18981DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion00211850X
18984DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer00201820X
18985DNA 100201820X
19017Bulges in G-quadruplexes0001830X
19035G-rich VEGF aptamer with LNA modifications0001890X
19138ED Complex32910102030XX
19158DNA (5'-D(*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*TP*GP*GP*G)-3')00183490X
19159d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex00224280X
19276d[CGCGAAGCATTCGCG] hairpin0001390X
19277d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid0002400X
19278d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid0002660X
19279d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid0002450X
19280d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid0002630X
19281d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid0002600X
19367complex formed by the region 2 of E. coli sigmaE and its cognate -10 non template element TGTCAAA31710306840XX
19375N2-dG IQ at G3 in NarI sequence0002130X
19381DNA/RNA (5'-D(*TP*TP*G)-R(P*(LG))-D(P*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3')0001860X
19386parallel-stranded G-quadruplex in DNA poly-G stretches0001640X
19387intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative00232100X
19389stacked dimeric G-quadruplex0001340X
19391MBD33096804370XX
19402antiparallel (2+2) G-quadruplex0002290X
19435Complex between DNA quadruplex (human telomere) and DD-bisRuthenium ligand0001960X
19440N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNA00141600X
19441spermine modified DNA duplex00141640X
19448dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence0001960X
19511homeodomain transcription factor Gbx12487504930XX
19540MyT1 F4F5 - DNA complex115510510XX
19571d(GGGTTTTGGGTGGGTTTTGGG) quadruplex0003450X
19572quadruplex d(TGGGTTTGGGTTGGGTTTGGG)0001800X
19592Molecular Binding of TFF1 Estrogen Response Element0002870X
19594G-quadruplex bound to the bisquinolinium compound Phen-DC30001680X
19620DNA duplex containing N3T-ethylene-N1I0001160X
19653RRM domain from C. elegans SUP-12 + GGTGTGC DNA4209907310XX
19659RHB Modified duplex0002010X
19661SHB modified duplex0001980X
19695N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA0001370X
19696N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA0001400X
19728A tetrahelical DNA fold adopted by alternating GGG and GCG tracts0001120X
19745DNA (28-MER)0002120X
19784G-triplex truncated-TBA66091190X
19853AGA modified0001610X
19861AGT FAPY Modified duplex0001400X
19862AGC FAPY modified duplex Major isomer0001330X
19863AG(7-deaza)G FAPY modified duplex0001280X
19886CGACGCGTCG000980X
19888CGACGCGTCG with 5,6,7,8-TETRAHYDROBIOPTERIN000820X
19889CGACTAGTCG with AIK-18/51-1000960X
19890CGACTAGTCG dimer000820X
19912DNA duplex0001630X
19917DNA dodecamer containing the 5-hydroxycytosine000700X
19925DNA dodecamer with A:C mismatch000720X
19939MBD4 methyl-cytosine binding domain bound to methylated DNA2917505260XX
19957DNA-MC17810308730XX
25092MazE-DNA binding0610650XX
25099Hs2 dimer0001000X
25107DNA-quercetin000610X
25110left-handed G-quadruplex0002670X
25369DNA Dodecamer with 8-oxoguanine at 10th Position0001600X
25378A G-quadruplex structure0002320X
25407DNA complex of the C-Terminal domain of MvaT1635105360XX
25528DNA Dodecamer with 8-oxoguanine at 4th Position0001620X
25531N2-dG IQ at G1 in NarI sequence0001560X
25582Protein and DNA complex761401190XX
25596G-quadruplex0001660X
25651active G-quadruplex motif from AGRO1000002470X
25672N-(2'deoxyguanosin-8-yl)-3-aminobenzanthrone DNA adduct0001840X
25686G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome0002090X
25701EcoRV dimer with cognate DNA37112102950XX
25723Universal Base oligonucleotide with UB at point 500161360X
25724Control DNA oligonucleotide for the universal base00161330X
25746DNA G-quadruplex0001140X
25752EcoRV dimer with cognate DNA and Lu3+37111702910XX
25759Quercetin complexed with c-myc G-quadruplex DNA000570X
25840Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC000510X
25882dsDNA-lomaiviticin A complex0001630X
25888F1F2-DNA complex27239608960XX
25890DNA free0003400X
25891PARP-1 F1F2F3-DNA complex34833503350XX
25894PARP-1 F1F2F3-WGR-DNA complex044404440XX
25903Glucose in a DNA double helix0002120X
25906Glucose as a nuclease mimic in DNA0002350X
25915Photoswitchable G-quadruplex3400480X
26620Barnase-dCGAC5510902740XX
26731Paired domain of Pax5 in complex with DNA42413501350XX
26808Egr-1 DNA complex36610905420XX
26978MeCP2-DNA2667203050XX
27053KRAS oncogene promoter region0002180X
27144c-Myc Pu220002070X
27173KRAS promoter region1361202030X
27364Kaiso-MeCG2 complex011101110XX
27366KaisoE535Q-MeCG2 complex011101110XX
27367KaisoE535A-MeCG2 complex011101110XX
27368Kaiso-MeKBS complex011401140XX
27369KaisoE535Q-MeKBS complex011401140XX
27370KaisoE535A-MeKBS complex011401140XX
27371Kaiso-MeKBSsemi complex011401140XX
27372Kaiso-MeKBShemi complex011401140XX
27404hFEN1-336-K93A-DNA28013201320XX
27409DNA polymerase beta2900870XX
27410DNA polymerase beta ternary complex2900870XX
27560protein-gapped DNA complex76002280XX
27561protein-gapped DNA-nucelotide complex76002280XX
27652NZ118 tetramer0001110X
27828d(CGATATCG)2 : free form000500X
27829d(CGATATCG)2 : C-1305 complex0001000X
27958spin labled DNA duplex0006180X
28081Trimolecular G-quadruplex27901670X
30012DNA (5'-D(*AP*GP*GP*GP*CP*GP*GP*TP*GP*TP*GP*GP*GP*AP*AP*TP*AP*GP*GP*GP*AP*A)-3')0002180X
30015DNA (5'-D(*CP*GP*CP*TP*CP*(RIB)P*CP*AP*CP*GP*C)-3'), DNA (5'-D(*GP*CP*GP*TP*GP*GP*GP*AP*(8OG)P*CP*G)-3')0001900X
30016DNA (5'-D(*CP*GP*CP*TP*CP*(RIB)P*CP*AP*CP*GP*C)-3'), DNA (5'-D(*GP*CP*(8OG)P*TP*GP*GP*GP*AP*GP*CP*G)-3')0001870X
30038DNA00141860X
30044DNA Dodecamer with 8-oxoguanine at 10th Position00141860X
30045DNA (5'-D(*GP*GP*GP*TP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*AP*GP*GP*G)-3')0002100X
30052DNA (5'-D(*CP*GP*(RSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(RSG)P*CP*CP*G)-3')00181440X
30053DNA (5'-D(*CP*GP*GP*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*GP*CP*CP*G)-3')00161560X
30054DNA (5'-D(*CP*GP*(SSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(SSG)P*CP*CP*G)-3')00181120X
30055DNA (5'-D(*GP*GP*TP*TP*TP*GP*GP*TP*TP*TP*TP*GP*GP*TP*TP*TP*GP*G)-3')0001930X
30056DNA (5'-D(*GP*GP*TP*TP*TP*GP*GP*TP*TP*TP*TP*GP*GP*TP*TP*GP*G)-3')0001610X
30058DNA (25-MER)0002560X
30105DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')00161280XX
30111DNA (5'-D(*AP*TP*CP*CP*GP*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')00161290X
30112DNA (5'-D(*TP*TP*AP*GP*GP*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')00161290X
30113DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')00161280XX
30114DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')00161280XX
30115DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')00161280XX
30116DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')00161280XX
30117DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')00161280XX
30148DNA (5'-D(*CP*GP*(5CM)P*GP*AP*AP*TP*TP*CP*GP*CP*G)-3')0001920X
30151DNA (5'-D(*CP*GP*(5CM)P*GP*AP*AP*TP*TP*CP*GP*CP*G)-3')0001900X
30191DNA Dodecamer with 5-methylcytosine0001900X
30198DNA (5'-D(*CP*GP*CP*(8OG)P*AP*AP*TP*TP*(DMC)P*GP*CP*G)-3')0001700X
30250DNA (5'-D(*CP*GP*(DMC)P*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')0001700X
30251DNA (5'-D(*CP*GP*(DMC)P*GP*AP*AP*TP*TP*(DMC)P*(8OG)P*CP*G)-3')0001760X
30252DNA (5'-D(*CP*GP*CP*(8OG)P*AP*AP*TP*TP*(DMC)P*GP*CP*G)-3')0001720X
30253DNA (5'-D(*GP*CP*AP*TP*CP*GP*AP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*AP*AP*TP*CP*GP*AP*TP*GP*C)-3')11310221550X
30254DNA (5'-D(*CP*GP*AP*TP*TP*TP*TP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*AP*AP*AP*AP*AP*AP*TP*CP*G)-3')11510221610X
30255DNA (5'-D(*CP*GP*AP*TP*TP*TP*TP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*(M1A)P*AP*AP*AP*AP*AP*TP*CP*G)-3')11510201600X
30328DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')0001760X
30329DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')0001740X
30335DNA (5'-D(*CP*CP*AP*AP*GP*AP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*TP*CP*TP*TP*GP*G)-3')0001310X
30336DNA (5'-D(*CP*CP*AP*AP*GP*AP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*TP*CP*TP*TP*GP*G)-3')0001320X
30402DNA (26-MER)0002690X
30473Sp1 transcription factor duplex 5'-d(GGGGCGGGG)700101640X
30484Sp1 transcription factor duplex 5'-d(GGGGCGGGA)0001380X
30485Sp1 transcription factor duplex 5'-d(TGGGCGGGG)0001330X
30506Sp1 transcription factor duplex 5'-d(TGGGCGGGA)0001390X
30552DNA (27-MER)32002600X
30577DNA (5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*A)-3')0002030X
30688DNA (5'-D(*(3D1)P*AP*GP*GP*GP*AP*GP*GP*GP*CP*GP*GP*CP*GP*GP*GP*AP*CP*A)-3')0001710X
34025DNA (5'-D(*TP*AP*GP*GP*GP*AP*GP*GP*GP*TP*AP*GP*GP*GP*AP*GP*GP*GP*T)-3')0001380X
34034DNA (5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*G)-3')0001820X
34035DNA (5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*G)-3')0001720X
34051DNA (5'-D(*GP*CP*GP*AP*GP*GP*GP*AP*GP*CP*GP*AP*GP*GP*G)-3')0001370X
34053DNA (5'-D(*GP*TP*GP*TP*GP*GP*GP*TP*GP*TP*G)-3')0001090X
34054DNA (5'-D(*GP*CP*GP*AP*GP*GP*GP*AP*GP*CP*GP*AP*GP*GP*G)-3')0001030X
34056DNA (5'-D(*GP*CP*GP*AP*GP*GP*GP*AP*GP*CP*IP*AP*GP*GP*G)-3')000790X
34062G-quadruplex formed by a human telomeric sequence modified with 2'-fluoro-2'-deoxyriboguanosine46001970X
34063Artificial quadruplex with propeller, diagonal and lateral loop26001580X
34071DNA (5'-D(*GP*GP*(FT)P*TP*GP*GP*TP*GP*TP*GP*GP*TP*TP*GP*G)-3')0001460X
34083UpsB-Q-1, DNA (34-MER)0003010X
34084UpsB-Q-1 DNA (34-MER)0003050X
34086DNA (26-MER)0002500X
34118DNA (5'-D(*TP*(DCP)P*CP*GP*TP*TP*TP*CP*(PSC)P*GP*T)-3')000750X
34135DNA (5'-D(*TP*AP*GP*GP*GP*AP*CP*GP*GP*GP*CP*GP*GP*GP*CP*AP*GP*GP*GP*T)-3')0001820X
34136DNA (5'-D(*TP*AP*GP*GP*GP*AP*CP*GP*GP*GP*CP*GP*GP*GP*CP*AP*GP*GP*GP*T)-3')0001840X
34137DNA (5'-D(*TP*AP*GP*GP*GP*AP*CP*GP*GP*GP*CP*GP*GP*GP*CP*AP*GP*GP*GP*T)-3')0001840X
34145G-quadruplex of Human papillomavirus type 5227002210X
34157DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')1070223530X
34158DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')1050223040X
34159DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')1120223500X
34162DNA (5'-D(*TP*(DCP)P*GP*TP*TP*CP*(DCP)P*GP*TP*TP*TP*TP*TP*CP*GP*TP*TP*CP*CP*GP*T)-3')0001160X
34168DNA (5'-D(*GP*GP*GP*GP*CP*CP*GP*GP*GP*GP*CP*CP*GP*GP*GP*GP*CP*CP*GP*GP*(BGM)P*G)-3')0001760X
34172ECF RNA polymerase sigma-E factor,ECF RNA polymerase sigma factor SigW,ECF RNA polymerase sigma-E factor/DNA Complex40510207490XX
34174artificial quadruplex with propeller, diagonal, and lateral loop27001640X
34186cmbr-4813170001580X
34210DNA (5'-D(*GP*GP*GP*AP*TP*GP*GP*GP*AP*CP*AP*CP*AP*GP*(GFL)P*GP*GP*AP*CP*GP*GP*G)-3')24001430X
34221DNA (27-MER)0002190X
34244DNA (5'-D(*CP*GP*TP*CP*TP*CP*AP*TP*GP*AP*TP*AP*CP*G)-3') major0002920X
34245DNA (5'-D(*CP*GP*TP*CP*TP*CP*AP*TP*GP*AP*TP*AP*CP*G)-3') minor0001500X
34269DNA (5'-D(*GP*GP*CP*GP*AP*GP*GP*AP*GP*GP*GP*GP*CP*GP*TP*GP*GP*CP*CP*GP*GP*C)-3')0001930X
34276Tc-DNA/RNA duplex121002280XX
34277tc-DNA/tc-DNA duplex0001900X
34280Tc-DNA/DNA duplex59002340X
34290functional pRN1 primase/DNA Complex37610408500XX
34291functional pRN1 primase/DNA Complex30310407790XX
34296DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')0002000X
34297DNA (5'-D(*GP*GP*GP*TP*AP*GP*GP*GP*AP*GP*CP*GP*GP*GP*AP*GP*AP*GP*GP*G)-3')0001560X
34302DNA (28-MER)0002290X
34328DNA (5'-*(DC5)P*GP*AP*TP*(P)P*TP*AP*(Z)P*AP*TP*CP*(DG3))-3')72011980X
34331hTel-oxoG100001650X
34332hTel-oxoG210001570X
34353TINA-conjugated antiparallel DNA triplex0001780X
34378Kiteplatinated DNA oligomer0002000X
34386DNA (5'-D(*GP*TP*GP*TP*GP*TP*GP*GP*GP*TP*GP*TP*GP*T)-3')0001350X
34389DNA (25-MER)0001360X
34390DNA (25-MER)25001390X
34397DNA (5'-(*(DC5)P*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*(DG3))-3')0002140X
34398DNA (5'-D(*CP*GP*TP*CP*TP*CP*AP*TP*GP*AP*TP*AP*CP*G)-3')0003040X
34403F141522001252X
34431KRAS32R G9T1671302890X
34435VK20002170X
34436GCn00111150X
34438GCnCG00131320X
34441KRAS32R G25T341202580X
34444F141520001152X
34445F141525001292X
34467human telomeric G-quadruplexes000500X
34499DNA (5'-D(*GP*GP*GP*AP*TP*GP*GP*GP*AP*CP*AP*CP*AP*(GF2))-R(P*(LCG))-D(P*GP*GP*AP*CP*GP*GP*G)-3')21001130X
34502DNA (5'-D(*GP*GP*GP*AP*TP*GP*GP*GP*AP*CP*AP*CP*AP*(GF2))-R(P*(LCG))-D(P*GP*GP*AP*CP*GP*GP*G)-3')24001250X
34516DNA (5'-D(*GP*GP*GP*TP*GP*GP*GP*AP*AP*GP*GP*GP*TP*GP*GP*GP*A)-3')34001190X
34524DNA (36-MER)34002510X
34525DNA (35-MER)0002370X
34533DNA (36-MER)0002420X
34579DNA (5'-D(*CP*AP*CP*GP*CP*CP*GP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*CP*GP*GP*CP*GP*TP*G)-3')0002650X
34580DNA (5'-D(*CP*AP*CP*GP*CP*CP*GP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*CP*GP*GP*CP*GP*(SGT)P*G)-3')110162580X
34581DNA (5'-D(*CP*AP*CP*GP*CP*CP*GP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*CP*GP*GP*CP*GP*TP*G)-3')60172120X
34587DNA (5'-D(*AP*GP*CP*AP*AP*TP*CP*CP*(XC)P*(XC)P*(XC)P*(XC)P*GP*GP*AP*TP*TP*GP*CP*T)-3')85001670X
34588deoxyxylose nucleic acid hairpin66001670X
36001Switch-activating protein 1/DNA Complex4389806120XX
36020DNA (5'-D(*CP*CP*TP*GP*CP*CP*TP*G)-3')000820X
36022DNA (5'-D(*TP*TP*TP*AP*TP*TP*TP*A)-3')000900X
36116DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3')0001750X
36159G-quadruplex DNA (26-MER)0002600X
36160G-quadruplex DNA (26-MER)0002620X
36168DNA (5'-D(*GP*GP*GP*TP*AP*CP*CP*CP*GP*GP*GP*TP*GP*AP*GP*GP*TP*GP*CP*GP*GP*GP*GP*T)-3')110242360X
36174DNA (5'-D(*CP*GP*CP*GP*AP*AP*AP*TP*TP*TP*CP*GP*CP*G)-3')0002580X
36186Rok/DNA Complex3558309710XX
50109d(GTATGGCCATAC)2 DNA duplex000830X
50278dsDNA0001590X
50604Nucleosome Core Particle (human)33190200XX