data_53872 ####################### # Entry information # ####################### save_entry_information_1 _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information_1 _Entry.ID 53872 _Entry.Title ; Mtb-NID in complex with PstC1-RNA ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2026-06-16 _Entry.Accession_date 2026-06-16 _Entry.Last_release_date 2026-06-16 _Entry.Original_release_date 2026-06-16 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID 1 _Entry.Generated_software_label $software_1 _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Karine Loth . . . 0000-0001-7058-8661 53872 2 Herve Meudal . . . 0000-0002-9642-3643 53872 stop_ loop_ _Entry_src.ID _Entry_src.Project_name _Entry_src.Organization_full_name _Entry_src.Organization_initials _Entry_src.Entry_ID 1 . 'MO2VING-NMR, CBM, UPR 4301, CNRS, Orleans, France' . 53872 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2026-06-23 . original BMRB . 53872 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 53871 'Mtb-NID free' 53872 BMRB 53873 'Mtb-NID in complex with PstC1-DNA template' 53872 stop_ save_ ############### # Citations # ############### save_citations_1 _Citation.Sf_category citations _Citation.Sf_framecode citations_1 _Citation.Entry_ID 53872 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID . _Citation.DOI . _Citation.Full_citation . _Citation.Title ; An intrinsically disordered domain of transcription terminator Rho governs genome-wide Rho utilization (Rut) site selection in GC-rich Mycobacterium tuberculosis ; _Citation.Status submitted _Citation.Type journal _Citation.Journal_abbrev 'Nucleic Acids Res.' _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year . _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 'Thuy Duong' DO . . . . 53872 1 2 Gabriel 'PINO PECO' . . . . 53872 1 3 Eric EVENO . . . . 53872 1 4 Charlotte SAINT-ANDRE . . . . 53872 1 5 Mildred DELALEAU . . . . 53872 1 6 Franck COSTE . . . . 53872 1 7 Herve MEUDAL . . . . 53872 1 8 Karine LOTH . . . . 53872 1 9 Albert WEILXBAUMER . . . . 53872 1 10 Konstantin BRODOLIN . . . . 53872 1 11 Marc BOUDVILLAIN . . . . 53872 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly_1 _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly_1 _Assembly.Entry_ID 53872 _Assembly.ID 1 _Assembly.Name Mtb-NID+PstC1-RNA _Assembly.BMRB_code . _Assembly.Number_of_components 2 _Assembly.Organic_ligands 0 _Assembly.Metal_ions 0 _Assembly.Non_standard_bonds no _Assembly.Ambiguous_conformational_states yes _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange yes _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 NID 1 $entity_1 . . yes native yes yes . . . 53872 1 2 RNA 2 $entity_2 . . no native no no . . . 53872 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 53872 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polypeptide(L) _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GSHMANGAPAVDRSAQEHDK GDRPPSSEAPATQGEQTPTE QIDSQSQQVRPERRSATREA GPSGSGERAGTAADDTDNRQ GGQQDAKTEERGTDAGGDQG GDQQASGGQQARGDEDGEAR QGRRGRRFRDRRRRGERSGD GAEAELRE ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states yes _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 148 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . GLY . 53872 1 2 . SER . 53872 1 3 . HIS . 53872 1 4 . MET . 53872 1 5 . ALA . 53872 1 6 . ASN . 53872 1 7 . GLY . 53872 1 8 . ALA . 53872 1 9 . PRO . 53872 1 10 . ALA . 53872 1 11 . VAL . 53872 1 12 . ASP . 53872 1 13 . ARG . 53872 1 14 . SER . 53872 1 15 . ALA . 53872 1 16 . GLN . 53872 1 17 . GLU . 53872 1 18 . HIS . 53872 1 19 . ASP . 53872 1 20 . LYS . 53872 1 21 . GLY . 53872 1 22 . ASP . 53872 1 23 . ARG . 53872 1 24 . PRO . 53872 1 25 . PRO . 53872 1 26 . SER . 53872 1 27 . SER . 53872 1 28 . GLU . 53872 1 29 . ALA . 53872 1 30 . PRO . 53872 1 31 . ALA . 53872 1 32 . THR . 53872 1 33 . GLN . 53872 1 34 . GLY . 53872 1 35 . GLU . 53872 1 36 . GLN . 53872 1 37 . THR . 53872 1 38 . PRO . 53872 1 39 . THR . 53872 1 40 . GLU . 53872 1 41 . GLN . 53872 1 42 . ILE . 53872 1 43 . ASP . 53872 1 44 . SER . 53872 1 45 . GLN . 53872 1 46 . SER . 53872 1 47 . GLN . 53872 1 48 . GLN . 53872 1 49 . VAL . 53872 1 50 . ARG . 53872 1 51 . PRO . 53872 1 52 . GLU . 53872 1 53 . ARG . 53872 1 54 . ARG . 53872 1 55 . SER . 53872 1 56 . ALA . 53872 1 57 . THR . 53872 1 58 . ARG . 53872 1 59 . GLU . 53872 1 60 . ALA . 53872 1 61 . GLY . 53872 1 62 . PRO . 53872 1 63 . SER . 53872 1 64 . GLY . 53872 1 65 . SER . 53872 1 66 . GLY . 53872 1 67 . GLU . 53872 1 68 . ARG . 53872 1 69 . ALA . 53872 1 70 . GLY . 53872 1 71 . THR . 53872 1 72 . ALA . 53872 1 73 . ALA . 53872 1 74 . ASP . 53872 1 75 . ASP . 53872 1 76 . THR . 53872 1 77 . ASP . 53872 1 78 . ASN . 53872 1 79 . ARG . 53872 1 80 . GLN . 53872 1 81 . GLY . 53872 1 82 . GLY . 53872 1 83 . GLN . 53872 1 84 . GLN . 53872 1 85 . ASP . 53872 1 86 . ALA . 53872 1 87 . LYS . 53872 1 88 . THR . 53872 1 89 . GLU . 53872 1 90 . GLU . 53872 1 91 . ARG . 53872 1 92 . GLY . 53872 1 93 . THR . 53872 1 94 . ASP . 53872 1 95 . ALA . 53872 1 96 . GLY . 53872 1 97 . GLY . 53872 1 98 . ASP . 53872 1 99 . GLN . 53872 1 100 . GLY . 53872 1 101 . GLY . 53872 1 102 . ASP . 53872 1 103 . GLN . 53872 1 104 . GLN . 53872 1 105 . ALA . 53872 1 106 . SER . 53872 1 107 . GLY . 53872 1 108 . GLY . 53872 1 109 . GLN . 53872 1 110 . GLN . 53872 1 111 . ALA . 53872 1 112 . ARG . 53872 1 113 . GLY . 53872 1 114 . ASP . 53872 1 115 . GLU . 53872 1 116 . ASP . 53872 1 117 . GLY . 53872 1 118 . GLU . 53872 1 119 . ALA . 53872 1 120 . ARG . 53872 1 121 . GLN . 53872 1 122 . GLY . 53872 1 123 . ARG . 53872 1 124 . ARG . 53872 1 125 . GLY . 53872 1 126 . ARG . 53872 1 127 . ARG . 53872 1 128 . PHE . 53872 1 129 . ARG . 53872 1 130 . ASP . 53872 1 131 . ARG . 53872 1 132 . ARG . 53872 1 133 . ARG . 53872 1 134 . ARG . 53872 1 135 . GLY . 53872 1 136 . GLU . 53872 1 137 . ARG . 53872 1 138 . SER . 53872 1 139 . GLY . 53872 1 140 . ASP . 53872 1 141 . GLY . 53872 1 142 . ALA . 53872 1 143 . GLU . 53872 1 144 . ALA . 53872 1 145 . GLU . 53872 1 146 . LEU . 53872 1 147 . ARG . 53872 1 148 . GLU . 53872 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . GLY 1 1 53872 1 . SER 2 2 53872 1 . HIS 3 3 53872 1 . MET 4 4 53872 1 . ALA 5 5 53872 1 . ASN 6 6 53872 1 . GLY 7 7 53872 1 . ALA 8 8 53872 1 . PRO 9 9 53872 1 . ALA 10 10 53872 1 . VAL 11 11 53872 1 . ASP 12 12 53872 1 . ARG 13 13 53872 1 . SER 14 14 53872 1 . ALA 15 15 53872 1 . GLN 16 16 53872 1 . GLU 17 17 53872 1 . HIS 18 18 53872 1 . ASP 19 19 53872 1 . LYS 20 20 53872 1 . GLY 21 21 53872 1 . ASP 22 22 53872 1 . ARG 23 23 53872 1 . PRO 24 24 53872 1 . PRO 25 25 53872 1 . SER 26 26 53872 1 . SER 27 27 53872 1 . GLU 28 28 53872 1 . ALA 29 29 53872 1 . PRO 30 30 53872 1 . ALA 31 31 53872 1 . THR 32 32 53872 1 . GLN 33 33 53872 1 . GLY 34 34 53872 1 . GLU 35 35 53872 1 . GLN 36 36 53872 1 . THR 37 37 53872 1 . PRO 38 38 53872 1 . THR 39 39 53872 1 . GLU 40 40 53872 1 . GLN 41 41 53872 1 . ILE 42 42 53872 1 . ASP 43 43 53872 1 . SER 44 44 53872 1 . GLN 45 45 53872 1 . SER 46 46 53872 1 . GLN 47 47 53872 1 . GLN 48 48 53872 1 . VAL 49 49 53872 1 . ARG 50 50 53872 1 . PRO 51 51 53872 1 . GLU 52 52 53872 1 . ARG 53 53 53872 1 . ARG 54 54 53872 1 . SER 55 55 53872 1 . ALA 56 56 53872 1 . THR 57 57 53872 1 . ARG 58 58 53872 1 . GLU 59 59 53872 1 . ALA 60 60 53872 1 . GLY 61 61 53872 1 . PRO 62 62 53872 1 . SER 63 63 53872 1 . GLY 64 64 53872 1 . SER 65 65 53872 1 . GLY 66 66 53872 1 . GLU 67 67 53872 1 . ARG 68 68 53872 1 . ALA 69 69 53872 1 . GLY 70 70 53872 1 . THR 71 71 53872 1 . ALA 72 72 53872 1 . ALA 73 73 53872 1 . ASP 74 74 53872 1 . ASP 75 75 53872 1 . THR 76 76 53872 1 . ASP 77 77 53872 1 . ASN 78 78 53872 1 . ARG 79 79 53872 1 . GLN 80 80 53872 1 . GLY 81 81 53872 1 . GLY 82 82 53872 1 . GLN 83 83 53872 1 . GLN 84 84 53872 1 . ASP 85 85 53872 1 . ALA 86 86 53872 1 . LYS 87 87 53872 1 . THR 88 88 53872 1 . GLU 89 89 53872 1 . GLU 90 90 53872 1 . ARG 91 91 53872 1 . GLY 92 92 53872 1 . THR 93 93 53872 1 . ASP 94 94 53872 1 . ALA 95 95 53872 1 . GLY 96 96 53872 1 . GLY 97 97 53872 1 . ASP 98 98 53872 1 . GLN 99 99 53872 1 . GLY 100 100 53872 1 . GLY 101 101 53872 1 . ASP 102 102 53872 1 . GLN 103 103 53872 1 . GLN 104 104 53872 1 . ALA 105 105 53872 1 . SER 106 106 53872 1 . GLY 107 107 53872 1 . GLY 108 108 53872 1 . GLN 109 109 53872 1 . GLN 110 110 53872 1 . ALA 111 111 53872 1 . ARG 112 112 53872 1 . GLY 113 113 53872 1 . ASP 114 114 53872 1 . GLU 115 115 53872 1 . ASP 116 116 53872 1 . GLY 117 117 53872 1 . GLU 118 118 53872 1 . ALA 119 119 53872 1 . ARG 120 120 53872 1 . GLN 121 121 53872 1 . GLY 122 122 53872 1 . ARG 123 123 53872 1 . ARG 124 124 53872 1 . GLY 125 125 53872 1 . ARG 126 126 53872 1 . ARG 127 127 53872 1 . PHE 128 128 53872 1 . ARG 129 129 53872 1 . ASP 130 130 53872 1 . ARG 131 131 53872 1 . ARG 132 132 53872 1 . ARG 133 133 53872 1 . ARG 134 134 53872 1 . GLY 135 135 53872 1 . GLU 136 136 53872 1 . ARG 137 137 53872 1 . SER 138 138 53872 1 . GLY 139 139 53872 1 . ASP 140 140 53872 1 . GLY 141 141 53872 1 . ALA 142 142 53872 1 . GLU 143 143 53872 1 . ALA 144 144 53872 1 . GLU 145 145 53872 1 . LEU 146 146 53872 1 . ARG 147 147 53872 1 . GLU 148 148 53872 1 stop_ save_ save_entity_2 _Entity.Sf_category entity _Entity.Sf_framecode entity_2 _Entity.Entry_ID 53872 _Entity.ID 2 _Entity.BMRB_code . _Entity.Name entity_2 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGCCGCGCUGGCCCGGCCAU CCGGUGGUUGGGUGGGAUAG GUGCGGUGAUCCCGCUGCUU GCGCUGGUCUUGGUGCUGGU GGUGCUGGUCAUCGAGGCGA UGGGUGCGAUCAGGCUCAAC GG ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states yes _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 122 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID 2 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . G . 53872 2 2 . G . 53872 2 3 . C . 53872 2 4 . C . 53872 2 5 . G . 53872 2 6 . C . 53872 2 7 . G . 53872 2 8 . C . 53872 2 9 . U . 53872 2 10 . G . 53872 2 11 . G . 53872 2 12 . C . 53872 2 13 . C . 53872 2 14 . C . 53872 2 15 . G . 53872 2 16 . G . 53872 2 17 . C . 53872 2 18 . C . 53872 2 19 . A . 53872 2 20 . U . 53872 2 21 . C . 53872 2 22 . C . 53872 2 23 . G . 53872 2 24 . G . 53872 2 25 . U . 53872 2 26 . G . 53872 2 27 . G . 53872 2 28 . U . 53872 2 29 . U . 53872 2 30 . G . 53872 2 31 . G . 53872 2 32 . G . 53872 2 33 . U . 53872 2 34 . G . 53872 2 35 . G . 53872 2 36 . G . 53872 2 37 . A . 53872 2 38 . U . 53872 2 39 . A . 53872 2 40 . G . 53872 2 41 . G . 53872 2 42 . U . 53872 2 43 . G . 53872 2 44 . C . 53872 2 45 . G . 53872 2 46 . G . 53872 2 47 . U . 53872 2 48 . G . 53872 2 49 . A . 53872 2 50 . U . 53872 2 51 . C . 53872 2 52 . C . 53872 2 53 . C . 53872 2 54 . G . 53872 2 55 . C . 53872 2 56 . U . 53872 2 57 . G . 53872 2 58 . C . 53872 2 59 . U . 53872 2 60 . U . 53872 2 61 . G . 53872 2 62 . C . 53872 2 63 . G . 53872 2 64 . C . 53872 2 65 . U . 53872 2 66 . G . 53872 2 67 . G . 53872 2 68 . U . 53872 2 69 . C . 53872 2 70 . U . 53872 2 71 . U . 53872 2 72 . G . 53872 2 73 . G . 53872 2 74 . U . 53872 2 75 . G . 53872 2 76 . C . 53872 2 77 . U . 53872 2 78 . G . 53872 2 79 . G . 53872 2 80 . U . 53872 2 81 . G . 53872 2 82 . G . 53872 2 83 . U . 53872 2 84 . G . 53872 2 85 . C . 53872 2 86 . U . 53872 2 87 . G . 53872 2 88 . G . 53872 2 89 . U . 53872 2 90 . C . 53872 2 91 . A . 53872 2 92 . U . 53872 2 93 . C . 53872 2 94 . G . 53872 2 95 . A . 53872 2 96 . G . 53872 2 97 . G . 53872 2 98 . C . 53872 2 99 . G . 53872 2 100 . A . 53872 2 101 . U . 53872 2 102 . G . 53872 2 103 . G . 53872 2 104 . G . 53872 2 105 . U . 53872 2 106 . G . 53872 2 107 . C . 53872 2 108 . G . 53872 2 109 . A . 53872 2 110 . U . 53872 2 111 . C . 53872 2 112 . A . 53872 2 113 . G . 53872 2 114 . G . 53872 2 115 . C . 53872 2 116 . U . 53872 2 117 . C . 53872 2 118 . A . 53872 2 119 . A . 53872 2 120 . C . 53872 2 121 . G . 53872 2 122 . G . 53872 2 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 53872 2 . G 2 2 53872 2 . C 3 3 53872 2 . C 4 4 53872 2 . G 5 5 53872 2 . C 6 6 53872 2 . G 7 7 53872 2 . C 8 8 53872 2 . U 9 9 53872 2 . G 10 10 53872 2 . G 11 11 53872 2 . C 12 12 53872 2 . C 13 13 53872 2 . C 14 14 53872 2 . G 15 15 53872 2 . G 16 16 53872 2 . C 17 17 53872 2 . C 18 18 53872 2 . A 19 19 53872 2 . U 20 20 53872 2 . C 21 21 53872 2 . C 22 22 53872 2 . G 23 23 53872 2 . G 24 24 53872 2 . U 25 25 53872 2 . G 26 26 53872 2 . G 27 27 53872 2 . U 28 28 53872 2 . U 29 29 53872 2 . G 30 30 53872 2 . G 31 31 53872 2 . G 32 32 53872 2 . U 33 33 53872 2 . G 34 34 53872 2 . G 35 35 53872 2 . G 36 36 53872 2 . A 37 37 53872 2 . U 38 38 53872 2 . A 39 39 53872 2 . G 40 40 53872 2 . G 41 41 53872 2 . U 42 42 53872 2 . G 43 43 53872 2 . C 44 44 53872 2 . G 45 45 53872 2 . G 46 46 53872 2 . U 47 47 53872 2 . G 48 48 53872 2 . A 49 49 53872 2 . U 50 50 53872 2 . C 51 51 53872 2 . C 52 52 53872 2 . C 53 53 53872 2 . G 54 54 53872 2 . C 55 55 53872 2 . U 56 56 53872 2 . G 57 57 53872 2 . C 58 58 53872 2 . U 59 59 53872 2 . U 60 60 53872 2 . G 61 61 53872 2 . C 62 62 53872 2 . G 63 63 53872 2 . C 64 64 53872 2 . U 65 65 53872 2 . G 66 66 53872 2 . G 67 67 53872 2 . U 68 68 53872 2 . C 69 69 53872 2 . U 70 70 53872 2 . U 71 71 53872 2 . G 72 72 53872 2 . G 73 73 53872 2 . U 74 74 53872 2 . G 75 75 53872 2 . C 76 76 53872 2 . U 77 77 53872 2 . G 78 78 53872 2 . G 79 79 53872 2 . U 80 80 53872 2 . G 81 81 53872 2 . G 82 82 53872 2 . U 83 83 53872 2 . G 84 84 53872 2 . C 85 85 53872 2 . U 86 86 53872 2 . G 87 87 53872 2 . G 88 88 53872 2 . U 89 89 53872 2 . C 90 90 53872 2 . A 91 91 53872 2 . U 92 92 53872 2 . C 93 93 53872 2 . G 94 94 53872 2 . A 95 95 53872 2 . G 96 96 53872 2 . G 97 97 53872 2 . C 98 98 53872 2 . G 99 99 53872 2 . A 100 100 53872 2 . U 101 101 53872 2 . G 102 102 53872 2 . G 103 103 53872 2 . G 104 104 53872 2 . U 105 105 53872 2 . G 106 106 53872 2 . C 107 107 53872 2 . G 108 108 53872 2 . A 109 109 53872 2 . U 110 110 53872 2 . C 111 111 53872 2 . A 112 112 53872 2 . G 113 113 53872 2 . G 114 114 53872 2 . C 115 115 53872 2 . U 116 116 53872 2 . C 117 117 53872 2 . A 118 118 53872 2 . A 119 119 53872 2 . C 120 120 53872 2 . G 121 121 53872 2 . G 122 122 53872 2 stop_ save_ #################### # Natural source # #################### save_natural_source_1 _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source_1 _Entity_natural_src_list.Entry_ID 53872 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 1773 organism . 'Mycobacterium tuberculosis' 'Mycobacterium tuberculosis' . . Bacteria . Mycobacterium tuberculosis . . . . . . . . . . . . . 53872 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source_1 _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source_1 _Entity_experimental_src_list.Entry_ID 53872 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'recombinant technology' 'Escherichia coli' . . . Escherichia coli . . . plasmid . . pET28a . . . 53872 1 2 2 $entity_2 . 'chemical synthesis' . . . . . . . . . plasmid . . . . . . 53872 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 53872 _Sample.ID 1 _Sample.Name 'RNA complex' _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 Mtb-NID '[U-99% 13C; U-99% 15N]' . . 1 $entity_1 . . 2 . . uM . . . . 53872 1 2 PstC1-RNA 'natural abundance' . . 2 $entity_2 . . 25 . . uM . . . . 53872 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 53872 _Sample_condition_list.ID 1 _Sample_condition_list.Name Conditions _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID pH 6 . pH 53872 1 pressure 1 . atm 53872 1 temperature 298 . K 53872 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 53872 _Software.ID 1 _Software.Type . _Software.Name TOPSPIN _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID collection . 53872 1 processing . 53872 1 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 53872 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name 700 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE NEO' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 700 save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 53872 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 'So fast HMQC' yes no no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53872 1 stop_ loop_ _Experiment_file.Experiment_ID _Experiment_file.Experiment_name _Experiment_file.Name _Experiment_file.Type _Experiment_file.Content _Experiment_file.Directory_path _Experiment_file.Details _Experiment_file.Entry_ID _Experiment_file.Experiment_list_ID 1 'So fast HMQC' 2rr-NID-RNA . 'Time-domain (raw spectral data)' . 'Spectrum (2rr)' 53872 1 stop_ save_