data_53977 ####################### # Entry information # ####################### save_entry_information_1 _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information_1 _Entry.ID 53977 _Entry.Title ; 1H, 13C and 15N chemical shift assignments of an RNA hairpin construct for ES h44-top from the E. coli 70S ribosome ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2026-08-12 _Entry.Accession_date 2026-08-12 _Entry.Last_release_date 2026-08-12 _Entry.Original_release_date 2026-08-12 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Christian Steinmetzger . . . 0000-0002-8031-3562 53977 2 Katja Petzold . . . 0000-0001-9470-0347 53977 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 53977 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 53 53977 '15N chemical shifts' 43 53977 '1H chemical shifts' 94 53977 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2026-11-03 . original BMRB . 53977 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 53975 '1H, 13C and 15N chemical shift assignments of an RNA hairpin construct for WT h44-top from the E. coli 70S ribosome' 53977 BMRB 53976 '1H, 13C and 15N chemical shift assignments of an RNA hairpin construct for trapped GS h44-top from the E. coli 70S ribosome' 53977 PDB pdb_000028ui 'Cryo-EM structure of the E. coli 70S ribosome the RNA construct is derived from' 53977 stop_ save_ ############### # Citations # ############### save_citations_1 _Citation.Sf_category citations _Citation.Sf_framecode citations_1 _Citation.Entry_ID 53977 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID . _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Universal 3D Motif dynamics in RNA: The A-minor Switch ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'Nucleic Acids Res.' _Citation.Journal_name_full 'Nucleic Acids Research' _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year 2026 _Citation.Details 'BioRxiv preprint: 10.64898/2026.05.08.718354.' loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Christian Steinmetzger . . . . 53977 1 2 Hampus Karlsson . . . . 53977 1 3 Carolina Fontana . . . . 53977 1 4 Natalia 'Galindo Riera' . . . . 53977 1 5 Magdalena Riad . . . . 53977 1 6 David Kosek . . . . 53977 1 7 Judith Schlagnitweit . . . . 53977 1 8 Emilie Steiner . . . . 53977 1 9 Sarah Sandoz . F. . . 53977 1 10 Emma Andersson . R. . . 53977 1 11 Katja Petzold . . . . 53977 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly_1 _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly_1 _Assembly.Entry_ID 53977 _Assembly.ID 1 _Assembly.Name 'h44-top_es 27mer RNA hairpin' _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands 0 _Assembly.Metal_ions 0 _Assembly.Non_standard_bonds no _Assembly.Ambiguous_conformational_states yes _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange no _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 hairpin 1 $entity_1 . . yes native yes no . . . 53977 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 53977 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGCGCUUAACGCUUCGCGGA GGGCGCC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states yes _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 27 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 1 G . 53977 1 2 2 G . 53977 1 3 3 C . 53977 1 4 4 G . 53977 1 5 5 C . 53977 1 6 6 U . 53977 1 7 7 U . 53977 1 8 8 A . 53977 1 9 9 A . 53977 1 10 10 C . 53977 1 11 10A G . 53977 1 12 11 C . 53977 1 13 12 U . 53977 1 14 13 U . 53977 1 15 14 C . 53977 1 16 15 G . 53977 1 17 15A C . 53977 1 18 16 G . 53977 1 19 17 G . 53977 1 20 18 A . 53977 1 21 19 G . 53977 1 22 20 G . 53977 1 23 21 G . 53977 1 24 22 C . 53977 1 25 23 G . 53977 1 26 24 C . 53977 1 27 25 C . 53977 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 53977 1 . G 2 2 53977 1 . C 3 3 53977 1 . G 4 4 53977 1 . C 5 5 53977 1 . U 6 6 53977 1 . U 7 7 53977 1 . A 8 8 53977 1 . A 9 9 53977 1 . C 10 10 53977 1 . G 11 11 53977 1 . C 12 12 53977 1 . U 13 13 53977 1 . U 14 14 53977 1 . C 15 15 53977 1 . G 16 16 53977 1 . C 17 17 53977 1 . G 18 18 53977 1 . G 19 19 53977 1 . A 20 20 53977 1 . G 21 21 53977 1 . G 22 22 53977 1 . G 23 23 53977 1 . C 24 24 53977 1 . G 25 25 53977 1 . C 26 26 53977 1 . C 27 27 53977 1 stop_ save_ #################### # Natural source # #################### save_natural_source_1 _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source_1 _Entity_natural_src_list.Entry_ID 53977 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 562 organism . 'Escherichia coli' 'E. coli' . . Bacteria . Escherichia coli . . . . . . . . . . . . . 53977 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source_1 _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source_1 _Entity_experimental_src_list.Entry_ID 53977 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'in vitro transcription' 'cell free' . . . cell free . . . . . . . . . . 53977 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 53977 _Sample.ID 1 _Sample.Name '13C,15N-labeled sample' _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'h44-top_wt 27mer RNA hairpin' '[U-13C; U-15N]' . . 1 $entity_1 . . 1 . . mM . . . . 53977 1 2 NaP 'natural abundance' . . . . . . 15 . . mM . . . . 53977 1 3 NaCl 'natural abundance' . . . . . . 25 . . mM . . . . 53977 1 4 EDTA 'natural abundance' . . . . . . 0.5 . . mM . . . . 53977 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 53977 _Sample_condition_list.ID 1 _Sample_condition_list.Name '298 K, standard NMR buffer' _Sample_condition_list.Details '15 mM NaP, 25 mM NaCl, 0.5 mM EDTA, pH 6.5' loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID pH 6.5 . pH 53977 1 temperature 298 . K 53977 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 53977 _Software.ID 1 _Software.Type . _Software.Name CcpNMR _Software.Version 3 _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 53977 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 53977 _Software.ID 2 _Software.Type . _Software.Name TOPSPIN _Software.Version 3 _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID collection . 53977 2 processing . 53977 2 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 53977 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name '600 MHz' _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE III' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 53977 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no no no . . . . . . . . . . 1 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . '175 ms mixing time' 53977 1 2 '2D 1H-13C HSQC aromatic' no no no . . . . . . . . . . 1 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53977 1 3 '2D 1H-13C HSQC aliphatic' no no no . . . . . . . . . . 1 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53977 1 4 '2D HCN aromatic' no no no . . . . . . . . . . 1 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53977 1 5 '2D HCN aliphatic' no no no . . . . . . . . . . 1 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53977 1 6 '2D 1H-15N HSQC' no no no . . . . . . . . . . 1 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53977 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 53977 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name 'DSS 298 K' _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 DSS 'methyl protons' . . . . ppm -2.755 na indirect 0.251449530 . . . . . 53977 1 H 1 DSS 'methyl protons' . . . . ppm -0.099 external direct 1.000000000 'separate tube (no insert) similar to the experimental sample tube' . . . . 53977 1 N 15 DSS 'methyl protons' . . . . ppm -0.101 na indirect 0.101329118 . . . . . 53977 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 53977 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name 'HCN 298 K pH 6.5' _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 53977 1 2 '2D 1H-13C HSQC aromatic' . . . 53977 1 3 '2D 1H-13C HSQC aliphatic' . . . 53977 1 4 '2D HCN aromatic' . . . 53977 1 5 '2D HCN aliphatic' . . . 53977 1 6 '2D 1H-15N HSQC' . . . 53977 1 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 1 $software_1 . . 53977 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 G H1' H 1 5.789098002 0.0435634099 . 1 . . . . . 1 G H1' . 53977 1 2 . 1 . 1 1 1 G H8 H 1 8.096422887 0.04361213927 . 1 . . . . . 1 G H8 . 53977 1 3 . 1 . 1 1 1 G C1' C 13 90.98742203 0 . 1 . . . . . 1 G C1' . 53977 1 4 . 1 . 1 1 1 G C8 C 13 139.0537604 0 . 1 . . . . . 1 G C8 . 53977 1 5 . 1 . 1 1 1 G N9 N 15 167.9896973 0.02001961684 . 1 . . . . . 1 G N9 . 53977 1 6 . 1 . 1 2 2 G H1 H 1 13.34940979 0.001102854638 . 1 . . . . . 2 G H1 . 53977 1 7 . 1 . 1 2 2 G H1' H 1 5.885673227 0.0452396518 . 1 . . . . . 2 G H1' . 53977 1 8 . 1 . 1 2 2 G H8 H 1 7.618840791 0.03575233204 . 1 . . . . . 2 G H8 . 53977 1 9 . 1 . 1 2 2 G C1' C 13 92.97153036 0 . 1 . . . . . 2 G C1' . 53977 1 10 . 1 . 1 2 2 G C8 C 13 136.8877994 0 . 1 . . . . . 2 G C8 . 53977 1 11 . 1 . 1 2 2 G N1 N 15 148.4295148 0 . 1 . . . . . 2 G N1 . 53977 1 12 . 1 . 1 2 2 G N9 N 15 169.1308154 0 . 1 . . . . . 2 G N9 . 53977 1 13 . 1 . 1 3 3 C H1' H 1 5.530843398 0.04399375607 . 1 . . . . . 3 C H1' . 53977 1 14 . 1 . 1 3 3 C H5 H 1 5.240256034 0.0004764768126 . 1 . . . . . 3 C H5 . 53977 1 15 . 1 . 1 3 3 C H6 H 1 7.609487794 0.03454581327 . 1 . . . . . 3 C H6 . 53977 1 16 . 1 . 1 3 3 C H41 H 1 6.723886997 0.001550845602 . 1 . . . . . 3 C H41 . 53977 1 17 . 1 . 1 3 3 C H42 H 1 8.494912566 0.001731228989 . 1 . . . . . 3 C H42 . 53977 1 18 . 1 . 1 3 3 C C1' C 13 93.74656579 0 . 1 . . . . . 3 C C1' . 53977 1 19 . 1 . 1 3 3 C C6 C 13 140.467271 0 . 1 . . . . . 3 C C6 . 53977 1 20 . 1 . 1 3 3 C N1 N 15 150.1415619 0.0106567465 . 1 . . . . . 3 C N1 . 53977 1 21 . 1 . 1 4 4 G H1 H 1 12.87675131 0.0009651930584 . 1 . . . . . 4 G H1 . 53977 1 22 . 1 . 1 4 4 G H1' H 1 5.713774861 0.04135004694 . 1 . . . . . 4 G H1' . 53977 1 23 . 1 . 1 4 4 G H8 H 1 7.542921505 0.03415398523 . 1 . . . . . 4 G H8 . 53977 1 24 . 1 . 1 4 4 G C1' C 13 93.06400885 0 . 1 . . . . . 4 G C1' . 53977 1 25 . 1 . 1 4 4 G C8 C 13 136.1233794 0 . 1 . . . . . 4 G C8 . 53977 1 26 . 1 . 1 4 4 G N1 N 15 147.8271942 0 . 1 . . . . . 4 G N1 . 53977 1 27 . 1 . 1 4 4 G N9 N 15 168.7340546 0.03002929688 . 1 . . . . . 4 G N9 . 53977 1 28 . 1 . 1 5 5 C H1' H 1 5.470910634 0.04255287502 . 1 . . . . . 5 C H1' . 53977 1 29 . 1 . 1 5 5 C H5 H 1 5.163386885 0.003284365438 . 1 . . . . . 5 C H5 . 53977 1 30 . 1 . 1 5 5 C H6 H 1 7.527191365 0.03458592947 . 1 . . . . . 5 C H6 . 53977 1 31 . 1 . 1 5 5 C H41 H 1 6.883855995 0.0005361397741 . 1 . . . . . 5 C H41 . 53977 1 32 . 1 . 1 5 5 C H42 H 1 8.402893924 0.0007697178405 . 1 . . . . . 5 C H42 . 53977 1 33 . 1 . 1 5 5 C C1' C 13 93.86032764 0 . 1 . . . . . 5 C C1' . 53977 1 34 . 1 . 1 5 5 C C6 C 13 140.8067588 0 . 1 . . . . . 5 C C6 . 53977 1 35 . 1 . 1 5 5 C N1 N 15 151.2261284 0.007149536003 . 1 . . . . . 5 C N1 . 53977 1 36 . 1 . 1 5 5 C N4 N 15 99.44241443 0.004878571651 . 1 . . . . . 5 C N4 . 53977 1 37 . 1 . 1 6 6 U H1' H 1 5.5805434 0.0406382128 . 1 . . . . . 6 U H1' . 53977 1 38 . 1 . 1 6 6 U H3 H 1 11.66768691 0.001265860763 . 1 . . . . . 6 U H3 . 53977 1 39 . 1 . 1 6 6 U H5 H 1 5.651882148 0.002011895074 . 1 . . . . . 6 U H5 . 53977 1 40 . 1 . 1 6 6 U H6 H 1 7.749639338 0.03462092302 . 1 . . . . . 6 U H6 . 53977 1 41 . 1 . 1 6 6 U C1' C 13 94.63077032 0 . 1 . . . . . 6 U C1' . 53977 1 42 . 1 . 1 6 6 U C6 C 13 141.0815998 0 . 1 . . . . . 6 U C6 . 53977 1 43 . 1 . 1 6 6 U N1 N 15 145.9480991 0 . 1 . . . . . 6 U N1 . 53977 1 44 . 1 . 1 6 6 U N3 N 15 157.8851091 0 . 1 . . . . . 6 U N3 . 53977 1 45 . 1 . 1 7 7 U H1' H 1 5.423816728 0.04183780938 . 1 . . . . . 7 U H1' . 53977 1 46 . 1 . 1 7 7 U H3 H 1 11.36990812 0 . 1 . . . . . 7 U H3 . 53977 1 47 . 1 . 1 7 7 U H6 H 1 7.814900314 0.04252300027 . 1 . . . . . 7 U H6 . 53977 1 48 . 1 . 1 7 7 U C1' C 13 93.9180711 0 . 1 . . . . . 7 U C1' . 53977 1 49 . 1 . 1 7 7 U C6 C 13 141.941634 0 . 1 . . . . . 7 U C6 . 53977 1 50 . 1 . 1 7 7 U N1 N 15 145.5677264 0.02001961684 . 1 . . . . . 7 U N1 . 53977 1 51 . 1 . 1 7 7 U N3 N 15 157.2345588 0 . 1 . . . . . 7 U N3 . 53977 1 52 . 1 . 1 8 8 A H1' H 1 5.773910646 0.04213082271 . 1 . . . . . 8 A H1' . 53977 1 53 . 1 . 1 8 8 A H2 H 1 7.786853047 . . 1 . . . . . 8 A H2 . 53977 1 54 . 1 . 1 8 8 A H8 H 1 8.373731215 0.03506527575 . 1 . . . . . 8 A H8 . 53977 1 55 . 1 . 1 8 8 A C1' C 13 90.54687488 0 . 1 . . . . . 8 A C1' . 53977 1 56 . 1 . 1 8 8 A C2 C 13 153.907527 . . 1 . . . . . 8 A C2 . 53977 1 57 . 1 . 1 8 8 A C8 C 13 141.2940562 0 . 1 . . . . . 8 A C8 . 53977 1 58 . 1 . 1 8 8 A N9 N 15 169.4511293 0 . 1 . . . . . 8 A N9 . 53977 1 59 . 1 . 1 9 9 A H1' H 1 5.795555026 0.04361964751 . 1 . . . . . 9 A H1' . 53977 1 60 . 1 . 1 9 9 A H2 H 1 7.899511836 . . 1 . . . . . 9 A H2 . 53977 1 61 . 1 . 1 9 9 A H8 H 1 7.8773001 0.0381416863 . 1 . . . . . 9 A H8 . 53977 1 62 . 1 . 1 9 9 A C1' C 13 93.10649106 0 . 1 . . . . . 9 A C1' . 53977 1 63 . 1 . 1 9 9 A C2 C 13 154.0998703 . . 1 . . . . . 9 A C2 . 53977 1 64 . 1 . 1 9 9 A C8 C 13 140.0620056 0 . 1 . . . . . 9 A C8 . 53977 1 65 . 1 . 1 9 9 A N9 N 15 169.6913647 0 . 1 . . . . . 9 A N9 . 53977 1 66 . 1 . 1 10 10 C H1' H 1 5.643564722 0.0003770071668 . 1 . . . . . 10 C H1' . 53977 1 67 . 1 . 1 10 10 C H5 H 1 5.670680184 0.003301965928 . 1 . . . . . 10 C H5 . 53977 1 68 . 1 . 1 10 10 C H6 H 1 7.440985991 0.04059539258 . 1 . . . . . 10 C H6 . 53977 1 69 . 1 . 1 10 10 C H41 H 1 6.714560071 0.001531022769 . 1 . . . . . 10 C H41 . 53977 1 70 . 1 . 1 10 10 C H42 H 1 8.236720371 0.002074616233 . 1 . . . . . 10 C H42 . 53977 1 71 . 1 . 1 10 10 C C6 C 13 140.0985533 0 . 1 . . . . . 10 C C6 . 53977 1 72 . 1 . 1 10 10 C N1 N 15 149.9119832 . . 1 . . . . . 10 C N1 . 53977 1 73 . 1 . 1 10 10 C N4 N 15 96.58221027 0.001324499477 . 1 . . . . . 10 C N4 . 53977 1 74 . 1 . 1 11 11 G H1 H 1 12.74080833 0.0009442684385 . 1 . . . . . 10A G H1 . 53977 1 75 . 1 . 1 11 11 G H1' H 1 5.61733688 0.04348031338 . 1 . . . . . 10A G H1' . 53977 1 76 . 1 . 1 11 11 G H8 H 1 7.488400153 0.03885628235 . 1 . . . . . 10A G H8 . 53977 1 77 . 1 . 1 11 11 G C1' C 13 92.97528569 0 . 1 . . . . . 10A G C1' . 53977 1 78 . 1 . 1 11 11 G C8 C 13 136.2112745 0 . 1 . . . . . 10A G C8 . 53977 1 79 . 1 . 1 11 11 G N1 N 15 147.1929843 0 . 1 . . . . . 10A G N1 . 53977 1 80 . 1 . 1 11 11 G N9 N 15 169.0106977 0 . 1 . . . . . 10A G N9 . 53977 1 81 . 1 . 1 12 12 C H1' H 1 5.655990334 0.04377432516 . 1 . . . . . 11 C H1' . 53977 1 82 . 1 . 1 12 12 C H5 H 1 5.199549667 0.001128731764 . 1 . . . . . 11 C H5 . 53977 1 83 . 1 . 1 12 12 C H6 H 1 7.421265516 0.0354622699 . 1 . . . . . 11 C H6 . 53977 1 84 . 1 . 1 12 12 C H41 H 1 6.82055938 0.0006079818511 . 1 . . . . . 11 C H41 . 53977 1 85 . 1 . 1 12 12 C H42 H 1 8.238772366 0.001476983994 . 1 . . . . . 11 C H42 . 53977 1 86 . 1 . 1 12 12 C C1' C 13 92.47090784 0 . 1 . . . . . 11 C C1' . 53977 1 87 . 1 . 1 12 12 C C6 C 13 141.0073861 0 . 1 . . . . . 11 C C6 . 53977 1 88 . 1 . 1 12 12 C N1 N 15 149.6317086 0 . 1 . . . . . 11 C N1 . 53977 1 89 . 1 . 1 12 12 C N4 N 15 98.61345136 0.009976839966 . 1 . . . . . 11 C N4 . 53977 1 90 . 1 . 1 13 13 U H1' H 1 5.815413794 0.04500674867 . 1 . . . . . 12 U H1' . 53977 1 91 . 1 . 1 13 13 U H5 H 1 5.592124928 0 . 1 . . . . . 12 U H5 . 53977 1 92 . 1 . 1 13 13 U H6 H 1 7.829193062 0.0364943591 . 1 . . . . . 12 U H6 . 53977 1 93 . 1 . 1 13 13 U C1' C 13 90.64716797 0 . 1 . . . . . 12 U C1' . 53977 1 94 . 1 . 1 13 13 U C6 C 13 143.4973677 0 . 1 . . . . . 12 U C6 . 53977 1 95 . 1 . 1 13 13 U N1 N 15 143.9060982 0 . 1 . . . . . 12 U N1 . 53977 1 96 . 1 . 1 14 14 U H1' H 1 5.489607786 0.04926869266 . 1 . . . . . 13 U H1' . 53977 1 97 . 1 . 1 14 14 U H5 H 1 5.647109584 0.001989946791 . 1 . . . . . 13 U H5 . 53977 1 98 . 1 . 1 14 14 U H6 H 1 7.563785175 0.04434009777 . 1 . . . . . 13 U H6 . 53977 1 99 . 1 . 1 14 14 U C1' C 13 89.52260948 0 . 1 . . . . . 13 U C1' . 53977 1 100 . 1 . 1 14 14 U C6 C 13 143.4955618 0 . 1 . . . . . 13 U C6 . 53977 1 101 . 1 . 1 14 14 U N1 N 15 143.5857843 0 . 1 . . . . . 13 U N1 . 53977 1 102 . 1 . 1 15 15 C H1' H 1 5.838810126 0.04291372187 . 1 . . . . . 14 C H1' . 53977 1 103 . 1 . 1 15 15 C H5 H 1 5.970728824 0.001914265259 . 1 . . . . . 14 C H5 . 53977 1 104 . 1 . 1 15 15 C H6 H 1 7.696535773 0.04124159235 . 1 . . . . . 14 C H6 . 53977 1 105 . 1 . 1 15 15 C C1' C 13 90.73429669 0 . 1 . . . . . 14 C C1' . 53977 1 106 . 1 . 1 15 15 C C6 C 13 144.0003053 0 . 1 . . . . . 14 C C6 . 53977 1 107 . 1 . 1 15 15 C N1 N 15 150.292356 0.02001961675 . 1 . . . . . 14 C N1 . 53977 1 108 . 1 . 1 16 16 G H1 H 1 13.00229797 0.0009206300583 . 1 . . . . . 15 G H1 . 53977 1 109 . 1 . 1 16 16 G H1' H 1 5.706776602 0.002104648012 . 1 . . . . . 15 G H1' . 53977 1 110 . 1 . 1 16 16 G H8 H 1 8.085346986 0.03672411611 . 1 . . . . . 15 G H8 . 53977 1 111 . 1 . 1 16 16 G C1' C 13 89.28100219 0 . 1 . . . . . 15 G C1' . 53977 1 112 . 1 . 1 16 16 G C8 C 13 138.0910058 0 . 1 . . . . . 15 G C8 . 53977 1 113 . 1 . 1 16 16 G N1 N 15 148.5796654 0 . 1 . . . . . 15 G N1 . 53977 1 114 . 1 . 1 16 16 G N9 N 15 166.6483829 . . 1 . . . . . 15 G N9 . 53977 1 115 . 1 . 1 17 17 C H1' H 1 5.609145892 0.04745640844 . 1 . . . . . 15A C H1' . 53977 1 116 . 1 . 1 17 17 C H5 H 1 5.244741241 0.002990830377 . 1 . . . . . 15A C H5 . 53977 1 117 . 1 . 1 17 17 C H6 H 1 7.597763889 0.03493102865 . 1 . . . . . 15A C H6 . 53977 1 118 . 1 . 1 17 17 C H41 H 1 6.401291377 0.0005349662873 . 1 . . . . . 15A C H41 . 53977 1 119 . 1 . 1 17 17 C H42 H 1 8.340409176 0.001101340691 . 1 . . . . . 15A C H42 . 53977 1 120 . 1 . 1 17 17 C C1' C 13 94.32490954 0 . 1 . . . . . 15A C C1' . 53977 1 121 . 1 . 1 17 17 C C6 C 13 141.6941879 0 . 1 . . . . . 15A C C6 . 53977 1 122 . 1 . 1 17 17 C N1 N 15 150.4324933 0 . 1 . . . . . 15A C N1 . 53977 1 123 . 1 . 1 17 17 C N4 N 15 96.9846685 0.001272883368 . 1 . . . . . 15A C N4 . 53977 1 124 . 1 . 1 18 18 G H1 H 1 12.79124553 0.0008179749866 . 1 . . . . . 16 G H1 . 53977 1 125 . 1 . 1 18 18 G H1' H 1 5.602877932 0.04758333456 . 1 . . . . . 16 G H1' . 53977 1 126 . 1 . 1 18 18 G H8 H 1 7.293535464 0.03520173318 . 1 . . . . . 16 G H8 . 53977 1 127 . 1 . 1 18 18 G C1' C 13 93.56551633 . . 1 . . . . . 16 G C1' . 53977 1 128 . 1 . 1 18 18 G C8 C 13 135.9458591 0 . 1 . . . . . 16 G C8 . 53977 1 129 . 1 . 1 18 18 G N1 N 15 147.4506202 0 . 1 . . . . . 16 G N1 . 53977 1 130 . 1 . 1 18 18 G N9 N 15 167.9696776 0 . 1 . . . . . 16 G N9 . 53977 1 131 . 1 . 1 19 19 G H1' H 1 5.415704426 0.0002708175916 . 1 . . . . . 17 G H1' . 53977 1 132 . 1 . 1 19 19 G H8 H 1 7.788924982 0.03506437728 . 1 . . . . . 17 G H8 . 53977 1 133 . 1 . 1 19 19 G C1' C 13 91.47080798 0 . 1 . . . . . 17 G C1' . 53977 1 134 . 1 . 1 19 19 G C8 C 13 137.098819 0 . 1 . . . . . 17 G C8 . 53977 1 135 . 1 . 1 19 19 G N9 N 15 169.6513255 . . 1 . . . . . 17 G N9 . 53977 1 136 . 1 . 1 20 20 A H1' H 1 5.841897285 0.0387060579 . 1 . . . . . 18 A H1' . 53977 1 137 . 1 . 1 20 20 A H8 H 1 7.986008811 0.03249688889 . 1 . . . . . 18 A H8 . 53977 1 138 . 1 . 1 20 20 A C1' C 13 92.76830887 0 . 1 . . . . . 18 A C1' . 53977 1 139 . 1 . 1 20 20 A C8 C 13 140.3901997 0 . 1 . . . . . 18 A C8 . 53977 1 140 . 1 . 1 20 20 A N9 N 15 169.2309135 0.02001961684 . 1 . . . . . 18 A N9 . 53977 1 141 . 1 . 1 21 21 G H1 H 1 10.24202698 0 . 1 . . . . . 19 G H1 . 53977 1 142 . 1 . 1 21 21 G H8 H 1 7.355397154 0.001061034274 . 1 . . . . . 19 G H8 . 53977 1 143 . 1 . 1 21 21 G C8 C 13 136.8123463 0 . 1 . . . . . 19 G C8 . 53977 1 144 . 1 . 1 21 21 G N1 N 15 142.9343974 0 . 1 . . . . . 19 G N1 . 53977 1 145 . 1 . 1 22 22 G H1 H 1 10.73415151 0.00081459379 . 1 . . . . . 20 G H1 . 53977 1 146 . 1 . 1 22 22 G H1' H 1 5.495548582 . . 1 . . . . . 20 G H1' . 53977 1 147 . 1 . 1 22 22 G H8 H 1 6.889610355 0.05092815463 . 1 . . . . . 20 G H8 . 53977 1 148 . 1 . 1 22 22 G C8 C 13 136.8805427 . . 1 . . . . . 20 G C8 . 53977 1 149 . 1 . 1 22 22 G N1 N 15 142.9674815 0 . 1 . . . . . 20 G N1 . 53977 1 150 . 1 . 1 22 22 G N9 N 15 170.043563 0.008154772663 . 1 . . . . . 20 G N9 . 53977 1 151 . 1 . 1 23 23 G H1 H 1 13.30932261 0.001057063718 . 1 . . . . . 21 G H1 . 53977 1 152 . 1 . 1 23 23 G H1' H 1 5.697629382 0.042126238 . 1 . . . . . 21 G H1' . 53977 1 153 . 1 . 1 23 23 G H8 H 1 7.174653752 0.03657790922 . 1 . . . . . 21 G H8 . 53977 1 154 . 1 . 1 23 23 G C1' C 13 93.11007568 0 . 1 . . . . . 21 G C1' . 53977 1 155 . 1 . 1 23 23 G C8 C 13 136.0804115 0 . 1 . . . . . 21 G C8 . 53977 1 156 . 1 . 1 23 23 G N1 N 15 148.4573708 0 . 1 . . . . . 21 G N1 . 53977 1 157 . 1 . 1 23 23 G N9 N 15 169.41109 0 . 1 . . . . . 21 G N9 . 53977 1 158 . 1 . 1 24 24 C H1' H 1 5.520632286 0.03902595883 . 1 . . . . . 22 C H1' . 53977 1 159 . 1 . 1 24 24 C H5 H 1 5.209045594 0.001654654582 . 1 . . . . . 22 C H5 . 53977 1 160 . 1 . 1 24 24 C H6 H 1 7.535522577 0.03540148592 . 1 . . . . . 22 C H6 . 53977 1 161 . 1 . 1 24 24 C H41 H 1 6.823956781 0.003077175609 . 1 . . . . . 22 C H41 . 53977 1 162 . 1 . 1 24 24 C H42 H 1 8.480398649 0.002035237494 . 1 . . . . . 22 C H42 . 53977 1 163 . 1 . 1 24 24 C C1' C 13 93.80979649 0 . 1 . . . . . 22 C C1' . 53977 1 164 . 1 . 1 24 24 C C6 C 13 140.4635087 0 . 1 . . . . . 22 C C6 . 53977 1 165 . 1 . 1 24 24 C N1 N 15 150.0874998 0.01535966004 . 1 . . . . . 22 C N1 . 53977 1 166 . 1 . 1 25 25 G H1 H 1 12.90798834 0.001269408223 . 1 . . . . . 23 G H1 . 53977 1 167 . 1 . 1 25 25 G H1' H 1 5.7169364 0.0405697568 . 1 . . . . . 23 G H1' . 53977 1 168 . 1 . 1 25 25 G H8 H 1 7.551218964 0.03982820078 . 1 . . . . . 23 G H8 . 53977 1 169 . 1 . 1 25 25 G C1' C 13 92.97784275 0 . 1 . . . . . 23 G C1' . 53977 1 170 . 1 . 1 25 25 G C8 C 13 136.1523127 0 . 1 . . . . . 23 G C8 . 53977 1 171 . 1 . 1 25 25 G N1 N 15 147.903584 0 . 1 . . . . . 23 G N1 . 53977 1 172 . 1 . 1 25 25 G N9 N 15 168.7280731 0.03746032715 . 1 . . . . . 23 G N9 . 53977 1 173 . 1 . 1 26 26 C H1' H 1 5.498977419 0.03885492102 . 1 . . . . . 24 C H1' . 53977 1 174 . 1 . 1 26 26 C H5 H 1 5.222046406 0.004003604574 . 1 . . . . . 24 C H5 . 53977 1 175 . 1 . 1 26 26 C H6 H 1 7.66540171 0.03383489592 . 1 . . . . . 24 C H6 . 53977 1 176 . 1 . 1 26 26 C H41 H 1 6.887959962 0.001144813405 . 1 . . . . . 24 C H41 . 53977 1 177 . 1 . 1 26 26 C H42 H 1 8.580135942 0.001718947663 . 1 . . . . . 24 C H42 . 53977 1 178 . 1 . 1 26 26 C C1' C 13 94.21717905 0 . 1 . . . . . 24 C C1' . 53977 1 179 . 1 . 1 26 26 C C6 C 13 141.1456593 0 . 1 . . . . . 24 C C6 . 53977 1 180 . 1 . 1 26 26 C N1 N 15 151.1531995 0 . 1 . . . . . 24 C N1 . 53977 1 181 . 1 . 1 26 26 C N4 N 15 99.13422914 0.0000954 . 1 . . . . . 24 C N4 . 53977 1 182 . 1 . 1 27 27 C H1' H 1 5.729286999 0.04702445041 . 1 . . . . . 25 C H1' . 53977 1 183 . 1 . 1 27 27 C H5 H 1 5.525630434 0.002536592772 . 1 . . . . . 25 C H5 . 53977 1 184 . 1 . 1 27 27 C H6 H 1 7.652842365 0.03658307321 . 1 . . . . . 25 C H6 . 53977 1 185 . 1 . 1 27 27 C H41 H 1 7.000498805 0.001478484274 . 1 . . . . . 25 C H41 . 53977 1 186 . 1 . 1 27 27 C H42 H 1 8.345773309 0.0007208784156 . 1 . . . . . 25 C H42 . 53977 1 187 . 1 . 1 27 27 C C1' C 13 92.97995837 0 . 1 . . . . . 25 C C1' . 53977 1 188 . 1 . 1 27 27 C C6 C 13 141.7062906 0 . 1 . . . . . 25 C C6 . 53977 1 189 . 1 . 1 27 27 C N1 N 15 152.3944157 0 . 1 . . . . . 25 C N1 . 53977 1 190 . 1 . 1 27 27 C N4 N 15 97.5118017 0.001052829666 . 1 . . . . . 25 C N4 . 53977 1 stop_ save_