data_53976 ####################### # Entry information # ####################### save_entry_information_1 _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information_1 _Entry.ID 53976 _Entry.Title ; 1H, 13C and 15N chemical shift assignments of an RNA hairpin construct for trapped GS h44-top from the E. coli 70S ribosome ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2026-08-12 _Entry.Accession_date 2026-08-12 _Entry.Last_release_date 2026-08-12 _Entry.Original_release_date 2026-08-12 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Christian Steinmetzger . . . 0000-0002-8031-3562 53976 2 Katja Petzold . . . 0000-0001-9470-0347 53976 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 53976 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 45 53976 '15N chemical shifts' 43 53976 '1H chemical shifts' 89 53976 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2026-11-03 . original BMRB . 53976 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 53975 '1H, 13C and 15N chemical shift assignments of an RNA hairpin construct for WT h44-top from the E. coli 70S ribosome' 53976 BMRB 53977 '1H, 13C and 15N chemical shift assignments of an RNA hairpin construct for ES h44-top from the E. coli 70S ribosome' 53976 PDB pdb_00009tqa 'Cryo-EM structure of the E. coli 70S ribosome the RNA construct is derived from' 53976 stop_ save_ ############### # Citations # ############### save_citations_1 _Citation.Sf_category citations _Citation.Sf_framecode citations_1 _Citation.Entry_ID 53976 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID . _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Universal 3D Motif dynamics in RNA: The A-minor Switch ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'Nucleic Acids Res.' _Citation.Journal_name_full 'Nucleic Acids Research' _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year 2026 _Citation.Details 'BioRxiv preprint: 10.64898/2026.05.08.718354.' loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Christian Steinmetzger . . . . 53976 1 2 Hampus Karlsson . . . . 53976 1 3 Carolina Fontana . . . . 53976 1 4 Natalia 'Galindo Riera' . . . . 53976 1 5 Magdalena Riad . . . . 53976 1 6 David Kosek . . . . 53976 1 7 Judith Schlagnitweit . . . . 53976 1 8 Emilie Steiner . . . . 53976 1 9 Sarah Sandoz . F. . . 53976 1 10 Emma Andersson . R. . . 53976 1 11 Katja Petzold . . . . 53976 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly_1 _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly_1 _Assembly.Entry_ID 53976 _Assembly.ID 1 _Assembly.Name 'h44-top_gs 27mer RNA hairpin' _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands 0 _Assembly.Metal_ions 0 _Assembly.Non_standard_bonds no _Assembly.Ambiguous_conformational_states yes _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange no _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 hairpin 1 $entity_1 . . yes native no no . . . 53976 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 53976 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGCGCUUAACGCUUCGGCGA GGGCGCC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states yes _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 27 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 1 G . 53976 1 2 2 G . 53976 1 3 3 C . 53976 1 4 4 G . 53976 1 5 5 C . 53976 1 6 6 U . 53976 1 7 7 U . 53976 1 8 8 A . 53976 1 9 9 A . 53976 1 10 10 C . 53976 1 11 10A G . 53976 1 12 11 C . 53976 1 13 12 U . 53976 1 14 13 U . 53976 1 15 14 C . 53976 1 16 15 G . 53976 1 17 16 G . 53976 1 18 16A C . 53976 1 19 17 G . 53976 1 20 18 A . 53976 1 21 19 G . 53976 1 22 20 G . 53976 1 23 21 G . 53976 1 24 22 C . 53976 1 25 23 G . 53976 1 26 24 C . 53976 1 27 25 C . 53976 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 53976 1 . G 2 2 53976 1 . C 3 3 53976 1 . G 4 4 53976 1 . C 5 5 53976 1 . U 6 6 53976 1 . U 7 7 53976 1 . A 8 8 53976 1 . A 9 9 53976 1 . C 10 10 53976 1 . G 11 11 53976 1 . C 12 12 53976 1 . U 13 13 53976 1 . U 14 14 53976 1 . C 15 15 53976 1 . G 16 16 53976 1 . G 17 17 53976 1 . C 18 18 53976 1 . G 19 19 53976 1 . A 20 20 53976 1 . G 21 21 53976 1 . G 22 22 53976 1 . G 23 23 53976 1 . C 24 24 53976 1 . G 25 25 53976 1 . C 26 26 53976 1 . C 27 27 53976 1 stop_ save_ #################### # Natural source # #################### save_natural_source_1 _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source_1 _Entity_natural_src_list.Entry_ID 53976 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 562 organism . 'Escherichia coli' 'E. coli' . . Bacteria . Escherichia coli . . . . . . . . . . . . . 53976 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source_1 _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source_1 _Entity_experimental_src_list.Entry_ID 53976 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'in vitro transcription' 'cell free' . . . cell free . . . . . . . . . . 53976 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 53976 _Sample.ID 1 _Sample.Name '13C,15N-labeled sample' _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'h44-top_gs 27mer RNA hairpin' '[U-13C; U-15N]' . . 1 $entity_1 . . 1 . . mM . . . . 53976 1 2 NaP 'natural abundance' . . . . . . 15 . . mM . . . . 53976 1 3 NaCl 'natural abundance' . . . . . . 25 . . mM . . . . 53976 1 4 EDTA 'natural abundance' . . . . . . 0.5 . . mM . . . . 53976 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 53976 _Sample_condition_list.ID 1 _Sample_condition_list.Name '298 K, standard NMR buffer' _Sample_condition_list.Details '15 mM NaP, 25 mM NaCl, 0.5 mM EDTA, pH 6.5' loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID pH 6.5 . pH 53976 1 temperature 298 . K 53976 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 53976 _Software.ID 1 _Software.Type . _Software.Name CcpNMR _Software.Version 3 _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 53976 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 53976 _Software.ID 2 _Software.Type . _Software.Name TOPSPIN _Software.Version 3 _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID collection . 53976 2 processing . 53976 2 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 53976 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name '600 MHz' _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE III' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 53976 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no no no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . '175 ms mixing time' 53976 1 2 '2D 1H-13C HSQC aromatic' no no no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53976 1 3 '2D 1H-13C HSQC aliphatic' no no no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53976 1 4 '2D HCN aromatic' no no no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53976 1 5 '2D HCN aliphatic' no no no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53976 1 6 '2D 1H-15N HSQC' no no no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53976 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 53976 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name 'DSS 298 K' _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 DSS 'methyl protons' . . . . ppm -2.755 na indirect 0.251449530 . . . . . 53976 1 H 1 DSS 'methyl protons' . . . . ppm -0.099 external direct 1.000000000 'separate tube (no insert) similar to the experimental sample tube' . . . . 53976 1 N 15 DSS 'methyl protons' . . . . ppm -0.101 na indirect 0.101329118 . . . . . 53976 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 53976 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name 'HCN 298 K pH 6.5' _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 53976 1 2 '2D 1H-13C HSQC aromatic' . . . 53976 1 3 '2D 1H-13C HSQC aliphatic' . . . 53976 1 4 '2D HCN aromatic' . . . 53976 1 5 '2D HCN aliphatic' . . . 53976 1 6 '2D 1H-15N HSQC' . . . 53976 1 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 1 $software_1 . . 53976 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 G H1' H 1 5.814460584 0.001756715985 . 1 . . . . . 1 G H1' . 53976 1 2 . 1 . 1 1 1 G H8 H 1 8.126628001 0.003675140496 . 1 . . . . . 1 G H8 . 53976 1 3 . 1 . 1 1 1 G C1' C 13 90.96934042 . . 1 . . . . . 1 G C1' . 53976 1 4 . 1 . 1 1 1 G C8 C 13 139.0455647 . . 1 . . . . . 1 G C8 . 53976 1 5 . 1 . 1 1 1 G N9 N 15 167.9696776 . . 1 . . . . . 1 G N9 . 53976 1 6 . 1 . 1 2 2 G H1 H 1 13.36100869 0.000933725844 . 1 . . . . . 2 G H1 . 53976 1 7 . 1 . 1 2 2 G H1' H 1 5.917062652 0.002836082912 . 1 . . . . . 2 G H1' . 53976 1 8 . 1 . 1 2 2 G H8 H 1 7.601619642 0.001775986705 . 1 . . . . . 2 G H8 . 53976 1 9 . 1 . 1 2 2 G C1' C 13 92.98778028 . . 1 . . . . . 2 G C1' . 53976 1 10 . 1 . 1 2 2 G C8 C 13 136.6836571 . . 1 . . . . . 2 G C8 . 53976 1 11 . 1 . 1 2 2 G N1 N 15 148.4681092 . . 1 . . . . . 2 G N1 . 53976 1 12 . 1 . 1 2 2 G N9 N 15 169.1645441 0.0337286464 . 1 . . . . . 2 G N9 . 53976 1 13 . 1 . 1 3 3 C H1' H 1 5.56281607 0.002034388976 . 1 . . . . . 3 C H1' . 53976 1 14 . 1 . 1 3 3 C H5 H 1 5.256408928 0.0005168661613 . 1 . . . . . 3 C H5 . 53976 1 15 . 1 . 1 3 3 C H6 H 1 7.625080524 0.002720428391 . 1 . . . . . 3 C H6 . 53976 1 16 . 1 . 1 3 3 C H41 H 1 6.744785387 0.003135957188 . 1 . . . . . 3 C H41 . 53976 1 17 . 1 . 1 3 3 C H42 H 1 8.506226138 . . 1 . . . . . 3 C H42 . 53976 1 18 . 1 . 1 3 3 C C1' C 13 93.78959343 . . 1 . . . . . 3 C C1' . 53976 1 19 . 1 . 1 3 3 C C6 C 13 140.45345 . . 1 . . . . . 3 C C6 . 53976 1 20 . 1 . 1 3 3 C N1 N 15 150.1200469 0.007867508622 . 1 . . . . . 3 C N1 . 53976 1 21 . 1 . 1 3 3 C N4 N 15 98.38060594 0.002850513548 . 1 . . . . . 3 C N4 . 53976 1 22 . 1 . 1 4 4 G H1 H 1 12.92033828 0.001166528934 . 1 . . . . . 4 G H1 . 53976 1 23 . 1 . 1 4 4 G H1' H 1 5.746992689 0.004285867773 . 1 . . . . . 4 G H1' . 53976 1 24 . 1 . 1 4 4 G H8 H 1 7.570427041 0.00171545829 . 1 . . . . . 4 G H8 . 53976 1 25 . 1 . 1 4 4 G C1' C 13 93.14206659 . . 1 . . . . . 4 G C1' . 53976 1 26 . 1 . 1 4 4 G C8 C 13 136.1095778 . . 1 . . . . . 4 G C8 . 53976 1 27 . 1 . 1 4 4 G N1 N 15 147.7682773 . . 1 . . . . . 4 G N1 . 53976 1 28 . 1 . 1 4 4 G N9 N 15 168.7517244 0.01873792936 . 1 . . . . . 4 G N9 . 53976 1 29 . 1 . 1 5 5 C H1' H 1 5.524312867 0.0006021058832 . 1 . . . . . 5 C H1' . 53976 1 30 . 1 . 1 5 5 C H5 H 1 5.178732398 0.001547517487 . 1 . . . . . 5 C H5 . 53976 1 31 . 1 . 1 5 5 C H6 H 1 7.561797358 0.00189944056 . 1 . . . . . 5 C H6 . 53976 1 32 . 1 . 1 5 5 C H41 H 1 6.915636122 0.005627308174 . 1 . . . . . 5 C H41 . 53976 1 33 . 1 . 1 5 5 C H42 H 1 8.434427609 0.004313860299 . 1 . . . . . 5 C H42 . 53976 1 34 . 1 . 1 5 5 C C1' C 13 151.3835907 . . 1 . . . . . 5 C C1' . 53976 1 35 . 1 . 1 5 5 C C6 C 13 140.8147825 . . 1 . . . . . 5 C C6 . 53976 1 36 . 1 . 1 5 5 C N1 N 15 151.3934349 . . 1 . . . . . 5 C N1 . 53976 1 37 . 1 . 1 5 5 C N4 N 15 99.2011543 0.004316988375 . 1 . . . . . 5 C N4 . 53976 1 38 . 1 . 1 6 6 U H1' H 1 5.623028717 0.001104257656 . 1 . . . . . 6 U H1' . 53976 1 39 . 1 . 1 6 6 U H3 H 1 11.92427339 0.002137209337 . 1 . . . . . 6 U H3 . 53976 1 40 . 1 . 1 6 6 U H5 H 1 5.656546448 . . 1 . . . . . 6 U H5 . 53976 1 41 . 1 . 1 6 6 U H6 H 1 7.723071264 0.002291074261 . 1 . . . . . 6 U H6 . 53976 1 42 . 1 . 1 6 6 U C1' C 13 94.81159557 . . 1 . . . . . 6 U C1' . 53976 1 43 . 1 . 1 6 6 U C6 C 13 141.2166992 . . 1 . . . . . 6 U C6 . 53976 1 44 . 1 . 1 6 6 U N1 N 15 145.7479029 0 . 1 . . . . . 6 U N1 . 53976 1 45 . 1 . 1 6 6 U N3 N 15 158.0128671 . . 1 . . . . . 6 U N3 . 53976 1 46 . 1 . 1 7 7 U H5 H 1 5.640692819 . . 1 . . . . . 7 U H5 . 53976 1 47 . 1 . 1 7 7 U H6 H 1 7.873335089 0.002465579138 . 1 . . . . . 7 U H6 . 53976 1 48 . 1 . 1 7 7 U C6 C 13 142.7504641 . . 1 . . . . . 7 U C6 . 53976 1 49 . 1 . 1 7 7 U N1 N 15 145.3475106 . . 1 . . . . . 7 U N1 . 53976 1 50 . 1 . 1 8 8 A H1' H 1 5.80336662 0.002363518168 . 1 . . . . . 8 A H1' . 53976 1 51 . 1 . 1 8 8 A H2 H 1 7.55139342 . . 1 . . . . . 8 A H2 . 53976 1 52 . 1 . 1 8 8 A H8 H 1 8.144143697 0.0005851283515 . 1 . . . . . 8 A H8 . 53976 1 53 . 1 . 1 8 8 A C1' C 13 90.752819 . . 1 . . . . . 8 A C1' . 53976 1 54 . 1 . 1 8 8 A C2 C 13 154.5510436 . . 1 . . . . . 8 A C2 . 53976 1 55 . 1 . 1 8 8 A C8 C 13 141.4560953 . . 1 . . . . . 8 A C8 . 53976 1 56 . 1 . 1 8 8 A N9 N 15 168.1698738 . . 1 . . . . . 8 A N9 . 53976 1 57 . 1 . 1 9 9 A H1' H 1 5.997310991 0.0007014837699 . 1 . . . . . 9 A H1' . 53976 1 58 . 1 . 1 9 9 A H2 H 1 8.168089977 . . 1 . . . . . 9 A H2 . 53976 1 59 . 1 . 1 9 9 A H8 H 1 8.249594323 0.002239938145 . 1 . . . . . 9 A H8 . 53976 1 60 . 1 . 1 9 9 A C1' C 13 90.79834527 . . 1 . . . . . 9 A C1' . 53976 1 61 . 1 . 1 9 9 A C2 C 13 155.2741228 . . 1 . . . . . 9 A C2 . 53976 1 62 . 1 . 1 9 9 A C8 C 13 140.902381 . . 1 . . . . . 9 A C8 . 53976 1 63 . 1 . 1 9 9 A N9 N 15 168.8505408 0 . 1 . . . . . 9 A N9 . 53976 1 64 . 1 . 1 10 10 C H6 H 1 7.68660272 0.0008689696831 . 1 . . . . . 10 C H6 . 53976 1 65 . 1 . 1 10 10 C C6 C 13 141.1688865 . . 1 . . . . . 10 C C6 . 53976 1 66 . 1 . 1 10 10 C N1 N 15 149.9119832 . . 1 . . . . . 10 C N1 . 53976 1 67 . 1 . 1 11 11 G H1 H 1 13.36986074 0.001890419606 . 1 . . . . . 10A G H1 . 53976 1 68 . 1 . 1 11 11 G H1' H 1 5.705426244 . . 1 . . . . . 10A G H1' . 53976 1 69 . 1 . 1 11 11 G H8 H 1 7.653091933 0.001218060845 . 1 . . . . . 10A G H8 . 53976 1 70 . 1 . 1 11 11 G C8 C 13 136.4548582 . . 1 . . . . . 10A G C8 . 53976 1 71 . 1 . 1 11 11 G N1 N 15 148.1832549 . . 1 . . . . . 10A G N1 . 53976 1 72 . 1 . 1 11 11 G N9 N 15 168.8371944 0.01887467587 . 1 . . . . . 10A G N9 . 53976 1 73 . 1 . 1 12 12 C H1' H 1 5.49129325 0.003044476451 . 1 . . . . . 11 C H1' . 53976 1 74 . 1 . 1 12 12 C H5 H 1 5.199082807 0.0004423593638 . 1 . . . . . 11 C H5 . 53976 1 75 . 1 . 1 12 12 C H6 H 1 7.545715011 0.002106662524 . 1 . . . . . 11 C H6 . 53976 1 76 . 1 . 1 12 12 C H41 H 1 6.606387519 0.003848291452 . 1 . . . . . 11 C H41 . 53976 1 77 . 1 . 1 12 12 C H42 H 1 8.469097756 0.001150603332 . 1 . . . . . 11 C H42 . 53976 1 78 . 1 . 1 12 12 C C1' C 13 93.84190535 . . 1 . . . . . 11 C C1' . 53976 1 79 . 1 . 1 12 12 C C6 C 13 140.6379076 . . 1 . . . . . 11 C C6 . 53976 1 80 . 1 . 1 12 12 C N1 N 15 150.5926502 0 . 1 . . . . . 11 C N1 . 53976 1 81 . 1 . 1 12 12 C N4 N 15 97.77431539 0.001504795932 . 1 . . . . . 11 C N4 . 53976 1 82 . 1 . 1 13 13 U H1' H 1 5.6389342 0.003177736989 . 1 . . . . . 12 U H1' . 53976 1 83 . 1 . 1 13 13 U H2' H 1 3.779122775 0.003560291477 . 1 . . . . . 12 U H2' . 53976 1 84 . 1 . 1 13 13 U H5 H 1 5.729837961 . . 1 . . . . . 12 U H5 . 53976 1 85 . 1 . 1 13 13 U H6 H 1 7.747397487 0.001899522695 . 1 . . . . . 12 U H6 . 53976 1 86 . 1 . 1 13 13 U HO2' H 1 6.598179947 0.002961025035 . 1 . . . . . 12 U HO2' . 53976 1 87 . 1 . 1 13 13 U C1' C 13 94.5429894 . . 1 . . . . . 12 U C1' . 53976 1 88 . 1 . 1 13 13 U C6 C 13 140.6060936 . . 1 . . . . . 12 U C6 . 53976 1 89 . 1 . 1 13 13 U N1 N 15 146.8089426 0.02001961684 . 1 . . . . . 12 U N1 . 53976 1 90 . 1 . 1 14 14 U H1' H 1 6.09680512 0.001586743594 . 1 . . . . . 13 U H1' . 53976 1 91 . 1 . 1 14 14 U H5 H 1 5.852034211 . . 1 . . . . . 13 U H5 . 53976 1 92 . 1 . 1 14 14 U H6 H 1 8.014870388 0.001987595088 . 1 . . . . . 13 U H6 . 53976 1 93 . 1 . 1 14 14 U C1' C 13 89.20847004 . . 1 . . . . . 13 U C1' . 53976 1 94 . 1 . 1 14 14 U C6 C 13 144.6860511 . . 1 . . . . . 13 U C6 . 53976 1 95 . 1 . 1 14 14 U N1 N 15 143.7859805 0 . 1 . . . . . 13 U N1 . 53976 1 96 . 1 . 1 15 15 C H1' H 1 5.947767129 0.004034558342 . 1 . . . . . 14 C H1' . 53976 1 97 . 1 . 1 15 15 C H5 H 1 6.123263348 0.001795570406 . 1 . . . . . 14 C H5 . 53976 1 98 . 1 . 1 15 15 C H6 H 1 7.675402567 0.003208876391 . 1 . . . . . 14 C H6 . 53976 1 99 . 1 . 1 15 15 C H41 H 1 6.286519724 0.0003804193038 . 1 . . . . . 14 C H41 . 53976 1 100 . 1 . 1 15 15 C H42 H 1 7.131971578 0.001181952086 . 1 . . . . . 14 C H42 . 53976 1 101 . 1 . 1 15 15 C C1' C 13 89.07270375 . . 1 . . . . . 14 C C1' . 53976 1 102 . 1 . 1 15 15 C C6 C 13 142.7871482 . . 1 . . . . . 14 C C6 . 53976 1 103 . 1 . 1 15 15 C N1 N 15 150.5125717 0 . 1 . . . . . 14 C N1 . 53976 1 104 . 1 . 1 15 15 C N4 N 15 93.68398947 0.0001355358771 . 1 . . . . . 14 C N4 . 53976 1 105 . 1 . 1 16 16 G H1 H 1 9.861491887 0.002604181642 . 1 . . . . . 15 G H1 . 53976 1 106 . 1 . 1 16 16 G H1' H 1 5.950257974 0.002162966074 . 1 . . . . . 15 G H1' . 53976 1 107 . 1 . 1 16 16 G H8 H 1 7.84863661 0.002587693769 . 1 . . . . . 15 G H8 . 53976 1 108 . 1 . 1 16 16 G C1' C 13 94.56865211 . . 1 . . . . . 15 G C1' . 53976 1 109 . 1 . 1 16 16 G C8 C 13 142.9198593 . . 1 . . . . . 15 G C8 . 53976 1 110 . 1 . 1 16 16 G N1 N 15 143.2892502 . . 1 . . . . . 15 G N1 . 53976 1 111 . 1 . 1 16 16 G N9 N 15 171.5732087 0 . 1 . . . . . 15 G N9 . 53976 1 112 . 1 . 1 17 17 G H1 H 1 12.80362716 0.002108495801 . 1 . . . . . 16 G H1 . 53976 1 113 . 1 . 1 17 17 G H1' H 1 4.428089916 . . 1 . . . . . 16 G H1' . 53976 1 114 . 1 . 1 17 17 G H8 H 1 8.25290144 0.001474459194 . 1 . . . . . 16 G H8 . 53976 1 115 . 1 . 1 17 17 G C1' C 13 93.19331929 . . 1 . . . . . 16 G C1' . 53976 1 116 . 1 . 1 17 17 G C8 C 13 138.7572498 . . 1 . . . . . 16 G C8 . 53976 1 117 . 1 . 1 17 17 G N1 N 15 147.602594 . . 1 . . . . . 16 G N1 . 53976 1 118 . 1 . 1 17 17 G N9 N 15 170.1718355 . . 1 . . . . . 16 G N9 . 53976 1 119 . 1 . 1 18 18 C H1' H 1 5.493344287 0.001730784626 . 1 . . . . . 16A C H1' . 53976 1 120 . 1 . 1 18 18 C H5 H 1 5.173406943 0.001469680151 . 1 . . . . . 16A C H5 . 53976 1 121 . 1 . 1 18 18 C H6 H 1 7.466987838 0.002032825001 . 1 . . . . . 16A C H6 . 53976 1 122 . 1 . 1 18 18 C H41 H 1 6.860020403 0.006980670653 . 1 . . . . . 16A C H41 . 53976 1 123 . 1 . 1 18 18 C H42 H 1 8.506459854 0.004642255246 . 1 . . . . . 16A C H42 . 53976 1 124 . 1 . 1 18 18 C C1' C 13 93.84190535 . . 1 . . . . . 16A C C1' . 53976 1 125 . 1 . 1 18 18 C C6 C 13 140.5234536 . . 1 . . . . . 16A C C6 . 53976 1 126 . 1 . 1 18 18 C N1 N 15 151.1531995 0 . 1 . . . . . 16A C N1 . 53976 1 127 . 1 . 1 18 18 C N4 N 15 99.3938142 0.004154408925 . 1 . . . . . 16A C N4 . 53976 1 128 . 1 . 1 19 19 G H1 H 1 12.16946647 0.002237607883 . 1 . . . . . 17 G H1 . 53976 1 129 . 1 . 1 19 19 G H8 H 1 7.423460183 0.001673315721 . 1 . . . . . 17 G H8 . 53976 1 130 . 1 . 1 19 19 G C8 C 13 136.2311427 . . 1 . . . . . 17 G C8 . 53976 1 131 . 1 . 1 19 19 G N1 N 15 146.9064376 . . 1 . . . . . 17 G N1 . 53976 1 132 . 1 . 1 19 19 G N9 N 15 168.8105015 . . 1 . . . . . 17 G N9 . 53976 1 133 . 1 . 1 20 20 A H1' H 1 5.831095245 0.001465890401 . 1 . . . . . 18 A H1' . 53976 1 134 . 1 . 1 20 20 A H2 H 1 7.931143322 . . 1 . . . . . 18 A H2 . 53976 1 135 . 1 . 1 20 20 A H8 H 1 7.792563005 0.002139787061 . 1 . . . . . 18 A H8 . 53976 1 136 . 1 . 1 20 20 A C1' C 13 92.22996708 . . 1 . . . . . 18 A C1' . 53976 1 137 . 1 . 1 20 20 A C2 C 13 154.3522127 . . 1 . . . . . 18 A C2 . 53976 1 138 . 1 . 1 20 20 A C8 C 13 139.5389302 . . 1 . . . . . 18 A C8 . 53976 1 139 . 1 . 1 20 20 A N9 N 15 170.5922474 0.02001961684 . 1 . . . . . 18 A N9 . 53976 1 140 . 1 . 1 22 22 G H1 H 1 10.83907796 0.003267302424 . 1 . . . . . 20 G H1 . 53976 1 141 . 1 . 1 22 22 G N1 N 15 143.1930988 . . 1 . . . . . 20 G N1 . 53976 1 142 . 1 . 1 23 23 G H1 H 1 13.2709964 0.002190640978 . 1 . . . . . 21 G H1 . 53976 1 143 . 1 . 1 23 23 G H1' H 1 5.729444365 0.001262297508 . 1 . . . . . 21 G H1' . 53976 1 144 . 1 . 1 23 23 G H8 H 1 7.194284239 0.002870183629 . 1 . . . . . 21 G H8 . 53976 1 145 . 1 . 1 23 23 G C1' C 13 93.15208199 . . 1 . . . . . 21 G C1' . 53976 1 146 . 1 . 1 23 23 G C8 C 13 136.1096767 . . 1 . . . . . 21 G C8 . 53976 1 147 . 1 . 1 23 23 G N1 N 15 148.7182325 . . 1 . . . . . 21 G N1 . 53976 1 148 . 1 . 1 23 23 G N9 N 15 169.571247 0 . 1 . . . . . 21 G N9 . 53976 1 149 . 1 . 1 24 24 C H1' H 1 5.567759234 0.001855863713 . 1 . . . . . 22 C H1' . 53976 1 150 . 1 . 1 24 24 C H5 H 1 5.230002498 0.001052494515 . 1 . . . . . 22 C H5 . 53976 1 151 . 1 . 1 24 24 C H6 H 1 7.587767286 0.002963525468 . 1 . . . . . 22 C H6 . 53976 1 152 . 1 . 1 24 24 C H41 H 1 6.831590499 0.00323157601 . 1 . . . . . 22 C H41 . 53976 1 153 . 1 . 1 24 24 C H42 H 1 8.508602168 0.0005506006218 . 1 . . . . . 22 C H42 . 53976 1 154 . 1 . 1 24 24 C C6 C 13 140.4789205 . . 1 . . . . . 22 C C6 . 53976 1 155 . 1 . 1 24 24 C N1 N 15 150.2066941 0.01443624628 . 1 . . . . . 22 C N1 . 53976 1 156 . 1 . 1 24 24 C N4 N 15 98.59146804 0.002645586751 . 1 . . . . . 22 C N4 . 53976 1 157 . 1 . 1 25 25 G H1 H 1 12.93462668 0.002926417761 . 1 . . . . . 23 G H1 . 53976 1 158 . 1 . 1 25 25 G H8 H 1 7.571323884 . . 1 . . . . . 23 G H8 . 53976 1 159 . 1 . 1 25 25 G N1 N 15 147.9313304 . . 1 . . . . . 23 G N1 . 53976 1 160 . 1 . 1 25 25 G N9 N 15 168.7704623 . . 1 . . . . . 23 G N9 . 53976 1 161 . 1 . 1 26 26 C H1' H 1 5.52745534 . . 1 . . . . . 24 C H1' . 53976 1 162 . 1 . 1 26 26 C H5 H 1 5.232672416 0.0003963347065 . 1 . . . . . 24 C H5 . 53976 1 163 . 1 . 1 26 26 C H6 H 1 7.680820396 0.005165107701 . 1 . . . . . 24 C H6 . 53976 1 164 . 1 . 1 26 26 C H41 H 1 6.896829408 0.004818649863 . 1 . . . . . 24 C H41 . 53976 1 165 . 1 . 1 26 26 C H42 H 1 8.576379868 0.005219129675 . 1 . . . . . 24 C H42 . 53976 1 166 . 1 . 1 26 26 C C6 C 13 141.1688865 . . 1 . . . . . 24 C C6 . 53976 1 167 . 1 . 1 26 26 C N1 N 15 151.1732191 0.02001961684 . 1 . . . . . 24 C N1 . 53976 1 168 . 1 . 1 26 26 C N4 N 15 99.17665156 0.00192408089 . 1 . . . . . 24 C N4 . 53976 1 169 . 1 . 1 27 27 C H1' H 1 5.766762258 0.00154224458 . 1 . . . . . 25 C H1' . 53976 1 170 . 1 . 1 27 27 C H5 H 1 5.529110724 0.002961060221 . 1 . . . . . 25 C H5 . 53976 1 171 . 1 . 1 27 27 C H6 H 1 7.667310255 0.00141062951 . 1 . . . . . 25 C H6 . 53976 1 172 . 1 . 1 27 27 C H41 H 1 6.99477013 0.001485427262 . 1 . . . . . 25 C H41 . 53976 1 173 . 1 . 1 27 27 C H42 H 1 8.36759841 0.000633117978 . 1 . . . . . 25 C H42 . 53976 1 174 . 1 . 1 27 27 C C1' C 13 92.98230607 . . 1 . . . . . 25 C C1' . 53976 1 175 . 1 . 1 27 27 C C6 C 13 141.6978279 . . 1 . . . . . 25 C C6 . 53976 1 176 . 1 . 1 27 27 C N1 N 15 152.434455 0 . 1 . . . . . 25 C N1 . 53976 1 177 . 1 . 1 27 27 C N4 N 15 97.53136041 0.00000539 . 1 . . . . . 25 C N4 . 53976 1 stop_ save_