data_53720 ####################### # Entry information # ####################### save_entry_information_1 _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information_1 _Entry.ID 53720 _Entry.Title ; Solution NMR chemical shift assignments for a construct of the top fragment of 7SK SL3 RNA in the SL3e state at pH 7.5 ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2026-04-14 _Entry.Accession_date 2026-04-14 _Entry.Last_release_date 2026-04-14 _Entry.Original_release_date 2026-04-14 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID 1 _Entry.Generated_software_label $software_1 _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details 'Solution NMR chemical shift assignments for the upper region of 7SK SL3e RNA (SL3e-top)' _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Shilla 'Owusu Ansah' . . . 0000-0003-0870-1373 53720 2 Momodou Camara . B. . 0000-0003-0922-4943 53720 3 Catherine Eichhorn . D. . 0000-0001-8624-1961 53720 stop_ loop_ _Entry_src.ID _Entry_src.Project_name _Entry_src.Organization_full_name _Entry_src.Organization_initials _Entry_src.Entry_ID 1 . 'University of Nebraska Lincoln' . 53720 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 2 53720 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 92 53720 '15N chemical shifts' 9 53720 '1H chemical shifts' 212 53720 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2026-04-28 . original BMRB . 53720 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 53721 7SK_SL3e-top_pH75_10eq-Mg 53720 stop_ save_ ############### # Citations # ############### save_citations_1 _Citation.Sf_category citations _Citation.Sf_framecode citations_1 _Citation.Entry_ID 53720 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID . _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Quantifying Mg2+ dependence on conformational equilibrium in the two-state 7SK RNA stem-loop 3 ; _Citation.Status submitted _Citation.Type journal _Citation.Journal_abbrev 'Nucleic Acids Res.' _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year . _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Shilla 'Owusu Ansah' . . . . 53720 1 2 Momodou Camara . B. . . 53720 1 3 Catherine Eichhorn . D. . . 53720 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly_1 _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly_1 _Assembly.Entry_ID 53720 _Assembly.ID 1 _Assembly.Name '7SK SL3e-top RNA' _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands 0 _Assembly.Metal_ions 0 _Assembly.Non_standard_bonds no _Assembly.Ambiguous_conformational_states no _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange no _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 '7SK SL3e-top RNA' 1 $entity_1 . . yes native no no . . . 53720 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 53720 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGCCUCCAAACAAGCUCUCA AGGUCCAUUUGUAGGCC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 37 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 219 G . 53720 1 2 220 G . 53720 1 3 221 C . 53720 1 4 222 C . 53720 1 5 223 U . 53720 1 6 224 C . 53720 1 7 225 C . 53720 1 8 226 A . 53720 1 9 227 A . 53720 1 10 228 A . 53720 1 11 229 C . 53720 1 12 230 A . 53720 1 13 231 A . 53720 1 14 232 G . 53720 1 15 233 C . 53720 1 16 234 U . 53720 1 17 235 C . 53720 1 18 236 U . 53720 1 19 237 C . 53720 1 20 238 A . 53720 1 21 239 A . 53720 1 22 240 G . 53720 1 23 241 G . 53720 1 24 242 U . 53720 1 25 243 C . 53720 1 26 244 C . 53720 1 27 245 A . 53720 1 28 246 U . 53720 1 29 247 U . 53720 1 30 248 U . 53720 1 31 249 G . 53720 1 32 250 U . 53720 1 33 251 A . 53720 1 34 252 G . 53720 1 35 253 G . 53720 1 36 254 C . 53720 1 37 255 C . 53720 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 53720 1 . G 2 2 53720 1 . C 3 3 53720 1 . C 4 4 53720 1 . U 5 5 53720 1 . C 6 6 53720 1 . C 7 7 53720 1 . A 8 8 53720 1 . A 9 9 53720 1 . A 10 10 53720 1 . C 11 11 53720 1 . A 12 12 53720 1 . A 13 13 53720 1 . G 14 14 53720 1 . C 15 15 53720 1 . U 16 16 53720 1 . C 17 17 53720 1 . U 18 18 53720 1 . C 19 19 53720 1 . A 20 20 53720 1 . A 21 21 53720 1 . G 22 22 53720 1 . G 23 23 53720 1 . U 24 24 53720 1 . C 25 25 53720 1 . C 26 26 53720 1 . A 27 27 53720 1 . U 28 28 53720 1 . U 29 29 53720 1 . U 30 30 53720 1 . G 31 31 53720 1 . U 32 32 53720 1 . A 33 33 53720 1 . G 34 34 53720 1 . G 35 35 53720 1 . C 36 36 53720 1 . C 37 37 53720 1 stop_ save_ #################### # Natural source # #################### save_natural_source_1 _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source_1 _Entity_natural_src_list.Entry_ID 53720 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 9606 organism . 'Homo sapiens' Human . . Eukaryota Metazoa Homo sapiens . . . . . . . . . . . . . 53720 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source_1 _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source_1 _Entity_experimental_src_list.Entry_ID 53720 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' . . . . . . . . . . . . . . . . 53720 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 53720 _Sample.ID 1 _Sample.Name '7SK SL3e-top RNA' _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '95% H2O/5% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 '7SK SL3e-top RNA' '[U-100% 15N]' . . 1 $entity_1 . . 0.65 0.5 0.8 mM . . . . 53720 1 2 '7SK SL3e-top RNA' '[U-100% 13C]' . . 1 $entity_1 . . 0.65 0.5 0.8 mM . . . . 53720 1 3 '7SK SL3e-top RNA' 'natural abundance' . . 1 $entity_1 . . 0.65 0.5 0.8 mM . . . . 53720 1 4 D2O '[U-100% 2H]' . . . . . . 5 . . % . . . . 53720 1 5 'sodium phosphate' 'natural abundance' . . . . . . 20 . . mM . . . . 53720 1 6 KCl 'natural abundance' . . . . . . 50 . . mM . . . . 53720 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 53720 _Sample_condition_list.ID 1 _Sample_condition_list.Name '20mM sodium phosphate, 50 mM KCl, pH7.5' _Sample_condition_list.Details '278.1-313.1 K' loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 0.07 . M 53720 1 pH 7.5 . pH 53720 1 pressure 1 . atm 53720 1 temperature 298.1 . K 53720 1 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 53720 _Sample_condition_list.ID 2 _Sample_condition_list.Name '20mM sodium phosphate, 50 mM KCl, pH7.5' _Sample_condition_list.Details '278.1-313.1 K' loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 0.07 . M 53720 2 pH 7.5 . pH 53720 2 pressure 1 . atm 53720 2 temperature 313.1 . K 53720 2 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 53720 _Software.ID 1 _Software.Type . _Software.Name NMRFAM-SPARKY _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 53720 1 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 53720 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name 'Bruker AVANCE NEO 600 MHz' _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE NEO' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 53720 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '1D 1H' no no . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53720 1 2 '2D 1H-1H NOESY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53720 1 3 '2D 1H-13C HSQC' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53720 1 4 '2D 1H-15N HSQC' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53720 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 53720 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name 7SK_SL3e-top_pH75_no-MgCl2_25C _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 water protons . . . . ppm 0 na indirect . . . . . . 53720 1 H 1 water protons . . . . ppm 0 na direct 1 . . . . . 53720 1 N 15 water protons . . . . ppm 0 na indirect . . . . . . 53720 1 stop_ save_ save_chem_shift_reference_2 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_2 _Chem_shift_reference.Entry_ID 53720 _Chem_shift_reference.ID 2 _Chem_shift_reference.Name 7SK_SL3e-top_pH75_no-MgCl2_40C _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 water protons . . . . ppm 0 na indirect . . . . . . 53720 2 H 1 water protons . . . . ppm 0 na direct 1 . . . . . 53720 2 N 15 water protons . . . . ppm 0 na indirect . . . . . . 53720 2 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 53720 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name 7SK_SL3e-top_pH75_no-MgCl2_25C _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 2 '2D 1H-1H NOESY' . . . 53720 1 3 '2D 1H-13C HSQC' . . . 53720 1 4 '2D 1H-15N HSQC' . . . 53720 1 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 1 $software_1 . . 53720 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 G H1' H 1 4.925 0.00 . . . . . . . 219 G H1' . 53720 1 2 . 1 . 1 1 1 G H8 H 1 8.139 0.00 . . . . . . . 219 G H8 . 53720 1 3 . 1 . 1 1 1 G C8 C 13 139.108 0.00 . . . . . . . 219 G C8 . 53720 1 4 . 1 . 1 2 2 G H1 H 1 13.439 0.00 . . . . . . . 220 G H1 . 53720 1 5 . 1 . 1 2 2 G H1' H 1 5.800 0.00 . . . . . . . 220 G H1' . 53720 1 6 . 1 . 1 2 2 G H8 H 1 7.689 0.00 . . . . . . . 220 G H8 . 53720 1 7 . 1 . 1 2 2 G C8 C 13 136.977 0.00 . . . . . . . 220 G C8 . 53720 1 8 . 1 . 1 2 2 G N1 N 15 148.658 0.00 . . . . . . . 220 G N1 . 53720 1 9 . 1 . 1 3 3 C H5 H 1 5.265 0.00 . . . . . . . 221 C H5 . 53720 1 10 . 1 . 1 3 3 C H6 H 1 7.696 0.00 . . . . . . . 221 C H6 . 53720 1 11 . 1 . 1 3 3 C H41 H 1 8.664 0.00 . . . . . . . 221 C H41 . 53720 1 12 . 1 . 1 3 3 C H42 H 1 6.872 0.00 . . . . . . . 221 C H42 . 53720 1 13 . 1 . 1 3 3 C C6 C 13 140.964 0.00 . . . . . . . 221 C C6 . 53720 1 14 . 1 . 1 4 4 C H5 H 1 5.536 0.00 . . . . . . . 222 C H5 . 53720 1 15 . 1 . 1 4 4 C H6 H 1 7.727 0.00 . . . . . . . 222 C H6 . 53720 1 16 . 1 . 1 4 4 C H41 H 1 8.507 0.00 . . . . . . . 222 C H41 . 53720 1 17 . 1 . 1 4 4 C H42 H 1 6.885 0.00 . . . . . . . 222 C H42 . 53720 1 18 . 1 . 1 4 4 C C6 C 13 141.255 0.00 . . . . . . . 222 C C6 . 53720 1 19 . 1 . 1 5 5 U H1' H 1 5.497 0.00 . . . . . . . 223 U H1' . 53720 1 20 . 1 . 1 5 5 U H5 H 1 5.387 0.00 . . . . . . . 223 U H5 . 53720 1 21 . 1 . 1 5 5 U H6 H 1 7.848 0.00 . . . . . . . 223 U H6 . 53720 1 22 . 1 . 1 5 5 U C6 C 13 142.310 0.01 . . . . . . . 223 U C6 . 53720 1 23 . 1 . 1 6 6 C H1' H 1 5.518 0.00 . . . . . . . 224 C H1' . 53720 1 24 . 1 . 1 6 6 C H5 H 1 5.605 0.00 . . . . . . . 224 C H5 . 53720 1 25 . 1 . 1 6 6 C H6 H 1 7.678 0.00 . . . . . . . 224 C H6 . 53720 1 26 . 1 . 1 6 6 C C6 C 13 141.497 0.00 . . . . . . . 224 C C6 . 53720 1 27 . 1 . 1 7 7 C H1' H 1 5.460 0.00 . . . . . . . 225 C H1' . 53720 1 28 . 1 . 1 7 7 C H5 H 1 5.665 0.00 . . . . . . . 225 C H5 . 53720 1 29 . 1 . 1 7 7 C H6 H 1 7.782 0.00 . . . . . . . 225 C H6 . 53720 1 30 . 1 . 1 7 7 C H41 H 1 8.169 0.00 . . . . . . . 225 C H41 . 53720 1 31 . 1 . 1 7 7 C H42 H 1 7.019 0.00 . . . . . . . 225 C H42 . 53720 1 32 . 1 . 1 7 7 C C6 C 13 140.610 0.00 . . . . . . . 225 C C6 . 53720 1 33 . 1 . 1 8 8 A H1' H 1 5.830 0.00 . . . . . . . 226 A H1' . 53720 1 34 . 1 . 1 8 8 A H2 H 1 6.686 0.00 . . . . . . . 226 A H2 . 53720 1 35 . 1 . 1 8 8 A H8 H 1 7.986 0.00 . . . . . . . 226 A H8 . 53720 1 36 . 1 . 1 8 8 A C2 C 13 152.137 0.00 . . . . . . . 226 A C2 . 53720 1 37 . 1 . 1 8 8 A C8 C 13 139.597 0.00 . . . . . . . 226 A C8 . 53720 1 38 . 1 . 1 9 9 A H1' H 1 5.755 0.00 . . . . . . . 227 A H1' . 53720 1 39 . 1 . 1 9 9 A H2 H 1 7.187 0.00 . . . . . . . 227 A H2 . 53720 1 40 . 1 . 1 9 9 A H8 H 1 7.597 0.00 . . . . . . . 227 A H8 . 53720 1 41 . 1 . 1 9 9 A C2 C 13 152.750 0.00 . . . . . . . 227 A C2 . 53720 1 42 . 1 . 1 9 9 A C8 C 13 139.070 0.00 . . . . . . . 227 A C8 . 53720 1 43 . 1 . 1 10 10 A H1' H 1 5.742 0.00 . . . . . . . 228 A H1' . 53720 1 44 . 1 . 1 10 10 A H2 H 1 7.745 0.00 . . . . . . . 228 A H2 . 53720 1 45 . 1 . 1 10 10 A H8 H 1 7.389 0.00 . . . . . . . 228 A H8 . 53720 1 46 . 1 . 1 10 10 A C2 C 13 154.076 0.00 . . . . . . . 228 A C2 . 53720 1 47 . 1 . 1 10 10 A C8 C 13 138.741 0.00 . . . . . . . 228 A C8 . 53720 1 48 . 1 . 1 11 11 C H1' H 1 5.166 0.00 . . . . . . . 229 C H1' . 53720 1 49 . 1 . 1 11 11 C H5 H 1 5.354 0.00 . . . . . . . 229 C H5 . 53720 1 50 . 1 . 1 11 11 C H6 H 1 7.386 0.00 . . . . . . . 229 C H6 . 53720 1 51 . 1 . 1 11 11 C C6 C 13 140.970 0.00 . . . . . . . 229 C C6 . 53720 1 52 . 1 . 1 12 12 A H2 H 1 7.569 0.00 . . . . . . . 230 A H2 . 53720 1 53 . 1 . 1 12 12 A H8 H 1 8.024 0.00 . . . . . . . 230 A H8 . 53720 1 54 . 1 . 1 12 12 A C2 C 13 154.060 0.00 . . . . . . . 230 A C2 . 53720 1 55 . 1 . 1 12 12 A C8 C 13 140.701 0.00 . . . . . . . 230 A C8 . 53720 1 56 . 1 . 1 13 13 A H1' H 1 5.670 0.00 . . . . . . . 231 A H1' . 53720 1 57 . 1 . 1 13 13 A H2 H 1 7.911 0.01 . . . . . . . 231 A H2 . 53720 1 58 . 1 . 1 13 13 A H8 H 1 7.873 0.00 . . . . . . . 231 A H8 . 53720 1 59 . 1 . 1 13 13 A C2 C 13 154.224 0.00 . . . . . . . 231 A C2 . 53720 1 60 . 1 . 1 13 13 A C8 C 13 139.890 0.00 . . . . . . . 231 A C8 . 53720 1 61 . 1 . 1 14 14 G H1' H 1 5.251 0.00 . . . . . . . 232 G H1' . 53720 1 62 . 1 . 1 14 14 G H8 H 1 7.165 0.00 . . . . . . . 232 G H8 . 53720 1 63 . 1 . 1 14 14 G C8 C 13 136.542 0.00 . . . . . . . 232 G C8 . 53720 1 64 . 1 . 1 15 15 C H1' H 1 5.526 0.00 . . . . . . . 233 C H1' . 53720 1 65 . 1 . 1 15 15 C H5 H 1 5.313 0.03 . . . . . . . 233 C H5 . 53720 1 66 . 1 . 1 15 15 C H6 H 1 7.557 0.00 . . . . . . . 233 C H6 . 53720 1 67 . 1 . 1 15 15 C C6 C 13 140.942 0.01 . . . . . . . 233 C C6 . 53720 1 68 . 1 . 1 16 16 U H6 H 1 7.681 0.00 . . . . . . . 234 U H6 . 53720 1 69 . 1 . 1 16 16 U C6 C 13 141.167 0.00 . . . . . . . 234 U C6 . 53720 1 70 . 1 . 1 17 17 C H5 H 1 5.793 0.00 . . . . . . . 235 C H5 . 53720 1 71 . 1 . 1 17 17 C H6 H 1 7.598 0.00 . . . . . . . 235 C H6 . 53720 1 72 . 1 . 1 17 17 C C6 C 13 143.144 0.01 . . . . . . . 235 C C6 . 53720 1 73 . 1 . 1 18 18 U H5 H 1 5.675 0.00 . . . . . . . 236 U H5 . 53720 1 74 . 1 . 1 18 18 U H6 H 1 7.718 0.00 . . . . . . . 236 U H6 . 53720 1 75 . 1 . 1 18 18 U C6 C 13 143.138 0.00 . . . . . . . 236 U C6 . 53720 1 76 . 1 . 1 19 19 C H5 H 1 5.800 0.00 . . . . . . . 237 C H5 . 53720 1 77 . 1 . 1 19 19 C H6 H 1 7.839 0.00 . . . . . . . 237 C H6 . 53720 1 78 . 1 . 1 19 19 C C6 C 13 142.317 0.00 . . . . . . . 237 C C6 . 53720 1 79 . 1 . 1 20 20 A H2 H 1 7.928 0.00 . . . . . . . 238 A H2 . 53720 1 80 . 1 . 1 20 20 A H8 H 1 8.143 0.00 . . . . . . . 238 A H8 . 53720 1 81 . 1 . 1 20 20 A C2 C 13 154.933 0.00 . . . . . . . 238 A C2 . 53720 1 82 . 1 . 1 20 20 A C8 C 13 141.487 0.00 . . . . . . . 238 A C8 . 53720 1 83 . 1 . 1 21 21 A H1' H 1 5.845 0.00 . . . . . . . 239 A H1' . 53720 1 84 . 1 . 1 21 21 A H2 H 1 8.016 0.00 . . . . . . . 239 A H2 . 53720 1 85 . 1 . 1 21 21 A H8 H 1 8.123 0.01 . . . . . . . 239 A H8 . 53720 1 86 . 1 . 1 21 21 A C2 C 13 154.963 0.00 . . . . . . . 239 A C2 . 53720 1 87 . 1 . 1 21 21 A C8 C 13 141.245 0.00 . . . . . . . 239 A C8 . 53720 1 88 . 1 . 1 22 22 G H1' H 1 5.152 0.00 . . . . . . . 240 G H1' . 53720 1 89 . 1 . 1 22 22 G H8 H 1 7.623 0.00 . . . . . . . 240 G H8 . 53720 1 90 . 1 . 1 22 22 G C8 C 13 137.897 0.00 . . . . . . . 240 G C8 . 53720 1 91 . 1 . 1 23 23 G H1' H 1 5.718 0.00 . . . . . . . 241 G H1' . 53720 1 92 . 1 . 1 23 23 G H8 H 1 7.266 0.00 . . . . . . . 241 G H8 . 53720 1 93 . 1 . 1 23 23 G C8 C 13 136.674 0.00 . . . . . . . 241 G C8 . 53720 1 94 . 1 . 1 24 24 U H1' H 1 5.592 0.00 . . . . . . . 242 U H1' . 53720 1 95 . 1 . 1 24 24 U H5 H 1 5.330 0.03 . . . . . . . 242 U H5 . 53720 1 96 . 1 . 1 24 24 U H6 H 1 7.557 0.00 . . . . . . . 242 U H6 . 53720 1 97 . 1 . 1 24 24 U C6 C 13 140.668 0.01 . . . . . . . 242 U C6 . 53720 1 98 . 1 . 1 25 25 C H5 H 1 5.667 0.00 . . . . . . . 243 C H5 . 53720 1 99 . 1 . 1 25 25 C H6 H 1 7.817 0.00 . . . . . . . 243 C H6 . 53720 1 100 . 1 . 1 25 25 C C6 C 13 142.065 0.00 . . . . . . . 243 C C6 . 53720 1 101 . 1 . 1 26 26 C H1' H 1 5.720 0.00 . . . . . . . 244 C H1' . 53720 1 102 . 1 . 1 26 26 C H5 H 1 5.671 0.01 . . . . . . . 244 C H5 . 53720 1 103 . 1 . 1 26 26 C H6 H 1 7.737 0.00 . . . . . . . 244 C H6 . 53720 1 104 . 1 . 1 26 26 C C6 C 13 142.084 0.01 . . . . . . . 244 C C6 . 53720 1 105 . 1 . 1 27 27 A H1' H 1 5.807 0.00 . . . . . . . 245 A H1' . 53720 1 106 . 1 . 1 27 27 A H2 H 1 7.652 0.01 . . . . . . . 245 A H2 . 53720 1 107 . 1 . 1 27 27 A H8 H 1 8.087 0.00 . . . . . . . 245 A H8 . 53720 1 108 . 1 . 1 27 27 A C2 C 13 153.669 0.00 . . . . . . . 245 A C2 . 53720 1 109 . 1 . 1 27 27 A C8 C 13 140.634 0.00 . . . . . . . 245 A C8 . 53720 1 110 . 1 . 1 28 28 U H1' H 1 4.982 0.00 . . . . . . . 246 U H1' . 53720 1 111 . 1 . 1 28 28 U H5 H 1 5.405 0.00 . . . . . . . 246 U H5 . 53720 1 112 . 1 . 1 28 28 U H6 H 1 7.452 0.00 . . . . . . . 246 U H6 . 53720 1 113 . 1 . 1 28 28 U C6 C 13 141.166 0.01 . . . . . . . 246 U C6 . 53720 1 114 . 1 . 1 29 29 U H1' H 1 5.608 0.00 . . . . . . . 247 U H1' . 53720 1 115 . 1 . 1 29 29 U H5 H 1 5.578 0.00 . . . . . . . 247 U H5 . 53720 1 116 . 1 . 1 29 29 U H6 H 1 7.910 0.00 . . . . . . . 247 U H6 . 53720 1 117 . 1 . 1 29 29 U C6 C 13 142.584 0.01 . . . . . . . 247 U C6 . 53720 1 118 . 1 . 1 30 30 U H1' H 1 5.552 0.00 . . . . . . . 248 U H1' . 53720 1 119 . 1 . 1 30 30 U H3 H 1 13.120 0.00 . . . . . . . 248 U H3 . 53720 1 120 . 1 . 1 30 30 U H5 H 1 5.530 0.00 . . . . . . . 248 U H5 . 53720 1 121 . 1 . 1 30 30 U H6 H 1 7.860 0.00 . . . . . . . 248 U H6 . 53720 1 122 . 1 . 1 30 30 U C6 C 13 142.056 0.01 . . . . . . . 248 U C6 . 53720 1 123 . 1 . 1 30 30 U N3 N 15 162.337 0.00 . . . . . . . 248 U N3 . 53720 1 124 . 1 . 1 31 31 G H1 H 1 12.356 0.00 . . . . . . . 249 G H1 . 53720 1 125 . 1 . 1 31 31 G H1' H 1 5.676 0.00 . . . . . . . 249 G H1' . 53720 1 126 . 1 . 1 31 31 G H8 H 1 7.684 0.00 . . . . . . . 249 G H8 . 53720 1 127 . 1 . 1 31 31 G C8 C 13 136.820 0.00 . . . . . . . 249 G C8 . 53720 1 128 . 1 . 1 31 31 G N1 N 15 147.350 0.00 . . . . . . . 249 G N1 . 53720 1 129 . 1 . 1 32 32 U H1' H 1 5.530 0.00 . . . . . . . 250 U H1' . 53720 1 130 . 1 . 1 32 32 U H5 H 1 4.901 0.00 . . . . . . . 250 U H5 . 53720 1 131 . 1 . 1 32 32 U H6 H 1 7.456 0.00 . . . . . . . 250 U H6 . 53720 1 132 . 1 . 1 32 32 U C6 C 13 140.877 0.01 . . . . . . . 250 U C6 . 53720 1 133 . 1 . 1 33 33 A H1' H 1 5.992 0.00 . . . . . . . 251 A H1' . 53720 1 134 . 1 . 1 33 33 A H2 H 1 7.295 0.00 . . . . . . . 251 A H2 . 53720 1 135 . 1 . 1 33 33 A H8 H 1 7.948 0.00 . . . . . . . 251 A H8 . 53720 1 136 . 1 . 1 33 33 A C2 C 13 153.397 0.00 . . . . . . . 251 A C2 . 53720 1 137 . 1 . 1 33 33 A C8 C 13 139.021 0.00 . . . . . . . 251 A C8 . 53720 1 138 . 1 . 1 34 34 G H1 H 1 12.891 0.00 . . . . . . . 252 G H1 . 53720 1 139 . 1 . 1 34 34 G H1' H 1 5.625 0.00 . . . . . . . 252 G H1' . 53720 1 140 . 1 . 1 34 34 G H8 H 1 7.181 0.00 . . . . . . . 252 G H8 . 53720 1 141 . 1 . 1 34 34 G C8 C 13 135.706 0.00 . . . . . . . 252 G C8 . 53720 1 142 . 1 . 1 34 34 G N1 N 15 147.494 0.00 . . . . . . . 252 G N1 . 53720 1 143 . 1 . 1 35 35 G H1 H 1 13.314 0.00 . . . . . . . 253 G H1 . 53720 1 144 . 1 . 1 35 35 G H1' H 1 5.728 0.00 . . . . . . . 253 G H1' . 53720 1 145 . 1 . 1 35 35 G H8 H 1 7.227 0.00 . . . . . . . 253 G H8 . 53720 1 146 . 1 . 1 35 35 G C8 C 13 135.907 0.00 . . . . . . . 253 G C8 . 53720 1 147 . 1 . 1 35 35 G N1 N 15 148.917 0.00 . . . . . . . 253 G N1 . 53720 1 148 . 1 . 1 36 36 C H1' H 1 5.538 0.00 . . . . . . . 254 C H1' . 53720 1 149 . 1 . 1 36 36 C H5 H 1 5.196 0.00 . . . . . . . 254 C H5 . 53720 1 150 . 1 . 1 36 36 C H6 H 1 7.616 0.00 . . . . . . . 254 C H6 . 53720 1 151 . 1 . 1 36 36 C H41 H 1 8.639 0.00 . . . . . . . 254 C H41 . 53720 1 152 . 1 . 1 36 36 C H42 H 1 6.910 0.00 . . . . . . . 254 C H42 . 53720 1 153 . 1 . 1 36 36 C C6 C 13 140.987 0.00 . . . . . . . 254 C C6 . 53720 1 154 . 1 . 1 37 37 C H5 H 1 5.543 0.00 . . . . . . . 255 C H5 . 53720 1 155 . 1 . 1 37 37 C H6 H 1 7.678 0.00 . . . . . . . 255 C H6 . 53720 1 156 . 1 . 1 37 37 C H41 H 1 8.397 0.00 . . . . . . . 255 C H41 . 53720 1 157 . 1 . 1 37 37 C H42 H 1 7.013 0.00 . . . . . . . 255 C H42 . 53720 1 158 . 1 . 1 37 37 C C6 C 13 141.639 0.01 . . . . . . . 255 C C6 . 53720 1 stop_ save_ save_assigned_chemical_shifts_2 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_2 _Assigned_chem_shift_list.Entry_ID 53720 _Assigned_chem_shift_list.ID 2 _Assigned_chem_shift_list.Name 7SK_SL3e-top_pH75_no-MgCl2_40C _Assigned_chem_shift_list.Sample_condition_list_ID 2 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_2 _Assigned_chem_shift_list.Chem_shift_reference_ID 2 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_2 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 2 '2D 1H-1H NOESY' . . . 53720 2 3 '2D 1H-13C HSQC' . . . 53720 2 4 '2D 1H-15N HSQC' . . . 53720 2 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 1 $software_1 . . 53720 2 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 G H1' H 1 4.922 0.00 . . . . . . . 219 G H1' . 53720 2 2 . 1 . 1 1 1 G H8 H 1 8.127 0.00 . . . . . . . 219 G H8 . 53720 2 3 . 1 . 1 1 1 G C8 C 13 139.116 0.00 . . . . . . . 219 G C8 . 53720 2 4 . 1 . 1 2 2 G H1 H 1 13.393 0.00 . . . . . . . 220 G H1 . 53720 2 5 . 1 . 1 2 2 G H1' H 1 5.806 0.00 . . . . . . . 220 G H1' . 53720 2 6 . 1 . 1 2 2 G H8 H 1 7.684 0.00 . . . . . . . 220 G H8 . 53720 2 7 . 1 . 1 2 2 G C8 C 13 137.090 0.00 . . . . . . . 220 G C8 . 53720 2 8 . 1 . 1 2 2 G N1 N 15 148.671 0.00 . . . . . . . 220 G N1 . 53720 2 9 . 1 . 1 3 3 C H5 H 1 5.279 0.00 . . . . . . . 221 C H5 . 53720 2 10 . 1 . 1 3 3 C H6 H 1 7.682 0.00 . . . . . . . 221 C H6 . 53720 2 11 . 1 . 1 3 3 C H41 H 1 8.634 0.00 . . . . . . . 221 C H41 . 53720 2 12 . 1 . 1 3 3 C H42 H 1 6.796 0.00 . . . . . . . 221 C H42 . 53720 2 13 . 1 . 1 3 3 C C6 C 13 141.065 0.00 . . . . . . . 221 C C6 . 53720 2 14 . 1 . 1 4 4 C H5 H 1 5.548 0.00 . . . . . . . 222 C H5 . 53720 2 15 . 1 . 1 4 4 C H6 H 1 7.719 0.00 . . . . . . . 222 C H6 . 53720 2 16 . 1 . 1 4 4 C H41 H 1 8.479 0.00 . . . . . . . 222 C H41 . 53720 2 17 . 1 . 1 4 4 C H42 H 1 6.814 0.00 . . . . . . . 222 C H42 . 53720 2 18 . 1 . 1 4 4 C C6 C 13 141.329 0.00 . . . . . . . 222 C C6 . 53720 2 19 . 1 . 1 5 5 U H1' H 1 5.527 0.00 . . . . . . . 223 U H1' . 53720 2 20 . 1 . 1 5 5 U H5 H 1 5.395 0.00 . . . . . . . 223 U H5 . 53720 2 21 . 1 . 1 5 5 U H6 H 1 7.835 0.00 . . . . . . . 223 U H6 . 53720 2 22 . 1 . 1 5 5 U C6 C 13 142.315 0.03 . . . . . . . 223 U C6 . 53720 2 23 . 1 . 1 6 6 C H1' H 1 5.531 0.00 . . . . . . . 224 C H1' . 53720 2 24 . 1 . 1 6 6 C H5 H 1 5.580 0.08 . . . . . . . 224 C H5 . 53720 2 25 . 1 . 1 6 6 C H6 H 1 7.682 0.02 . . . . . . . 224 C H6 . 53720 2 26 . 1 . 1 6 6 C C6 C 13 141.625 0.01 . . . . . . . 224 C C6 . 53720 2 27 . 1 . 1 7 7 C H1' H 1 5.470 0.00 . . . . . . . 225 C H1' . 53720 2 28 . 1 . 1 7 7 C H5 H 1 5.665 0.00 . . . . . . . 225 C H5 . 53720 2 29 . 1 . 1 7 7 C H6 H 1 7.766 0.00 . . . . . . . 225 C H6 . 53720 2 30 . 1 . 1 7 7 C H42 H 1 6.932 0.00 . . . . . . . 225 C H42 . 53720 2 31 . 1 . 1 7 7 C C6 C 13 140.804 0.00 . . . . . . . 225 C C6 . 53720 2 32 . 1 . 1 8 8 A H1' H 1 5.838 0.00 . . . . . . . 226 A H1' . 53720 2 33 . 1 . 1 8 8 A H2 H 1 6.762 0.00 . . . . . . . 226 A H2 . 53720 2 34 . 1 . 1 8 8 A H8 H 1 7.985 0.00 . . . . . . . 226 A H8 . 53720 2 35 . 1 . 1 8 8 A C2 C 13 152.341 0.00 . . . . . . . 226 A C2 . 53720 2 36 . 1 . 1 8 8 A C8 C 13 139.718 0.00 . . . . . . . 226 A C8 . 53720 2 37 . 1 . 1 9 9 A H1' H 1 5.749 0.00 . . . . . . . 227 A H1' . 53720 2 38 . 1 . 1 9 9 A H2 H 1 7.261 0.00 . . . . . . . 227 A H2 . 53720 2 39 . 1 . 1 9 9 A H8 H 1 7.604 0.00 . . . . . . . 227 A H8 . 53720 2 40 . 1 . 1 9 9 A C2 C 13 153.002 0.00 . . . . . . . 227 A C2 . 53720 2 41 . 1 . 1 9 9 A C8 C 13 139.208 0.00 . . . . . . . 227 A C8 . 53720 2 42 . 1 . 1 10 10 A H1' H 1 5.722 0.02 . . . . . . . 228 A H1' . 53720 2 43 . 1 . 1 10 10 A H2 H 1 7.765 0.00 . . . . . . . 228 A H2 . 53720 2 44 . 1 . 1 10 10 A H8 H 1 7.463 0.00 . . . . . . . 228 A H8 . 53720 2 45 . 1 . 1 10 10 A C2 C 13 154.351 0.00 . . . . . . . 228 A C2 . 53720 2 46 . 1 . 1 10 10 A C8 C 13 139.040 0.00 . . . . . . . 228 A C8 . 53720 2 47 . 1 . 1 11 11 C H1' H 1 5.282 0.00 . . . . . . . 229 C H1' . 53720 2 48 . 1 . 1 11 11 C H5 H 1 5.363 0.00 . . . . . . . 229 C H5 . 53720 2 49 . 1 . 1 11 11 C H6 H 1 7.385 0.00 . . . . . . . 229 C H6 . 53720 2 50 . 1 . 1 11 11 C C6 C 13 141.351 0.00 . . . . . . . 229 C C6 . 53720 2 51 . 1 . 1 12 12 A H1' H 1 5.785 0.00 . . . . . . . 230 A H1' . 53720 2 52 . 1 . 1 12 12 A H2 H 1 7.643 0.00 . . . . . . . 230 A H2 . 53720 2 53 . 1 . 1 12 12 A H8 H 1 8.044 0.00 . . . . . . . 230 A H8 . 53720 2 54 . 1 . 1 12 12 A C2 C 13 154.359 0.00 . . . . . . . 230 A C2 . 53720 2 55 . 1 . 1 12 12 A C8 C 13 140.924 0.00 . . . . . . . 230 A C8 . 53720 2 56 . 1 . 1 13 13 A H1' H 1 5.741 0.00 . . . . . . . 231 A H1' . 53720 2 57 . 1 . 1 13 13 A H2 H 1 7.934 0.00 . . . . . . . 231 A H2 . 53720 2 58 . 1 . 1 13 13 A H8 H 1 7.897 0.00 . . . . . . . 231 A H8 . 53720 2 59 . 1 . 1 13 13 A C2 C 13 154.596 0.00 . . . . . . . 231 A C2 . 53720 2 60 . 1 . 1 13 13 A C8 C 13 140.164 0.00 . . . . . . . 231 A C8 . 53720 2 61 . 1 . 1 14 14 G H1 H 1 5.350 0.00 . . . . . . . 232 G H1 . 53720 2 62 . 1 . 1 14 14 G H1' H 1 5.356 0.00 . . . . . . . 232 G H1' . 53720 2 63 . 1 . 1 14 14 G H8 H 1 7.351 0.01 . . . . . . . 232 G H8 . 53720 2 64 . 1 . 1 14 14 G C8 C 13 136.938 0.00 . . . . . . . 232 G C8 . 53720 2 65 . 1 . 1 15 15 C H5 H 1 5.386 0.00 . . . . . . . 233 C H5 . 53720 2 66 . 1 . 1 15 15 C H6 H 1 7.594 0.00 . . . . . . . 233 C H6 . 53720 2 67 . 1 . 1 15 15 C C6 C 13 141.429 0.00 . . . . . . . 233 C C6 . 53720 2 68 . 1 . 1 16 16 U H5 H 1 5.605 0.00 . . . . . . . 234 U H5 . 53720 2 69 . 1 . 1 16 16 U H6 H 1 7.705 0.00 . . . . . . . 234 U H6 . 53720 2 70 . 1 . 1 16 16 U C6 C 13 141.741 0.01 . . . . . . . 234 U C6 . 53720 2 71 . 1 . 1 17 17 C H5 H 1 5.858 0.00 . . . . . . . 235 C H5 . 53720 2 72 . 1 . 1 17 17 C H6 H 1 7.607 0.00 . . . . . . . 235 C H6 . 53720 2 73 . 1 . 1 17 17 C C6 C 13 143.353 0.00 . . . . . . . 235 C C6 . 53720 2 74 . 1 . 1 18 18 U H5 H 1 5.719 0.00 . . . . . . . 236 U H5 . 53720 2 75 . 1 . 1 18 18 U H6 H 1 7.728 0.00 . . . . . . . 236 U H6 . 53720 2 76 . 1 . 1 18 18 U C6 C 13 143.266 0.00 . . . . . . . 236 U C6 . 53720 2 77 . 1 . 1 19 19 C H5 H 1 5.855 0.00 . . . . . . . 237 C H5 . 53720 2 78 . 1 . 1 19 19 C H6 H 1 7.837 0.00 . . . . . . . 237 C H6 . 53720 2 79 . 1 . 1 19 19 C C6 C 13 142.671 0.00 . . . . . . . 237 C C6 . 53720 2 80 . 1 . 1 20 20 A H2 H 1 7.946 0.00 . . . . . . . 238 A H2 . 53720 2 81 . 1 . 1 20 20 A H8 H 1 8.165 0.00 . . . . . . . 238 A H8 . 53720 2 82 . 1 . 1 20 20 A C2 C 13 155.079 0.00 . . . . . . . 238 A C2 . 53720 2 83 . 1 . 1 20 20 A C8 C 13 141.725 0.00 . . . . . . . 238 A C8 . 53720 2 84 . 1 . 1 21 21 A H1' H 1 5.892 0.00 . . . . . . . 239 A H1' . 53720 2 85 . 1 . 1 21 21 A H2 H 1 8.006 0.00 . . . . . . . 239 A H2 . 53720 2 86 . 1 . 1 21 21 A H8 H 1 8.167 0.00 . . . . . . . 239 A H8 . 53720 2 87 . 1 . 1 21 21 A C2 C 13 155.053 0.00 . . . . . . . 239 A C2 . 53720 2 88 . 1 . 1 21 21 A C8 C 13 141.463 0.00 . . . . . . . 239 A C8 . 53720 2 89 . 1 . 1 22 22 G H1' H 1 5.396 0.00 . . . . . . . 240 G H1' . 53720 2 90 . 1 . 1 22 22 G H8 H 1 7.672 0.00 . . . . . . . 240 G H8 . 53720 2 91 . 1 . 1 22 22 G C8 C 13 138.328 0.00 . . . . . . . 240 G C8 . 53720 2 92 . 1 . 1 23 23 G H8 H 1 7.383 0.00 . . . . . . . 241 G H8 . 53720 2 93 . 1 . 1 23 23 G C8 C 13 137.232 0.00 . . . . . . . 241 G C8 . 53720 2 94 . 1 . 1 24 24 U H5 H 1 5.405 0.00 . . . . . . . 242 U H5 . 53720 2 95 . 1 . 1 24 24 U H6 H 1 7.580 0.01 . . . . . . . 242 U H6 . 53720 2 96 . 1 . 1 24 24 U C6 C 13 141.235 0.00 . . . . . . . 242 U C6 . 53720 2 97 . 1 . 1 25 25 C H5 H 1 5.701 0.00 . . . . . . . 243 C H5 . 53720 2 98 . 1 . 1 25 25 C H6 H 1 7.784 0.00 . . . . . . . 243 C H6 . 53720 2 99 . 1 . 1 25 25 C C6 C 13 142.348 0.00 . . . . . . . 243 C C6 . 53720 2 100 . 1 . 1 26 26 C H1' H 1 5.720 0.00 . . . . . . . 244 C H1' . 53720 2 101 . 1 . 1 26 26 C H5 H 1 5.718 0.00 . . . . . . . 244 C H5 . 53720 2 102 . 1 . 1 26 26 C H6 H 1 7.716 0.00 . . . . . . . 244 C H6 . 53720 2 103 . 1 . 1 26 26 C C6 C 13 142.342 0.00 . . . . . . . 244 C C6 . 53720 2 104 . 1 . 1 27 27 A H1' H 1 5.841 0.00 . . . . . . . 245 A H1' . 53720 2 105 . 1 . 1 27 27 A H2 H 1 7.762 0.00 . . . . . . . 245 A H2 . 53720 2 106 . 1 . 1 27 27 A H8 H 1 8.126 0.00 . . . . . . . 245 A H8 . 53720 2 107 . 1 . 1 27 27 A C2 C 13 154.199 0.00 . . . . . . . 245 A C2 . 53720 2 108 . 1 . 1 27 27 A C8 C 13 140.868 0.00 . . . . . . . 245 A C8 . 53720 2 109 . 1 . 1 28 28 U H1' H 1 5.214 0.00 . . . . . . . 246 U H1' . 53720 2 110 . 1 . 1 28 28 U H5 H 1 5.463 0.00 . . . . . . . 246 U H5 . 53720 2 111 . 1 . 1 28 28 U H6 H 1 7.529 0.00 . . . . . . . 246 U H6 . 53720 2 112 . 1 . 1 28 28 U C6 C 13 141.728 0.01 . . . . . . . 246 U C6 . 53720 2 113 . 1 . 1 29 29 U H1' H 1 5.626 0.00 . . . . . . . 247 U H1' . 53720 2 114 . 1 . 1 29 29 U H5 H 1 5.634 0.00 . . . . . . . 247 U H5 . 53720 2 115 . 1 . 1 29 29 U H6 H 1 7.910 0.00 . . . . . . . 247 U H6 . 53720 2 116 . 1 . 1 29 29 U C6 C 13 142.793 0.01 . . . . . . . 247 U C6 . 53720 2 117 . 1 . 1 30 30 U H1' H 1 5.580 0.00 . . . . . . . 248 U H1' . 53720 2 118 . 1 . 1 30 30 U H5 H 1 5.562 0.00 . . . . . . . 248 U H5 . 53720 2 119 . 1 . 1 30 30 U H6 H 1 7.852 0.00 . . . . . . . 248 U H6 . 53720 2 120 . 1 . 1 30 30 U C6 C 13 142.195 0.01 . . . . . . . 248 U C6 . 53720 2 121 . 1 . 1 31 31 G H1 H 1 12.354 0.00 . . . . . . . 249 G H1 . 53720 2 122 . 1 . 1 31 31 G H1' H 1 5.683 0.00 . . . . . . . 249 G H1' . 53720 2 123 . 1 . 1 31 31 G H8 H 1 7.688 0.00 . . . . . . . 249 G H8 . 53720 2 124 . 1 . 1 31 31 G C8 C 13 136.894 0.00 . . . . . . . 249 G C8 . 53720 2 125 . 1 . 1 31 31 G N1 N 15 147.451 0.00 . . . . . . . 249 G N1 . 53720 2 126 . 1 . 1 32 32 U H1' H 1 5.537 0.00 . . . . . . . 250 U H1' . 53720 2 127 . 1 . 1 32 32 U H5 H 1 4.930 0.00 . . . . . . . 250 U H5 . 53720 2 128 . 1 . 1 32 32 U H6 H 1 7.463 0.00 . . . . . . . 250 U H6 . 53720 2 129 . 1 . 1 32 32 U C6 C 13 140.984 0.00 . . . . . . . 250 U C6 . 53720 2 130 . 1 . 1 33 33 A H1' H 1 5.989 0.00 . . . . . . . 251 A H1' . 53720 2 131 . 1 . 1 33 33 A H2 H 1 7.324 0.00 . . . . . . . 251 A H2 . 53720 2 132 . 1 . 1 33 33 A H8 H 1 7.959 0.00 . . . . . . . 251 A H8 . 53720 2 133 . 1 . 1 33 33 A C2 C 13 153.422 0.00 . . . . . . . 251 A C2 . 53720 2 134 . 1 . 1 33 33 A C8 C 13 139.214 0.00 . . . . . . . 251 A C8 . 53720 2 135 . 1 . 1 34 34 G H1 H 1 12.854 0.00 . . . . . . . 252 G H1 . 53720 2 136 . 1 . 1 34 34 G H1' H 1 5.635 0.00 . . . . . . . 252 G H1' . 53720 2 137 . 1 . 1 34 34 G H8 H 1 7.185 0.00 . . . . . . . 252 G H8 . 53720 2 138 . 1 . 1 34 34 G C8 C 13 135.778 0.00 . . . . . . . 252 G C8 . 53720 2 139 . 1 . 1 34 34 G N1 N 15 147.550 0.00 . . . . . . . 252 G N1 . 53720 2 140 . 1 . 1 35 35 G H1 H 1 13.281 0.00 . . . . . . . 253 G H1 . 53720 2 141 . 1 . 1 35 35 G H1' H 1 5.728 0.00 . . . . . . . 253 G H1' . 53720 2 142 . 1 . 1 35 35 G H8 H 1 7.212 0.00 . . . . . . . 253 G H8 . 53720 2 143 . 1 . 1 35 35 G C8 C 13 136.014 0.00 . . . . . . . 253 G C8 . 53720 2 144 . 1 . 1 35 35 G N1 N 15 148.946 0.00 . . . . . . . 253 G N1 . 53720 2 145 . 1 . 1 36 36 C H1' H 1 5.552 0.00 . . . . . . . 254 C H1' . 53720 2 146 . 1 . 1 36 36 C H5 H 1 5.202 0.00 . . . . . . . 254 C H5 . 53720 2 147 . 1 . 1 36 36 C H6 H 1 7.613 0.00 . . . . . . . 254 C H6 . 53720 2 148 . 1 . 1 36 36 C H41 H 1 8.613 0.00 . . . . . . . 254 C H41 . 53720 2 149 . 1 . 1 36 36 C H42 H 1 6.832 0.00 . . . . . . . 254 C H42 . 53720 2 150 . 1 . 1 36 36 C C6 C 13 141.098 0.00 . . . . . . . 254 C C6 . 53720 2 151 . 1 . 1 37 37 C H5 H 1 5.551 0.00 . . . . . . . 255 C H5 . 53720 2 152 . 1 . 1 37 37 C H6 H 1 7.679 0.00 . . . . . . . 255 C H6 . 53720 2 153 . 1 . 1 37 37 C H41 H 1 8.335 0.00 . . . . . . . 255 C H41 . 53720 2 154 . 1 . 1 37 37 C H42 H 1 6.941 0.00 . . . . . . . 255 C H42 . 53720 2 155 . 1 . 1 37 37 C C6 C 13 141.808 0.01 . . . . . . . 255 C C6 . 53720 2 stop_ save_