data_52427 ####################### # Entry information # ####################### save_entry_information_1 _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information_1 _Entry.ID 52427 _Entry.Title ; 123-nt Programmed Ribosome Frameshift (PRF) element of SARS-CoV-2 ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2024-04-29 _Entry.Accession_date 2024-04-29 _Entry.Last_release_date 2024-04-29 _Entry.Original_release_date 2024-04-29 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Maria Hernandez-Marin . . . . 52427 2 Angel Cantero-Camacho . . . . 52427 3 Sergio Lopez-Nunez . . . . 52427 4 Jose Gallego . . . . 52427 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 52427 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '15N chemical shifts' 57 52427 '1H chemical shifts' 75 52427 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2024-07-29 . original BMRB . 52427 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 52424 'Attenuator hairpin of SARS-CoV-2 PRF' 52427 BMRB 52425 'Helix-I of SARS-CoV-2 PRF' 52427 BMRB 52426 'Helix-II of SARS-CoV-2 PRF' 52427 BMRB 52428 '116-nt PRF sequence of SARS-CoV-2' 52427 stop_ save_ ############### # Citations # ############### save_citations_1 _Citation.Sf_category citations _Citation.Sf_framecode citations_1 _Citation.Entry_ID 52427 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID . _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Sarbecovirus Programmed Ribosome Frameshift RNA element folding studied by NMR spectroscopy and comparative analyses ; _Citation.Status submitted _Citation.Type journal _Citation.Journal_abbrev 'Not known' _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year . _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Maria Hernandez-Marin . . . . 52427 1 2 Angel Cantero-Camacho . . . . 52427 1 3 Ignacio Mena . . . . 52427 1 4 Sergio Lopez-Nunez . . . . 52427 1 5 Adolfo Garcia-Sastre . . . . 52427 1 6 Jose Gallego . . . . 52427 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly_1 _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly_1 _Assembly.Entry_ID 52427 _Assembly.ID 1 _Assembly.Name '123-nt PRF sequence of SARS-CoV-2' _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands 0 _Assembly.Metal_ions 0 _Assembly.Non_standard_bonds no _Assembly.Ambiguous_conformational_states no _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange no _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 '123-nt PRF sequence of SARS-CoV-2' 1 $entity_1 . . yes native no no . . . 52427 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 52427 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GACUCCGCGAACCCAUGCUU CAGUCAGCUGAUGCACAAUC GUUUUUAAACGGGUUUGCGG UGUAAGUGCAGCCCGUCUUA CACCGUGCGGCACAGGCACU AGUACUGAUGUCGUAUACAG GGCU ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details ; The sequences experimentally analyzed in this study correspond to SARS-CoV-2 isolate Wuhan-Hu-1 (NCBI NC_045512). To obtain genomic numbering add 13,419 to the authors' sequence numbers. ; _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 124 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 0 G . 52427 1 2 1 A . 52427 1 3 2 C . 52427 1 4 3 U . 52427 1 5 4 C . 52427 1 6 5 C . 52427 1 7 6 G . 52427 1 8 7 C . 52427 1 9 8 G . 52427 1 10 9 A . 52427 1 11 10 A . 52427 1 12 11 C . 52427 1 13 12 C . 52427 1 14 13 C . 52427 1 15 14 A . 52427 1 16 15 U . 52427 1 17 16 G . 52427 1 18 17 C . 52427 1 19 18 U . 52427 1 20 19 U . 52427 1 21 20 C . 52427 1 22 21 A . 52427 1 23 22 G . 52427 1 24 23 U . 52427 1 25 24 C . 52427 1 26 25 A . 52427 1 27 26 G . 52427 1 28 27 C . 52427 1 29 28 U . 52427 1 30 29 G . 52427 1 31 30 A . 52427 1 32 31 U . 52427 1 33 32 G . 52427 1 34 33 C . 52427 1 35 34 A . 52427 1 36 35 C . 52427 1 37 36 A . 52427 1 38 37 A . 52427 1 39 38 U . 52427 1 40 39 C . 52427 1 41 40 G . 52427 1 42 41 U . 52427 1 43 42 U . 52427 1 44 43 U . 52427 1 45 44 U . 52427 1 46 45 U . 52427 1 47 46 A . 52427 1 48 47 A . 52427 1 49 48 A . 52427 1 50 49 C . 52427 1 51 50 G . 52427 1 52 51 G . 52427 1 53 52 G . 52427 1 54 53 U . 52427 1 55 54 U . 52427 1 56 55 U . 52427 1 57 56 G . 52427 1 58 57 C . 52427 1 59 58 G . 52427 1 60 59 G . 52427 1 61 60 U . 52427 1 62 61 G . 52427 1 63 62 U . 52427 1 64 63 A . 52427 1 65 64 A . 52427 1 66 65 G . 52427 1 67 66 U . 52427 1 68 67 G . 52427 1 69 68 C . 52427 1 70 69 A . 52427 1 71 70 G . 52427 1 72 71 C . 52427 1 73 72 C . 52427 1 74 73 C . 52427 1 75 74 G . 52427 1 76 75 U . 52427 1 77 76 C . 52427 1 78 77 U . 52427 1 79 78 U . 52427 1 80 79 A . 52427 1 81 80 C . 52427 1 82 81 A . 52427 1 83 82 C . 52427 1 84 83 C . 52427 1 85 84 G . 52427 1 86 85 U . 52427 1 87 86 G . 52427 1 88 87 C . 52427 1 89 88 G . 52427 1 90 89 G . 52427 1 91 90 C . 52427 1 92 91 A . 52427 1 93 92 C . 52427 1 94 93 A . 52427 1 95 94 G . 52427 1 96 95 G . 52427 1 97 96 C . 52427 1 98 97 A . 52427 1 99 98 C . 52427 1 100 99 U . 52427 1 101 100 A . 52427 1 102 101 G . 52427 1 103 102 U . 52427 1 104 103 A . 52427 1 105 104 C . 52427 1 106 105 U . 52427 1 107 106 G . 52427 1 108 107 A . 52427 1 109 108 U . 52427 1 110 109 G . 52427 1 111 110 U . 52427 1 112 111 C . 52427 1 113 112 G . 52427 1 114 113 U . 52427 1 115 114 A . 52427 1 116 115 U . 52427 1 117 116 A . 52427 1 118 117 C . 52427 1 119 118 A . 52427 1 120 119 G . 52427 1 121 120 G . 52427 1 122 121 G . 52427 1 123 122 C . 52427 1 124 123 U . 52427 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 52427 1 . A 2 2 52427 1 . C 3 3 52427 1 . U 4 4 52427 1 . C 5 5 52427 1 . C 6 6 52427 1 . G 7 7 52427 1 . C 8 8 52427 1 . G 9 9 52427 1 . A 10 10 52427 1 . A 11 11 52427 1 . C 12 12 52427 1 . C 13 13 52427 1 . C 14 14 52427 1 . A 15 15 52427 1 . U 16 16 52427 1 . G 17 17 52427 1 . C 18 18 52427 1 . U 19 19 52427 1 . U 20 20 52427 1 . C 21 21 52427 1 . A 22 22 52427 1 . G 23 23 52427 1 . U 24 24 52427 1 . C 25 25 52427 1 . A 26 26 52427 1 . G 27 27 52427 1 . C 28 28 52427 1 . U 29 29 52427 1 . G 30 30 52427 1 . A 31 31 52427 1 . U 32 32 52427 1 . G 33 33 52427 1 . C 34 34 52427 1 . A 35 35 52427 1 . C 36 36 52427 1 . A 37 37 52427 1 . A 38 38 52427 1 . U 39 39 52427 1 . C 40 40 52427 1 . G 41 41 52427 1 . U 42 42 52427 1 . U 43 43 52427 1 . U 44 44 52427 1 . U 45 45 52427 1 . U 46 46 52427 1 . A 47 47 52427 1 . A 48 48 52427 1 . A 49 49 52427 1 . C 50 50 52427 1 . G 51 51 52427 1 . G 52 52 52427 1 . G 53 53 52427 1 . U 54 54 52427 1 . U 55 55 52427 1 . U 56 56 52427 1 . G 57 57 52427 1 . C 58 58 52427 1 . G 59 59 52427 1 . G 60 60 52427 1 . U 61 61 52427 1 . G 62 62 52427 1 . U 63 63 52427 1 . A 64 64 52427 1 . A 65 65 52427 1 . G 66 66 52427 1 . U 67 67 52427 1 . G 68 68 52427 1 . C 69 69 52427 1 . A 70 70 52427 1 . G 71 71 52427 1 . C 72 72 52427 1 . C 73 73 52427 1 . C 74 74 52427 1 . G 75 75 52427 1 . U 76 76 52427 1 . C 77 77 52427 1 . U 78 78 52427 1 . U 79 79 52427 1 . A 80 80 52427 1 . C 81 81 52427 1 . A 82 82 52427 1 . C 83 83 52427 1 . C 84 84 52427 1 . G 85 85 52427 1 . U 86 86 52427 1 . G 87 87 52427 1 . C 88 88 52427 1 . G 89 89 52427 1 . G 90 90 52427 1 . C 91 91 52427 1 . A 92 92 52427 1 . C 93 93 52427 1 . A 94 94 52427 1 . G 95 95 52427 1 . G 96 96 52427 1 . C 97 97 52427 1 . A 98 98 52427 1 . C 99 99 52427 1 . U 100 100 52427 1 . A 101 101 52427 1 . G 102 102 52427 1 . U 103 103 52427 1 . A 104 104 52427 1 . C 105 105 52427 1 . U 106 106 52427 1 . G 107 107 52427 1 . A 108 108 52427 1 . U 109 109 52427 1 . G 110 110 52427 1 . U 111 111 52427 1 . C 112 112 52427 1 . G 113 113 52427 1 . U 114 114 52427 1 . A 115 115 52427 1 . U 116 116 52427 1 . A 117 117 52427 1 . C 118 118 52427 1 . A 119 119 52427 1 . G 120 120 52427 1 . G 121 121 52427 1 . G 122 122 52427 1 . C 123 123 52427 1 . U 124 124 52427 1 stop_ save_ #################### # Natural source # #################### save_natural_source_1 _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source_1 _Entity_natural_src_list.Entry_ID 52427 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 2697049 organism . 'SARS coronavirus 2' SARS-CoV-2 . . Viruses . Betacoronavirus HCoV-SARS SARS-CoV-2 . . . . . . . . . . . . 52427 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source_1 _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source_1 _Entity_experimental_src_list.Entry_ID 52427 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'in vitro transcription' 'Not applicable' . . . . . . . . . . . . . . . 52427 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 52427 _Sample.ID 1 _Sample.Name '123-nt PRF sequence of SARS-CoV-2' _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 '123-nt PRF sequence of SARS-CoV-2' '[U-99% 13C; U-99% 15N]' . . 1 $entity_1 . . 176 . . uM . . . . 52427 1 2 'potassium phosphate' 'natural abundance' . . . . . . 25 . . mM . . . . 52427 1 3 'potassium chloride' 'natural abundance' . . . . . . 50 . . mM . . . . 52427 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 52427 _Sample_condition_list.ID 1 _Sample_condition_list.Name '123-nt PRF sequence of SARS-CoV-2' _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 75 . mM 52427 1 pH 6.2 . pH 52427 1 pressure 1 . atm 52427 1 temperature 298 . K 52427 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 52427 _Software.ID 1 _Software.Type . _Software.Name TOPSPIN _Software.Version 3.6.1 _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'collection, data analysis' . 52427 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 52427 _Software.ID 2 _Software.Type . _Software.Name NMRFARM-Sparky _Software.Version 1.414 _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'collection, data analysis' . 52427 2 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 52427 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name '600 MHz Bruker Avance spectrometer with TCI cryoprobe' _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_NMR_spectrometer_2 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_2 _NMR_spectrometer.Entry_ID 52427 _NMR_spectrometer.ID 2 _NMR_spectrometer.Name '600 MHz Bruker Avance spectrometer with cryoprobe' _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 52427 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no no no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 52427 1 2 '2D 1H-15N TROSY' no no no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 52427 1 3 '2D 1H-15N HNN-COSY' no no no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 52427 1 4 '2D 1H-15N HSQC' no no no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 52427 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 52427 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name '123-nt PRF sequence of SARS-CoV-2' _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0 external direct 1 . . . . . 52427 1 N 15 DSS 'methyl protons' . . . . ppm 0 external indirect 0.101329118 . . . . . 52427 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 52427 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name '123-nt PRF sequence of SARS-CoV-2' _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 52427 1 3 '2D 1H-15N HNN-COSY' . . . 52427 1 4 '2D 1H-15N HSQC' . . . 52427 1 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 1 $software_1 . . 52427 1 2 $software_2 . . 52427 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 4 4 U H3 H 1 10.77 . . 5 . . . . . 3 U H3 . 52427 1 2 . 1 . 1 4 4 U N3 N 15 157.40 . . 5 . . . . . 3 U N3 . 52427 1 3 . 1 . 1 5 5 C H41 H 1 8.32 . . . . . . . . 4 C H41 . 52427 1 4 . 1 . 1 5 5 C H42 H 1 6.67 . . . . . . . . 4 C H42 . 52427 1 5 . 1 . 1 5 5 C N3 N 15 197.00 . . 1 . . . . . 4 C N3 . 52427 1 6 . 1 . 1 6 6 C H41 H 1 8.34 . . . . . . . . 5 C H41 . 52427 1 7 . 1 . 1 6 6 C H42 H 1 6.67 . . . . . . . . 5 C H42 . 52427 1 8 . 1 . 1 6 6 C N3 N 15 196.70 . . 1 . . . . . 5 C N3 . 52427 1 9 . 1 . 1 7 7 G H1 H 1 12.71 . . 1 . . . . . 6 G H1 . 52427 1 10 . 1 . 1 7 7 G N1 N 15 147.61 . . 1 . . . . . 6 G N1 . 52427 1 11 . 1 . 1 8 8 C H41 H 1 8.34 . . . . . . . . 7 C H41 . 52427 1 12 . 1 . 1 8 8 C H42 H 1 6.86 . . . . . . . . 7 C H42 . 52427 1 13 . 1 . 1 8 8 C N3 N 15 197.60 . . 1 . . . . . 7 C N3 . 52427 1 14 . 1 . 1 9 9 G H1 H 1 9.97 . . 1 . . . . . 8 G H1 . 52427 1 15 . 1 . 1 9 9 G N1 N 15 142.11 . . 1 . . . . . 8 G N1 . 52427 1 16 . 1 . 1 10 10 A H2 H 1 7.18 . . 1 . . . . . 9 A H2 . 52427 1 17 . 1 . 1 10 10 A N1 N 15 220.50 . . 1 . . . . . 9 A N1 . 52427 1 18 . 1 . 1 11 11 A H2 H 1 7.77 . . 1 . . . . . 10 A H2 . 52427 1 19 . 1 . 1 11 11 A N1 N 15 222.10 . . 1 . . . . . 10 A N1 . 52427 1 20 . 1 . 1 12 12 C H41 H 1 8.38 . . . . . . . . 11 C H41 . 52427 1 21 . 1 . 1 12 12 C H42 H 1 6.89 . . . . . . . . 11 C H42 . 52427 1 22 . 1 . 1 12 12 C N3 N 15 197.90 . . 1 . . . . . 11 C N3 . 52427 1 23 . 1 . 1 13 13 C H41 H 1 8.46 . . . . . . . . 12 C H41 . 52427 1 24 . 1 . 1 13 13 C H42 H 1 6.74 . . . . . . . . 12 C H42 . 52427 1 25 . 1 . 1 13 13 C N3 N 15 197.20 . . 1 . . . . . 12 C N3 . 52427 1 26 . 1 . 1 17 17 G H1 H 1 12.53 . . 1 . . . . . 16 G H1 . 52427 1 27 . 1 . 1 17 17 G N1 N 15 147.71 . . 1 . . . . . 16 G N1 . 52427 1 28 . 1 . 1 18 18 C H41 H 1 8.32 . . . . . . . . 17 C H41 . 52427 1 29 . 1 . 1 18 18 C H42 H 1 6.83 . . . . . . . . 17 C H42 . 52427 1 30 . 1 . 1 18 18 C N3 N 15 197.50 . . 1 . . . . . 17 C N3 . 52427 1 31 . 1 . 1 19 19 U H3 H 1 10.48 . . 1 . . . . . 18 U H3 . 52427 1 32 . 1 . 1 19 19 U N3 N 15 156.80 . . 1 . . . . . 18 U N3 . 52427 1 33 . 1 . 1 20 20 U H3 H 1 14.55 . . 1 . . . . . 19 U H3 . 52427 1 34 . 1 . 1 20 20 U N3 N 15 163.20 . . 1 . . . . . 19 U N3 . 52427 1 35 . 1 . 1 21 21 C H41 H 1 8.23 . . . . . . . . 20 C H41 . 52427 1 36 . 1 . 1 21 21 C H42 H 1 6.88 . . . . . . . . 20 C H42 . 52427 1 37 . 1 . 1 21 21 C N3 N 15 197.40 . . 1 . . . . . 20 C N3 . 52427 1 38 . 1 . 1 22 22 A H2 H 1 7.05 . . 1 . . . . . 21 A H2 . 52427 1 39 . 1 . 1 22 22 A N1 N 15 219.60 . . 1 . . . . . 21 A N1 . 52427 1 40 . 1 . 1 23 23 G H1 H 1 13.44 . . 1 . . . . . 22 G H1 . 52427 1 41 . 1 . 1 23 23 G N1 N 15 148.01 . . 1 . . . . . 22 G N1 . 52427 1 42 . 1 . 1 29 29 U H3 H 1 13.38 . . 1 . . . . . 28 U H3 . 52427 1 43 . 1 . 1 29 29 U N3 N 15 161.91 . . 1 . . . . . 28 U N3 . 52427 1 44 . 1 . 1 30 30 G H1 H 1 11.62 . . 1 . . . . . 29 G H1 . 52427 1 45 . 1 . 1 30 30 G N1 N 15 146.01 . . 1 . . . . . 29 G N1 . 52427 1 46 . 1 . 1 32 32 U H3 H 1 10.28 . . 1 . . . . . 31 U H3 . 52427 1 47 . 1 . 1 32 32 U N3 N 15 157.21 . . 1 . . . . . 31 U N3 . 52427 1 48 . 1 . 1 33 33 G H1 H 1 13.23 . . 1 . . . . . 32 G H1 . 52427 1 49 . 1 . 1 33 33 G N1 N 15 148.51 . . 1 . . . . . 32 G N1 . 52427 1 50 . 1 . 1 34 34 C H41 H 1 8.26 . . . . . . . . 33 C H41 . 52427 1 51 . 1 . 1 34 34 C H42 H 1 6.73 . . . . . . . . 33 C H42 . 52427 1 52 . 1 . 1 34 34 C N3 N 15 196.61 . . 1 . . . . . 33 C N3 . 52427 1 53 . 1 . 1 51 51 G H1 H 1 12.18 . . 1 . . . . . 50 G H1 . 52427 1 54 . 1 . 1 51 51 G N1 N 15 146.91 . . 1 . . . . . 50 G N1 . 52427 1 55 . 1 . 1 52 52 G H1 H 1 12.65 . . 1 . . . . . 51 G H1 . 52427 1 56 . 1 . 1 52 52 G N1 N 15 147.71 . . 1 . . . . . 51 G N1 . 52427 1 57 . 1 . 1 53 53 G H1 H 1 13.25 . . 1 . . . . . 52 G H1 . 52427 1 58 . 1 . 1 53 53 G N1 N 15 148.61 . . 1 . . . . . 52 G N1 . 52427 1 59 . 1 . 1 54 54 U H3 H 1 14.19 . . 1 . . . . . 53 U H3 . 52427 1 60 . 1 . 1 54 54 U N3 N 15 162.40 . . 1 . . . . . 53 U N3 . 52427 1 61 . 1 . 1 55 55 U H3 H 1 13.73 . . 1 . . . . . 54 U H3 . 52427 1 62 . 1 . 1 55 55 U N3 N 15 162.60 . . 1 . . . . . 54 U N3 . 52427 1 63 . 1 . 1 56 56 U H3 H 1 11.62 . . 1 . . . . . 55 U H3 . 52427 1 64 . 1 . 1 56 56 U N3 N 15 158.40 . . 1 . . . . . 55 U N3 . 52427 1 65 . 1 . 1 57 57 G H1 H 1 13.22 . . 1 . . . . . 56 G H1 . 52427 1 66 . 1 . 1 57 57 G N1 N 15 148.61 . . 1 . . . . . 56 G N1 . 52427 1 67 . 1 . 1 58 58 C H41 H 1 8.32 . . . . . . . . 57 C H41 . 52427 1 68 . 1 . 1 58 58 C H42 H 1 6.76 . . . . . . . . 57 C H42 . 52427 1 69 . 1 . 1 58 58 C N3 N 15 196.90 . . 1 . . . . . 57 C N3 . 52427 1 70 . 1 . 1 59 59 G H1 H 1 12.32 . . 1 . . . . . 58 G H1 . 52427 1 71 . 1 . 1 59 59 G N1 N 15 146.81 . . 1 . . . . . 58 G N1 . 52427 1 72 . 1 . 1 60 60 G H1 H 1 12.71 . . 1 . . . . . 59 G H1 . 52427 1 73 . 1 . 1 60 60 G N1 N 15 147.61 . . 1 . . . . . 59 G N1 . 52427 1 74 . 1 . 1 61 61 U H3 H 1 9.74 . . 5 . . . . . 60 U H3 . 52427 1 75 . 1 . 1 61 61 U N3 N 15 156.30 . . 5 . . . . . 60 U N3 . 52427 1 76 . 1 . 1 71 71 G H1 H 1 13.44 . . 1 . . . . . 70 G H1 . 52427 1 77 . 1 . 1 71 71 G N1 N 15 148.61 . . 1 . . . . . 70 G N1 . 52427 1 78 . 1 . 1 72 72 C H41 H 1 8.68 . . . . . . . . 71 C H41 . 52427 1 79 . 1 . 1 72 72 C H42 H 1 6.87 . . . . . . . . 71 C H42 . 52427 1 80 . 1 . 1 72 72 C N3 N 15 197.80 . . 1 . . . . . 71 C N3 . 52427 1 81 . 1 . 1 73 73 C H41 H 1 8.55 . . . . . . . . 72 C H41 . 52427 1 82 . 1 . 1 73 73 C H42 H 1 6.86 . . . . . . . . 72 C H42 . 52427 1 83 . 1 . 1 73 73 C N3 N 15 197.10 . . 1 . . . . . 72 C N3 . 52427 1 84 . 1 . 1 74 74 C H41 H 1 8.24 . . . . . . . . 73 C H41 . 52427 1 85 . 1 . 1 74 74 C H42 H 1 6.74 . . . . . . . . 73 C H42 . 52427 1 86 . 1 . 1 74 74 C N3 N 15 195.60 . . 1 . . . . . 73 C N3 . 52427 1 87 . 1 . 1 87 87 G H1 H 1 10.83 . . 1 . . . . . 86 G H1 . 52427 1 88 . 1 . 1 87 87 G N1 N 15 144.21 . . 1 . . . . . 86 G N1 . 52427 1 89 . 1 . 1 88 88 C H41 H 1 8.17 . . . . . . . . 87 C H41 . 52427 1 90 . 1 . 1 88 88 C H42 H 1 6.74 . . . . . . . . 87 C H42 . 52427 1 91 . 1 . 1 88 88 C N3 N 15 196.91 . . 1 . . . . . 87 C N3 . 52427 1 92 . 1 . 1 89 89 G H1 H 1 12.41 . . 1 . . . . . 88 G H1 . 52427 1 93 . 1 . 1 89 89 G N1 N 15 147.51 . . 1 . . . . . 88 G N1 . 52427 1 94 . 1 . 1 90 90 G H1 H 1 11.39 . . 1 . . . . . 89 G H1 . 52427 1 95 . 1 . 1 90 90 G N1 N 15 145.51 . . 1 . . . . . 89 G N1 . 52427 1 96 . 1 . 1 91 91 C H41 H 1 8.00 . . . . . . . . 90 C H41 . 52427 1 97 . 1 . 1 91 91 C H42 H 1 6.78 . . . . . . . . 90 C H42 . 52427 1 98 . 1 . 1 91 91 C N3 N 15 196.00 . . 1 . . . . . 90 C N3 . 52427 1 99 . 1 . 1 93 93 C H41 H 1 8.32 . . . . . . . . 92 C H41 . 52427 1 100 . 1 . 1 93 93 C H42 H 1 6.85 . . . . . . . . 92 C H42 . 52427 1 101 . 1 . 1 93 93 C N3 N 15 197.00 . . 1 . . . . . 92 C N3 . 52427 1 102 . 1 . 1 94 94 A H2 H 1 6.89 . . 1 . . . . . 93 A H2 . 52427 1 103 . 1 . 1 94 94 A N1 N 15 220.71 . . 1 . . . . . 93 A N1 . 52427 1 104 . 1 . 1 95 95 G H1 H 1 13.08 . . 1 . . . . . 94 G H1 . 52427 1 105 . 1 . 1 95 95 G N1 N 15 148.01 . . 1 . . . . . 94 G N1 . 52427 1 106 . 1 . 1 105 105 C H41 H 1 8.27 . . . . . . . . 104 C H41 . 52427 1 107 . 1 . 1 105 105 C H42 H 1 7.02 . . . . . . . . 104 C H42 . 52427 1 108 . 1 . 1 105 105 C N3 N 15 198.00 . . 1 . . . . . 104 C N3 . 52427 1 109 . 1 . 1 106 106 U H3 H 1 14.04 . . 1 . . . . . 105 U H3 . 52427 1 110 . 1 . 1 106 106 U N3 N 15 162.60 . . 1 . . . . . 105 U N3 . 52427 1 111 . 1 . 1 107 107 G H1 H 1 12.05 . . 1 . . . . . 106 G H1 . 52427 1 112 . 1 . 1 107 107 G N1 N 15 147.31 . . 1 . . . . . 106 G N1 . 52427 1 113 . 1 . 1 110 110 G H1 H 1 12.47 . . 1 . . . . . 109 G H1 . 52427 1 114 . 1 . 1 110 110 G N1 N 15 147.51 . . 1 . . . . . 109 G N1 . 52427 1 115 . 1 . 1 111 111 U H3 H 1 12.22 . . 1 . . . . . 110 U H3 . 52427 1 116 . 1 . 1 111 111 U N3 N 15 158.71 . . 1 . . . . . 110 U N3 . 52427 1 117 . 1 . 1 112 112 C H41 H 1 8.22 . . . . . . . . 111 C H41 . 52427 1 118 . 1 . 1 112 112 C H42 H 1 6.77 . . . . . . . . 111 C H42 . 52427 1 119 . 1 . 1 112 112 C N3 N 15 195.61 . . 1 . . . . . 111 C N3 . 52427 1 120 . 1 . 1 113 113 G H1 H 1 12.89 . . 1 . . . . . 112 G H1 . 52427 1 121 . 1 . 1 113 113 G N1 N 15 147.51 . . 1 . . . . . 112 G N1 . 52427 1 122 . 1 . 1 114 114 U H3 H 1 11.77 . . 1 . . . . . 113 U H3 . 52427 1 123 . 1 . 1 114 114 U N1 N 15 158.10 . . 1 . . . . . 113 U N1 . 52427 1 124 . 1 . 1 120 120 G H1 H 1 12.41 . . 1 . . . . . 119 G H1 . 52427 1 125 . 1 . 1 120 120 G N1 N 15 147.51 . . 1 . . . . . 119 G N1 . 52427 1 126 . 1 . 1 121 121 G H1 H 1 12.66 . . 1 . . . . . 120 G H1 . 52427 1 127 . 1 . 1 121 121 G N1 N 15 147.81 . . 1 . . . . . 120 G N1 . 52427 1 128 . 1 . 1 122 122 G H1 H 1 13.27 . . 1 . . . . . 121 G H1 . 52427 1 129 . 1 . 1 122 122 G N1 N 15 148.71 . . 1 . . . . . 121 G N1 . 52427 1 130 . 1 . 1 123 123 C H41 H 1 8.61 . . . . . . . . 122 C H41 . 52427 1 131 . 1 . 1 123 123 C H42 H 1 6.95 . . . . . . . . 122 C H42 . 52427 1 132 . 1 . 1 123 123 C N3 N 15 197.70 . . 1 . . . . . 122 C N3 . 52427 1 stop_ save_