data_51905 ####################### # Entry information # ####################### save_entry_information_1 _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information_1 _Entry.ID 51905 _Entry.Title ; StASL domain of EMCV IRES J-K-St. ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2023-04-13 _Entry.Accession_date 2023-04-13 _Entry.Last_release_date 2023-04-14 _Entry.Original_release_date 2023-04-14 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID 1 _Entry.Generated_software_label $software_1 _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Shunsuke Imai . . . . 51905 2 Ichio Shimada . . . . 51905 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 51905 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 34 51905 '1H chemical shifts' 34 51905 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 2 . . 2023-09-15 2023-04-13 update BMRB 'update entry citation' 51905 1 . . 2023-08-09 2023-04-13 original author 'original release' 51905 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 51906 'J domain of EMCV IRES J-K-St' 51905 stop_ save_ ############### # Citations # ############### save_citations_1 _Citation.Sf_category citations _Citation.Sf_framecode citations_1 _Citation.Entry_ID 51905 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 37640715 _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Dynamically regulated two-site interaction of viral RNA to capture host translation initiation factor ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'Nat. Commun.' _Citation.Journal_name_full 'Nature communications' _Citation.Journal_volume 14 _Citation.Journal_issue 1 _Citation.Journal_ASTM . _Citation.Journal_ISSN 2041-1723 _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 4977 _Citation.Page_last 4977 _Citation.Year 2023 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Shunsuke Imai . . . . 51905 1 2 Hiroshi Suzuki . . . . 51905 1 3 Yoshinori Fujiyoshi . . . . 51905 1 4 Ichio Shimada . . . . 51905 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly_1 _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly_1 _Assembly.Entry_ID 51905 _Assembly.ID 1 _Assembly.Name StASL _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands 0 _Assembly.Metal_ions 0 _Assembly.Non_standard_bonds no _Assembly.Ambiguous_conformational_states no _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange no _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 StASL 1 $entity_1 . . yes native no no . . . 51905 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 51905 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGGCUGAAGGAUGCCCAGCU UCGGCUGGGGCCUCGUUCGC GAGGUUAAAAAACGUCUAGG CCC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 63 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . G . 51905 1 2 . G . 51905 1 3 . G . 51905 1 4 . C . 51905 1 5 . U . 51905 1 6 . G . 51905 1 7 . A . 51905 1 8 . A . 51905 1 9 . G . 51905 1 10 . G . 51905 1 11 . A . 51905 1 12 . U . 51905 1 13 . G . 51905 1 14 . C . 51905 1 15 . C . 51905 1 16 . C . 51905 1 17 . A . 51905 1 18 . G . 51905 1 19 . C . 51905 1 20 . U . 51905 1 21 . U . 51905 1 22 . C . 51905 1 23 . G . 51905 1 24 . G . 51905 1 25 . C . 51905 1 26 . U . 51905 1 27 . G . 51905 1 28 . G . 51905 1 29 . G . 51905 1 30 . G . 51905 1 31 . C . 51905 1 32 . C . 51905 1 33 . U . 51905 1 34 . C . 51905 1 35 . G . 51905 1 36 . U . 51905 1 37 . U . 51905 1 38 . C . 51905 1 39 . G . 51905 1 40 . C . 51905 1 41 . G . 51905 1 42 . A . 51905 1 43 . G . 51905 1 44 . G . 51905 1 45 . U . 51905 1 46 . U . 51905 1 47 . A . 51905 1 48 . A . 51905 1 49 . A . 51905 1 50 . A . 51905 1 51 . A . 51905 1 52 . A . 51905 1 53 . C . 51905 1 54 . G . 51905 1 55 . U . 51905 1 56 . C . 51905 1 57 . U . 51905 1 58 . A . 51905 1 59 . G . 51905 1 60 . G . 51905 1 61 . C . 51905 1 62 . C . 51905 1 63 . C . 51905 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 51905 1 . G 2 2 51905 1 . G 3 3 51905 1 . C 4 4 51905 1 . U 5 5 51905 1 . G 6 6 51905 1 . A 7 7 51905 1 . A 8 8 51905 1 . G 9 9 51905 1 . G 10 10 51905 1 . A 11 11 51905 1 . U 12 12 51905 1 . G 13 13 51905 1 . C 14 14 51905 1 . C 15 15 51905 1 . C 16 16 51905 1 . A 17 17 51905 1 . G 18 18 51905 1 . C 19 19 51905 1 . U 20 20 51905 1 . U 21 21 51905 1 . C 22 22 51905 1 . G 23 23 51905 1 . G 24 24 51905 1 . C 25 25 51905 1 . U 26 26 51905 1 . G 27 27 51905 1 . G 28 28 51905 1 . G 29 29 51905 1 . G 30 30 51905 1 . C 31 31 51905 1 . C 32 32 51905 1 . U 33 33 51905 1 . C 34 34 51905 1 . G 35 35 51905 1 . U 36 36 51905 1 . U 37 37 51905 1 . C 38 38 51905 1 . G 39 39 51905 1 . C 40 40 51905 1 . G 41 41 51905 1 . A 42 42 51905 1 . G 43 43 51905 1 . G 44 44 51905 1 . U 45 45 51905 1 . U 46 46 51905 1 . A 47 47 51905 1 . A 48 48 51905 1 . A 49 49 51905 1 . A 50 50 51905 1 . A 51 51 51905 1 . A 52 52 51905 1 . C 53 53 51905 1 . G 54 54 51905 1 . U 55 55 51905 1 . C 56 56 51905 1 . U 57 57 51905 1 . A 58 58 51905 1 . G 59 59 51905 1 . G 60 60 51905 1 . C 61 61 51905 1 . C 62 62 51905 1 . C 63 63 51905 1 stop_ save_ #################### # Natural source # #################### save_natural_source_1 _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source_1 _Entity_natural_src_list.Entry_ID 51905 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 12104 organism . 'Encephalomyocarditis virus' 'Encephalomyocarditis virus' . . Viruses . Cardiovirus 'Cardiovirus A' . . . . . . . . . . . . . 51905 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source_1 _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source_1 _Entity_experimental_src_list.Entry_ID 51905 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'enzymatic semisynthesis' . . . . . . . . . . . . . . . . 51905 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 51905 _Sample.ID 1 _Sample.Name 'StASL domain' _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'StASL domain' '[U-2H, {13C8,1H2,1H8}-A, {13C8,1H8}-G]' . . 1 $entity_1 . . 1 . . mM . . . . 51905 1 2 D2O 'natural abundance' . . . . . . 100 . . % . . . . 51905 1 3 'potassium phosphate' 'natural abundance' . . . . . . 10 . . mM . . . . 51905 1 4 'sodium chloride' 'natural abundance' . . . . . . 10 . . mM . . . . 51905 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 51905 _Sample_condition_list.ID 1 _Sample_condition_list.Name 1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 0.02 . M 51905 1 pH 6.4 . pH 51905 1 pressure 1 . atm 51905 1 temperature 303 . K 51905 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 51905 _Software.ID 1 _Software.Type . _Software.Name TOPSPIN _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 51905 1 'peak picking' . 51905 1 processing . 51905 1 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 51905 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name 'Ascend Evo 1.0GHz' _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'Ascend Evo 1.0GHz' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 1000 save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 51905 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-13C TROSY aromatic' no no no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 51905 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 51905 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name DSS _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 DSS 'methyl protons' . . . . ppm 0 external indirect 0.251449530 . . . . . 51905 1 H 1 DSS 'methyl protons' . . . . ppm 0 external direct 1 . . . . . 51905 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 51905 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name '1H8-13C8 signals' _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-13C TROSY aromatic' . . . 51905 1 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 1 $software_1 . . 51905 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 G H8 H 1 8.21 0.01 . 1 . . . . . 1 G H8 . 51905 1 2 . 1 . 1 1 1 G C8 C 13 136.82 0.02 . 1 . . . . . 1 G C8 . 51905 1 3 . 1 . 1 2 2 G H8 H 1 7.66 0.01 . 1 . . . . . 2 G H8 . 51905 1 4 . 1 . 1 2 2 G C8 C 13 134.14 0.02 . 1 . . . . . 2 G C8 . 51905 1 5 . 1 . 1 3 3 G H8 H 1 7.36 0.01 . 1 . . . . . 3 G H8 . 51905 1 6 . 1 . 1 3 3 G C8 C 13 133.81 0.02 . 1 . . . . . 3 G C8 . 51905 1 7 . 1 . 1 6 6 G H8 H 1 7.80 0.01 . 1 . . . . . 6 G H8 . 51905 1 8 . 1 . 1 6 6 G C8 C 13 135.70 0.02 . 1 . . . . . 6 G C8 . 51905 1 9 . 1 . 1 7 7 A H8 H 1 8.08 0.01 . 1 . . . . . 7 A H8 . 51905 1 10 . 1 . 1 7 7 A C8 C 13 139.21 0.02 . 1 . . . . . 7 A C8 . 51905 1 11 . 1 . 1 8 8 A H8 H 1 8.38 0.01 . 1 . . . . . 8 A H8 . 51905 1 12 . 1 . 1 8 8 A C8 C 13 139.65 0.02 . 1 . . . . . 8 A C8 . 51905 1 13 . 1 . 1 9 9 G H8 H 1 7.90 0.01 . 1 . . . . . 9 G H8 . 51905 1 14 . 1 . 1 9 9 G C8 C 13 135.82 0.02 . 1 . . . . . 9 G C8 . 51905 1 15 . 1 . 1 10 10 G H8 H 1 7.39 0.01 . 1 . . . . . 10 G H8 . 51905 1 16 . 1 . 1 10 10 G C8 C 13 134.51 0.02 . 1 . . . . . 10 G C8 . 51905 1 17 . 1 . 1 11 11 A H8 H 1 7.78 0.01 . 1 . . . . . 11 A H8 . 51905 1 18 . 1 . 1 11 11 A C8 C 13 137.16 0.02 . 1 . . . . . 11 A C8 . 51905 1 19 . 1 . 1 13 13 G H8 H 1 8.01 0.01 . 1 . . . . . 13 G H8 . 51905 1 20 . 1 . 1 13 13 G C8 C 13 136.19 0.02 . 1 . . . . . 13 G C8 . 51905 1 21 . 1 . 1 17 17 A H8 H 1 8.14 0.01 . 1 . . . . . 17 A H8 . 51905 1 22 . 1 . 1 17 17 A C8 C 13 137.46 0.02 . 1 . . . . . 17 A C8 . 51905 1 23 . 1 . 1 18 18 G H8 H 1 7.40 0.01 . 1 . . . . . 18 G H8 . 51905 1 24 . 1 . 1 18 18 G C8 C 13 133.59 0.02 . 1 . . . . . 18 G C8 . 51905 1 25 . 1 . 1 23 23 G H8 H 1 7.94 0.01 . 1 . . . . . 23 G H8 . 51905 1 26 . 1 . 1 23 23 G C8 C 13 140.67 0.02 . 1 . . . . . 23 G C8 . 51905 1 27 . 1 . 1 24 24 G H8 H 1 8.37 0.01 . 1 . . . . . 24 G H8 . 51905 1 28 . 1 . 1 24 24 G C8 C 13 136.65 0.02 . 1 . . . . . 24 G C8 . 51905 1 29 . 1 . 1 27 27 G H8 H 1 7.79 0.01 . 1 . . . . . 27 G H8 . 51905 1 30 . 1 . 1 27 27 G C8 C 13 134.08 0.02 . 1 . . . . . 27 G C8 . 51905 1 31 . 1 . 1 28 28 G H8 H 1 7.23 0.01 . 1 . . . . . 28 G H8 . 51905 1 32 . 1 . 1 28 28 G C8 C 13 133.64 0.02 . 1 . . . . . 28 G C8 . 51905 1 33 . 1 . 1 29 29 G H8 H 1 7.22 0.01 . 1 . . . . . 29 G H8 . 51905 1 34 . 1 . 1 29 29 G C8 C 13 134.04 0.02 . 1 . . . . . 29 G C8 . 51905 1 35 . 1 . 1 30 30 G H8 H 1 7.52 0.01 . 1 . . . . . 30 G H8 . 51905 1 36 . 1 . 1 30 30 G C8 C 13 134.67 0.02 . 1 . . . . . 30 G C8 . 51905 1 37 . 1 . 1 35 35 G H8 H 1 7.53 0.01 . 1 . . . . . 35 G H8 . 51905 1 38 . 1 . 1 35 35 G C8 C 13 133.65 0.02 . 1 . . . . . 35 G C8 . 51905 1 39 . 1 . 1 39 39 G H8 H 1 7.92 0.01 . 1 . . . . . 39 G H8 . 51905 1 40 . 1 . 1 39 39 G C8 C 13 140.57 0.02 . 1 . . . . . 39 G C8 . 51905 1 41 . 1 . 1 41 41 G H8 H 1 7.67 0.01 . 1 . . . . . 41 G H8 . 51905 1 42 . 1 . 1 41 41 G C8 C 13 134.69 0.02 . 1 . . . . . 41 G C8 . 51905 1 43 . 1 . 1 42 42 A H8 H 1 7.82 0.01 . 1 . . . . . 42 A H8 . 51905 1 44 . 1 . 1 42 42 A C8 C 13 136.97 0.02 . 1 . . . . . 42 A C8 . 51905 1 45 . 1 . 1 43 43 G H8 H 1 7.10 0.01 . 1 . . . . . 43 G H8 . 51905 1 46 . 1 . 1 43 43 G C8 C 13 133.35 0.02 . 1 . . . . . 43 G C8 . 51905 1 47 . 1 . 1 44 44 G H8 H 1 7.14 0.01 . 1 . . . . . 44 G H8 . 51905 1 48 . 1 . 1 44 44 G C8 C 13 133.69 0.02 . 1 . . . . . 44 G C8 . 51905 1 49 . 1 . 1 47 47 A H8 H 1 8.29 0.01 . 1 . . . . . 47 A H8 . 51905 1 50 . 1 . 1 47 47 A C8 C 13 139.47 0.02 . 1 . . . . . 47 A C8 . 51905 1 51 . 1 . 1 48 48 A H8 H 1 8.12 0.01 . 1 . . . . . 48 A H8 . 51905 1 52 . 1 . 1 48 48 A C8 C 13 138.86 0.02 . 1 . . . . . 48 A C8 . 51905 1 53 . 1 . 1 49 49 A H8 H 1 8.03 0.01 . 1 . . . . . 49 A H8 . 51905 1 54 . 1 . 1 49 49 A C8 C 13 138.48 0.02 . 1 . . . . . 49 A C8 . 51905 1 55 . 1 . 1 50 50 A H8 H 1 8.03 0.01 . 1 . . . . . 50 A H8 . 51905 1 56 . 1 . 1 50 50 A C8 C 13 138.27 0.02 . 1 . . . . . 50 A C8 . 51905 1 57 . 1 . 1 51 51 A H8 H 1 8.04 0.01 . 1 . . . . . 51 A H8 . 51905 1 58 . 1 . 1 51 51 A C8 C 13 138.58 0.02 . 1 . . . . . 51 A C8 . 51905 1 59 . 1 . 1 52 52 A H8 H 1 8.02 0.01 . 1 . . . . . 52 A H8 . 51905 1 60 . 1 . 1 52 52 A C8 C 13 137.88 0.02 . 1 . . . . . 52 A C8 . 51905 1 61 . 1 . 1 54 54 G H8 H 1 7.75 0.01 . 1 . . . . . 54 G H8 . 51905 1 62 . 1 . 1 54 54 G C8 C 13 135.17 0.02 . 1 . . . . . 54 G C8 . 51905 1 63 . 1 . 1 58 58 A H8 H 1 8.24 0.01 . 1 . . . . . 58 A H8 . 51905 1 64 . 1 . 1 58 58 A C8 C 13 138.96 0.02 . 1 . . . . . 58 A C8 . 51905 1 65 . 1 . 1 59 59 G H8 H 1 7.94 0.01 . 1 . . . . . 59 G H8 . 51905 1 66 . 1 . 1 59 59 G C8 C 13 135.75 0.02 . 1 . . . . . 59 G C8 . 51905 1 67 . 1 . 1 60 60 G H8 H 1 7.44 0.01 . 1 . . . . . 60 G H8 . 51905 1 68 . 1 . 1 60 60 G C8 C 13 134.13 0.02 . 1 . . . . . 60 G C8 . 51905 1 stop_ save_