data_50350 ####################### # Entry information # ####################### save_entry_information _Saveframe_category entry_information _Entry_title ; Assignment of base 15N and 1H chemical shifts for 3_SL3base ; _BMRB_accession_number 50350 _BMRB_flat_file_name bmr50350.str _Entry_type original _Submission_date 2020-06-23 _Accession_date 2020-06-23 _Entry_origination author _NMR_STAR_version 2.1.1 _Experimental_method NMR _Details . loop_ _Author_ordinal _Author_family_name _Author_given_name _Author_middle_initials _Author_family_title 1 Schwalbe Harald . . 2 Richter Christian . . stop_ loop_ _Saveframe_category_type _Saveframe_category_type_count assigned_chemical_shifts 1 stop_ loop_ _Data_type _Data_type_count "1H chemical shifts" 30 "15N chemical shifts" 44 stop_ loop_ _Revision_date _Revision_keyword _Revision_author _Revision_detail 2020-12-18 update BMRB 'update entry citation' 2020-07-10 original author 'original release' stop_ loop_ _Related_BMRB_accession_number _Relationship 50339 'chemical shifts of the 5_SL5B+C' 50340 'chemical shifts of the 5_SL5stem' 50341 'chemical shifts of the 3_s2m' 50342 'chemical shifts of the 3_SL1' 50343 'chemical shifts of the 2_SL3' 50344 'chemical shifts of the 5_SL2+3' 50346 'chemical shifts of the 5_SL5a' 50347 'chemical shifts of the 5_SL4' 50348 'chemical shifts of the PK (Pseudoknot)' 50349 'chemical shifts of the 5_SL1' 50351 'chemical shifts of the 5_SL6' 50352 'chemical shifts of the 5_SL8' stop_ _Original_release_date 2020-06-23 save_ ############################# # Citation for this entry # ############################# save_citations_1 _Saveframe_category entry_citation _Citation_full . _Citation_title ; Secondary structure determination of conserved SARS-CoV-2 RNA elements by NMR spectroscopy ; _Citation_status published _Citation_type journal _CAS_abstract_code . _MEDLINE_UI_code . _PubMed_ID 33167030 loop_ _Author_ordinal _Author_family_name _Author_given_name _Author_middle_initials _Author_family_title 1 Wacker Anna . . 2 Weigand Julia E. . 3 Akabayov Sabine R. . 4 Altincekic Nadide . . 5 'Kaur Bains' Jasleen . . 6 Banijamali Elnaz . . 7 Binas Oliver . . 8 Castillo-Martinez Jesus . . 9 Cetiner Erhan . . 10 Ceylan Betul . . 11 Chiu Liang-Yuan . . 12 Davila-Calderon Jesse . . 13 'De Jesus' Vanessa . . 14 Dhamotharan Karthikeyan . . 15 Duchardt-Ferner Elke . . 16 Ferner Jan . . 17 Frydman Lucio . . 18 Furtig Boris . . 19 Gallego Jose . . 20 Grun 'J. Tassilo' . . 21 Hacker Carolin . . 22 Haddad Christina . . 23 Hahnke Martin . . 24 Hengesbach Martin . . 25 Hiller Fabian . . 26 Hohmann Katharina F. . 27 Hymon Daniel . . 28 Jonker Henry . . 29 Keller Heiko . . 30 Knezic Bozana . . 31 Landgraf Tom . . 32 Lohr Frank . . 33 Luo Luke . . 34 Mertinkus Klara R. . 35 Muhs Christina . . 36 Novakovic Mihajlo . . 37 Oxenfarth Andreas . . 38 Palomino-Schatzlein Martina . . 39 Petzold Katja . . 40 Peter Stephen A. . 41 Pyper Dennis J. . 42 Qureshi Nusrat S. . 43 Riad Magdalena . . 44 Richter Christian . . 45 Saxena Krishna . . 46 Schamber Tatjana . . 47 Scherf Tali . . 48 Schlagnitweit Judith . . 49 Schlundt Andreas . . 50 Schnieders Robbin . . 51 Schwalbe Harald . . 52 Simba-Lahuasi Alvaro . . 53 Sreeramulu Sridhar . . 54 Stirnal Elke . . 55 Sudakov Alexey . . 56 Tants Jan-Niklas . . 57 Tolbert Blanton S. . 58 Vogele Jenny . . 59 Weiss Lena . . 60 Wirmer-Bartoschek Julia . . 61 'Wirtz Martin' Maria A. . 62 Wohnert Jens . . 63 Zetzsche Heidi . . stop_ _Journal_abbreviation 'Nucleic Acids Res.' _Journal_name_full 'Nucleic acids research' _Journal_volume 48 _Journal_issue 22 _Journal_ISSN 1362-4962 _Journal_CSD . _Book_chapter_title . _Book_volume . _Book_series . _Book_ISBN . _Conference_state_province . _Conference_abstract_number . _Page_first 12415 _Page_last 12435 _Year 2020 _Details . save_ ################################## # Molecular system description # ################################## save_assembly_1 _Saveframe_category molecular_system _Mol_system_name 3_SL3base _Enzyme_commission_number . loop_ _Mol_system_component_name _Mol_label 3_SL3base $entity_1 stop_ _System_molecular_weight . _System_physical_state native _System_oligomer_state ? _System_paramagnetic no _System_thiol_state . _Database_query_date . _Details . save_ ######################## # Monomeric polymers # ######################## save_entity_1 _Saveframe_category monomeric_polymer _Mol_type polymer _Mol_polymer_class RNA _Name_common entity_1 _Molecular_mass . _Mol_thiol_state 'not present' _Details . ############################## # Polymer residue sequence # ############################## _Residue_count 90 _Mol_residue_sequence ; GGAAUUCUCGUAACUACAUA GCACAAGUAGAUGUAGUUAA CUUUAAUCUCACACUUCGGU GUGAUUUUAAUAGCUUCUUA GGAGAAUGAC ; loop_ _Residue_seq_code _Residue_author_seq_code _Residue_label 1 29619 G 2 29620 G 3 29621 A 4 29622 A 5 29623 U 6 29624 U 7 29625 C 8 29626 U 9 29627 C 10 29628 G 11 29629 U 12 29630 A 13 29631 A 14 29632 C 15 29633 U 16 29634 A 17 29635 C 18 29636 A 19 29637 U 20 29638 A 21 29639 G 22 29640 C 23 29641 A 24 29642 C 25 29643 A 26 29644 A 27 29645 G 28 29646 U 29 29647 A 30 29648 G 31 29649 A 32 29650 U 33 29651 G 34 29652 U 35 29653 A 36 29654 G 37 29655 U 38 29656 U 39 29657 A 40 29658 A 41 29659 C 42 29660 U 43 29661 U 44 29662 U 45 29663 A 46 29664 A 47 29665 U 48 29666 C 49 29667 U 50 29668 C 51 29669 A 52 29670 C 53 29671 A 54 29672 C 55 29673 U 56 29674 U 57 29675 C 58 29676 G 59 29677 G 60 29840 U 61 29841 G 62 29842 U 63 29843 G 64 29844 A 65 29845 U 66 29846 U 67 29847 U 68 29848 U 69 29849 A 70 29850 A 71 29851 U 72 29852 A 73 29853 G 74 29854 C 75 29855 U 76 29856 U 77 29857 C 78 29858 U 79 29859 U 80 29860 A 81 29861 G 82 29862 G 83 29863 A 84 29864 G 85 29865 A 86 29866 A 87 29867 U 88 29868 G 89 29869 A 90 29870 C stop_ _Sequence_homology_query_date . _Sequence_homology_query_revised_last_date . save_ #################### # Natural source # #################### save_natural_source_1 _Saveframe_category natural_source loop_ _Mol_label _Organism_name_common _NCBI_taxonomy_ID _Superkingdom _Kingdom _Genus _Species _Strain $entity_1 SARS-CoV-2 2697049 Viruses . Betacoronavirus HCoV-SARS SARS-CoV-2 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source_1 _Saveframe_category experimental_source loop_ _Mol_label _Production_method _Host_organism_name_common _Genus _Species _Strain _Vector_name $entity_1 'reverse transcriptase' . . . . . stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Saveframe_category sample _Sample_type solution _Details . loop_ _Mol_label _Concentration_value _Concentration_value_units _Isotopic_labeling $entity_1 0.23 mM [U-15N] 'potassium phosphate' 25 mM 'natural abundance' 'potassium chloride' 50 mM 'natural abundance' stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Saveframe_category software _Name LOGS _Version 2.2 loop_ _Task collection stop_ _Details . save_ save_software_2 _Saveframe_category software _Name SPARKY _Version 3.114 loop_ _Task 'chemical shift assignment' 'peak picking' stop_ _Details . save_ save_software_3 _Saveframe_category software _Name TOPSPIN _Version 4.0.9 loop_ _Task collection stop_ _Details . save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _Saveframe_category NMR_spectrometer _Manufacturer Bruker _Model 'Bruker Avance neo 600 MHz' _Field_strength 600 _Details . save_ ############################# # NMR applied experiments # ############################# save_HSQC[15N]-2J_1 _Saveframe_category NMR_applied_experiment _Experiment_name HSQC[15N]-2J _Sample_label $sample_1 save_ save_HNN-COSY[15N]_2 _Saveframe_category NMR_applied_experiment _Experiment_name HNN-COSY[15N] _Sample_label $sample_1 save_ save_TROSY[15N]_3 _Saveframe_category NMR_applied_experiment _Experiment_name TROSY[15N] _Sample_label $sample_1 save_ save_1H-JR[15N]_4 _Saveframe_category NMR_applied_experiment _Experiment_name 1H-JR[15N] _Sample_label $sample_1 save_ save_NOESY[15N]-Imino_5 _Saveframe_category NMR_applied_experiment _Experiment_name NOESY[15N]-Imino _Sample_label $sample_1 save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Saveframe_category sample_conditions _Details . loop_ _Variable_type _Variable_value _Variable_value_error _Variable_value_units 'ionic strength' 0 . mM pH 6.2 . pH pressure 1 . atm temperature 283 . K stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Saveframe_category chemical_shift_reference _Details . loop_ _Mol_common_name _Atom_type _Atom_isotope_number _Atom_group _Chem_shift_units _Chem_shift_value _Reference_method _Reference_type _External_reference_sample_geometry _External_reference_location _External_reference_axis _Indirect_shift_ratio DSS C 13 'methyl protons' ppm 0.00 na indirect . . . 0.251449530 DSS H 1 'methyl protons' ppm 0.00 internal direct . . . 1.000000000 DSS N 15 'methyl protons' ppm 0.00 na indirect . . . 0.101329118 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Saveframe_category assigned_chemical_shifts _Details . loop_ _Software_label $software_2 stop_ loop_ _Experiment_label HSQC[15N]-2J HNN-COSY[15N] TROSY[15N] 1H-JR[15N] NOESY[15N]-Imino stop_ loop_ _Sample_label $sample_1 stop_ _Sample_conditions_label $sample_conditions_1 _Chem_shift_reference_set_label $chem_shift_reference_1 _Mol_system_component_name 3_SL3base _Text_data_format . _Text_data . loop_ _Atom_shift_assign_ID _Residue_author_seq_code _Residue_seq_code _Residue_label _Atom_name _Atom_type _Chem_shift_value _Chem_shift_value_error _Chem_shift_ambiguity_code 1 29624 6 U H3 H 13.804 . 1 2 29624 6 U N3 N 163.078 . 1 3 29625 7 C N3 N 197.707 . 1 4 29626 8 U H3 H 14.0966 . 1 5 29626 8 U N3 N 162.703 . 1 6 29632 14 C N3 N 197.387 . 1 7 29634 16 A H2 H 6.98282 . 1 8 29634 16 A N1 N 222.21 . 1 9 29634 16 A N3 N 211.428 . 1 10 29635 17 C N3 N 196.713 . 1 11 29636 18 A H2 H 7.24444 . 1 12 29636 18 A N1 N 221.143 . 1 13 29636 18 A N3 N 213.867 . 1 14 29650 32 U H3 H 13.4456 . 1 15 29650 32 U N3 N 162.244 . 1 16 29651 33 G H1 H 12.4832 . 1 17 29651 33 G N1 N 147.325 . 1 18 29652 34 U H3 H 13.3215 . 1 19 29652 34 U N3 N 161.634 . 1 20 29654 36 G H1 H 13.3874 . 1 21 29654 36 G N1 N 148.083 . 1 22 29662 44 U H3 H 13.2561 . 1 23 29662 44 U N3 N 161.548 . 1 24 29663 45 A H2 H 6.49864 . 1 25 29663 45 A N1 N 220.65 . 1 26 29663 45 A N3 N 211.989 . 1 27 29664 46 A N1 N 221.512 . 1 28 29665 47 U H3 H 11.164 . 5 29 29665 47 U N3 N 157.557 . 5 30 29667 49 U H3 H 14.4921 . 1 31 29667 49 U N3 N 163.23 . 1 32 29668 50 C N3 N 198.042 . 1 33 29669 51 A H2 H 7.27609 . 1 34 29669 51 A N1 N 221.38 . 1 35 29669 51 A N3 N 212.572 . 1 36 29670 52 C N3 N 196.868 . 1 37 29671 53 A H2 H 7.39659 . 1 38 29671 53 A N1 N 221.595 . 1 39 29672 54 C N3 N 195.989 . 1 40 29673 55 U H3 H 11.732 . 1 41 29673 55 U N3 N 159.78 . 1 42 29676 58 G H1 H 9.912 . 1 43 29676 58 G N1 N 143.32 . 1 44 29677 59 G H1 H 13.4154 . 1 45 29677 59 G N1 N 148.043 . 1 46 29840 60 U H3 H 13.7362 . 1 47 29840 60 U N3 N 162.266 . 1 48 29841 61 G H1 H 12.5576 . 1 49 29841 61 G N1 N 147.418 . 1 50 29842 62 U H3 H 13.6455 . 1 51 29842 62 U N3 N 162.016 . 1 52 29843 63 G H1 H 11.7273 . 1 53 29843 63 G N1 N 146.287 . 1 54 29844 64 A N1 N 222.047 . 1 55 29845 65 U H3 H 12.152 . 1 56 29845 65 U N3 N 160.04 . 1 57 29846 66 U H3 H 11.164 . 5 58 29846 66 U N3 N 157.557 . 5 59 29847 67 U H3 H 14.5201 . 1 60 29847 67 U N3 N 163.167 . 1 61 29848 68 U H3 H 12.6099 . 1 62 29848 68 U N3 N 162.003 . 1 63 29849 69 A H2 H 6.72464 . 1 64 29849 69 A N1 N 221.164 . 1 65 29849 69 A N3 N 212.382 . 1 66 29862 82 G H1 H 12.016 . 1 67 29862 82 G N1 N 146.542 . 1 68 29863 83 A H2 H 7.4007 . 1 69 29863 83 A N1 N 220.738 . 1 70 29864 84 G H1 H 12.3903 . 1 71 29864 84 G N1 N 146.812 . 1 72 29865 85 A H2 H 7.14676 . 1 73 29865 85 A N1 N 220.932 . 1 74 29865 85 A N3 N 212.296 . 1 stop_ save_