data_50343 ####################### # Entry information # ####################### save_entry_information _Saveframe_category entry_information _Entry_title ; Assignment of base 1H and 15N chemical shifts for 3_SL2 ; _BMRB_accession_number 50343 _BMRB_flat_file_name bmr50343.str _Entry_type original _Submission_date 2020-06-23 _Accession_date 2020-06-23 _Entry_origination author _NMR_STAR_version 2.1.1 _Experimental_method NMR _Details . loop_ _Author_ordinal _Author_family_name _Author_given_name _Author_middle_initials _Author_family_title 1 Schwalbe Harald . . 2 Richter Christian . . stop_ loop_ _Saveframe_category_type _Saveframe_category_type_count assigned_chemical_shifts 2 stop_ loop_ _Data_type _Data_type_count "1H chemical shifts" 49 "13C chemical shifts" 18 "15N chemical shifts" 27 stop_ loop_ _Revision_date _Revision_keyword _Revision_author _Revision_detail 2020-12-18 update BMRB 'update entry citation' 2020-07-10 original author 'original release' stop_ loop_ _Related_BMRB_accession_number _Relationship 50339 'chemical shifts of the 5_SL5B+C' 50340 'chemical shifts of the 5_SL5stem' 50341 'chemical shifts of the 3_s2m' 50342 'chemical shifts of the 3_SL1' 50344 'chemical shifts of the 5_SL2+3' 50346 'chemical shifts of the 5_SL5a' 50347 'chemical shifts of the 5_SL4' 50348 'chemical shifts of the PK (Pseudoknot)' 50349 'chemical shifts of the 5_SL1' 50350 'chemical shifts of the 3_SL3base' 50351 'chemical shifts of the 5_SL6' 50352 'chemical shifts of the 5_SL8' stop_ _Original_release_date 2020-06-23 save_ ############################# # Citation for this entry # ############################# save_citations_1 _Saveframe_category entry_citation _Citation_full . _Citation_title ; Secondary structure determination of conserved SARS-CoV-2 RNA elements by NMR spectroscopy ; _Citation_status published _Citation_type journal _CAS_abstract_code . _MEDLINE_UI_code . _PubMed_ID 33167030 loop_ _Author_ordinal _Author_family_name _Author_given_name _Author_middle_initials _Author_family_title 1 Wacker Anna . . 2 Weigand Julia E. . 3 Akabayov Sabine R. . 4 Altincekic Nadide . . 5 'Kaur Bains' Jasleen . . 6 Banijamali Elnaz . . 7 Binas Oliver . . 8 Castillo-Martinez Jesus . . 9 Cetiner Erhan . . 10 Ceylan Betul . . 11 Chiu Liang-Yuan . . 12 Davila-Calderon Jesse . . 13 'De Jesus' Vanessa . . 14 Dhamotharan Karthikeyan . . 15 Duchardt-Ferner Elke . . 16 Ferner Jan . . 17 Frydman Lucio . . 18 Furtig Boris . . 19 Gallego Jose . . 20 Grun 'J. Tassilo' . . 21 Hacker Carolin . . 22 Haddad Christina . . 23 Hahnke Martin . . 24 Hengesbach Martin . . 25 Hiller Fabian . . 26 Hohmann Katharina F. . 27 Hymon Daniel . . 28 Jonker Henry . . 29 Keller Heiko . . 30 Knezic Bozana . . 31 Landgraf Tom . . 32 Lohr Frank . . 33 Luo Luke . . 34 Mertinkus Klara R. . 35 Muhs Christina . . 36 Novakovic Mihajlo . . 37 Oxenfarth Andreas . . 38 Palomino-Schatzlein Martina . . 39 Petzold Katja . . 40 Peter Stephen A. . 41 Pyper Dennis J. . 42 Qureshi Nusrat S. . 43 Riad Magdalena . . 44 Richter Christian . . 45 Saxena Krishna . . 46 Schamber Tatjana . . 47 Scherf Tali . . 48 Schlagnitweit Judith . . 49 Schlundt Andreas . . 50 Schnieders Robbin . . 51 Schwalbe Harald . . 52 Simba-Lahuasi Alvaro . . 53 Sreeramulu Sridhar . . 54 Stirnal Elke . . 55 Sudakov Alexey . . 56 Tants Jan-Niklas . . 57 Tolbert Blanton S. . 58 Vogele Jenny . . 59 Weiss Lena . . 60 Wirmer-Bartoschek Julia . . 61 'Wirtz Martin' Maria A. . 62 Wohnert Jens . . 63 Zetzsche Heidi . . stop_ _Journal_abbreviation 'Nucleic Acids Res.' _Journal_name_full 'Nucleic acids research' _Journal_volume 48 _Journal_issue 22 _Journal_ISSN 1362-4962 _Journal_CSD . _Book_chapter_title . _Book_volume . _Book_series . _Book_ISBN . _Conference_state_province . _Conference_abstract_number . _Page_first 12415 _Page_last 12435 _Year 2020 _Details . save_ ################################## # Molecular system description # ################################## save_assembly_1 _Saveframe_category molecular_system _Mol_system_name 3_SL2 _Enzyme_commission_number . loop_ _Mol_system_component_name _Mol_label 3_SL2 $entity_1 stop_ _System_molecular_weight . _System_physical_state native _System_oligomer_state ? _System_paramagnetic no _System_thiol_state . _Database_query_date . _Details . save_ ######################## # Monomeric polymers # ######################## save_entity_1 _Saveframe_category monomeric_polymer _Mol_type polymer _Mol_polymer_class RNA _Name_common entity_1 _Molecular_mass . _Mol_thiol_state 'not present' _Details . ############################## # Polymer residue sequence # ############################## _Residue_count 31 _Mol_residue_sequence ; GGAACUACAUAGCACAAGUA GAUGUAGUUCC ; loop_ _Residue_seq_code _Residue_author_seq_code _Residue_label 1 -2 G 2 -1 G 3 29630 A 4 29631 A 5 29632 C 6 29633 U 7 29634 A 8 29635 C 9 29636 A 10 29637 U 11 29638 A 12 29639 G 13 29640 C 14 29641 A 15 29642 C 16 29643 A 17 29644 A 18 29645 G 19 29646 U 20 29647 A 21 29648 G 22 29649 A 23 29650 U 24 29651 G 25 29652 U 26 29653 A 27 29654 G 28 29655 U 29 29656 U 30 1 C 31 2 C stop_ _Sequence_homology_query_date . _Sequence_homology_query_revised_last_date . save_ #################### # Natural source # #################### save_natural_source_1 _Saveframe_category natural_source loop_ _Mol_label _Organism_name_common _NCBI_taxonomy_ID _Superkingdom _Kingdom _Genus _Species _Strain $entity_1 SARS-CoV-2 2697049 Viruses . Betacoronavirus HCoV-SARS SARS-CoV-2 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source_1 _Saveframe_category experimental_source loop_ _Mol_label _Production_method _Host_organism_name_common _Genus _Species _Strain _Vector_name $entity_1 transcription . . . . . stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Saveframe_category sample _Sample_type solution _Details . loop_ _Mol_label _Concentration_value _Concentration_value_units _Isotopic_labeling $entity_1 150 uM [U-15N] stop_ save_ save_sample_2 _Saveframe_category sample _Sample_type solution _Details . loop_ _Mol_label _Concentration_value _Concentration_value_units _Isotopic_labeling $entity_1 350 uM [U-15N] 'potassium phosphate' 25 mM 'natural abundance' KCl 50 mM 'natural abundance' stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Saveframe_category software _Name LOGS _Version 2.2 loop_ _Task collection stop_ _Details . save_ save_software_2 _Saveframe_category software _Name SPARKY _Version 3.114 loop_ _Task 'chemical shift assignment' 'peak picking' stop_ _Details . save_ save_software_3 _Saveframe_category software _Name TOPSPIN _Version 3.6.2 loop_ _Task collection stop_ _Details . save_ save_software_4 _Saveframe_category software _Name TOPSPIN _Version 4.0.8 loop_ _Task collection stop_ _Details . save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _Saveframe_category NMR_spectrometer _Manufacturer Bruker _Model 'Bruker Avance III HD 600 MHz' _Field_strength 600 _Details . save_ save_NMR_spectrometer_2 _Saveframe_category NMR_spectrometer _Manufacturer Bruker _Model 'Bruker Avance neo 600 MHz' _Field_strength 600 _Details . save_ ############################# # NMR applied experiments # ############################# save_1D_1H_1 _Saveframe_category NMR_applied_experiment _Experiment_name '1D 1H' _Sample_label $sample_2 save_ save_HMT-NOESY_2 _Saveframe_category NMR_applied_experiment _Experiment_name HMT-NOESY _Sample_label $sample_1 save_ save_NOESY[15N]CPMG_3 _Saveframe_category NMR_applied_experiment _Experiment_name NOESY[15N]CPMG _Sample_label $sample_1 save_ save_HSQC[15N]-2J_4 _Saveframe_category NMR_applied_experiment _Experiment_name HSQC[15N]-2J _Sample_label $sample_1 save_ save_1H-JR[15N]_5 _Saveframe_category NMR_applied_experiment _Experiment_name 1H-JR[15N] _Sample_label $sample_1 save_ save_HSQC[15N]-Amino_6 _Saveframe_category NMR_applied_experiment _Experiment_name HSQC[15N]-Amino _Sample_label $sample_1 save_ save_NOESY[15N]-Imino_7 _Saveframe_category NMR_applied_experiment _Experiment_name NOESY[15N]-Imino _Sample_label $sample_1 save_ save_NOESY[15N]-Imino_8 _Saveframe_category NMR_applied_experiment _Experiment_name NOESY[15N]-Imino _Sample_label $sample_1 save_ save_TROSY[15N]_9 _Saveframe_category NMR_applied_experiment _Experiment_name TROSY[15N] _Sample_label $sample_1 save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Saveframe_category sample_conditions _Details . loop_ _Variable_type _Variable_value _Variable_value_error _Variable_value_units 'ionic strength' 0 . mM pH 7 . pH pressure 1 . atm temperature 283 . K stop_ save_ save_sample_conditions_2 _Saveframe_category sample_conditions _Details . loop_ _Variable_type _Variable_value _Variable_value_error _Variable_value_units 'ionic strength' 75 . mM pH 6.2 . pH pressure 1 . atm temperature 283 . K stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Saveframe_category chemical_shift_reference _Details . loop_ _Mol_common_name _Atom_type _Atom_isotope_number _Atom_group _Chem_shift_units _Chem_shift_value _Reference_method _Reference_type _External_reference_sample_geometry _External_reference_location _External_reference_axis _Indirect_shift_ratio DSS C 13 'methyl protons' ppm 0.00 na indirect . . . 0.251449530 DSS H 1 'methyl protons' ppm 0.00 internal direct . . . 1.000000000 DSS N 15 'methyl protons' ppm 0.00 na indirect . . . 0.101329118 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Saveframe_category assigned_chemical_shifts _Details . loop_ _Software_label $software_2 stop_ loop_ _Experiment_label '1D 1H' HMT-NOESY NOESY[15N]CPMG HSQC[15N]-2J 1H-JR[15N] HSQC[15N]-Amino NOESY[15N]-Imino TROSY[15N] stop_ loop_ _Sample_label $sample_2 $sample_1 stop_ _Sample_conditions_label $sample_conditions_2 _Chem_shift_reference_set_label $chem_shift_reference_1 _Mol_system_component_name 3_SL2 _Text_data_format . _Text_data . loop_ _Atom_shift_assign_ID _Residue_author_seq_code _Residue_seq_code _Residue_label _Atom_name _Atom_type _Chem_shift_value _Chem_shift_value_error _Chem_shift_ambiguity_code 1 -2 1 G H1 H 12.7132 . 1 2 -2 1 G C8 C 139.071 . 1 3 -2 1 G N1 N 147.185 . 1 4 -1 2 G H1 H 12.3955 . 1 5 -1 2 G H8 H 7.491 . 1 6 -1 2 G C8 C 136.783 . 1 7 -1 2 G N1 N 146.957 . 1 8 29630 3 A H2 H 7.15983 . 1 9 29630 3 A C2 C 152.865 . 1 10 29631 4 A H2 H 7.75286 . 1 11 29631 4 A C2 C 153.689 . 1 12 29632 5 C H41 H 8.341 . 1 13 29632 5 C H42 H 7.035 . 1 14 29633 6 U H3 H 13.2299 . 1 15 29633 6 U C6 C 141.774 . 1 16 29633 6 U N3 N 161.423 . 1 17 29634 7 A H2 H 6.9798 . 1 18 29634 7 A C2 C 153.115 . 1 19 29635 8 C H41 H 8.145 . 1 20 29635 8 C H42 H 6.932 . 1 21 29636 9 A H2 H 7.23967 . 1 22 29636 9 A C2 C 153.074 . 1 23 29650 23 U H3 H 13.4598 . 1 24 29650 23 U N3 N 162.205 . 1 25 29651 24 G H1 H 12.4848 . 1 26 29651 24 G H8 H 7.607 . 1 27 29651 24 G C8 C 136.223 . 1 28 29651 24 G N1 N 147.275 . 1 29 29652 25 U H3 H 13.3458 . 1 30 29652 25 U C6 C 141.301 . 1 31 29652 25 U N3 N 161.645 . 1 32 29653 26 A H2 H 6.72514 . 1 33 29653 26 A C2 C 152.427 . 1 34 29654 27 G H1 H 13.4257 . 1 35 29654 27 G H8 H 7.192 . 1 36 29654 27 G C8 C 135.876 . 1 37 29654 27 G N1 N 148.006 . 1 38 29655 28 U H3 H 14.3067 . 1 39 29655 28 U H6 H 7.734 . 1 40 29655 28 U C6 C 141.632 . 1 41 29655 28 U N3 N 162.446 . 1 42 29656 29 U H3 H 13.8644 . 1 43 29656 29 U H6 H 8.001 . 1 44 29656 29 U C6 C 142.424 . 1 45 29656 29 U N3 N 163.147 . 1 46 1 30 C H41 H 8.348 . 1 47 1 30 C H42 H 7.001 . 1 48 2 31 C H41 H 8.401 . 1 49 2 31 C H42 H 7.077 . 1 stop_ save_ save_assigned_chemical_shifts_2 _Saveframe_category assigned_chemical_shifts _Details . loop_ _Software_label $software_2 stop_ loop_ _Experiment_label '1D 1H' HMT-NOESY NOESY[15N]CPMG HSQC[15N]-2J 1H-JR[15N] HSQC[15N]-Amino NOESY[15N]-Imino TROSY[15N] stop_ loop_ _Sample_label $sample_2 $sample_1 stop_ _Sample_conditions_label $sample_conditions_2 _Chem_shift_reference_set_label $chem_shift_reference_1 _Mol_system_component_name 3_SL2 _Text_data_format . _Text_data . loop_ _Atom_shift_assign_ID _Residue_author_seq_code _Residue_seq_code _Residue_label _Atom_name _Atom_type _Chem_shift_value _Chem_shift_value_error _Chem_shift_ambiguity_code 1 -1 1 G H1 H 12.3934 . 1 2 -1 1 G N1 N 147.003 . 1 3 -2 2 G H1 H 12.74 . 1 4 -2 2 G N1 N 147.198 . 1 5 29630 3 A H2 H 7.1745 . 1 6 29630 3 A C2 C 152.932 . 1 7 29630 3 A N1 N 221.05 . 1 8 29631 4 A H2 H 7.76167 . 1 9 29631 4 A C2 C 153.733 . 1 10 29631 4 A N1 N 222.478 . 1 11 29632 5 C H41 H 8.313 . 1 12 29632 5 C H42 H 6.946 . 1 13 29632 5 C N3 N 197.493 . 1 14 29633 6 U H3 H 13.2026 . 1 15 29633 6 U N3 N 161.381 . 1 16 29634 7 A H2 H 6.9915 . 1 17 29634 7 A C2 C 153.189 . 1 18 29634 7 A N1 N 222.417 . 1 19 29635 8 C H41 H 8.125 . 1 20 29635 8 C H42 H 6.846 . 1 21 29635 8 C N3 N 196.695 . 1 22 29636 9 A H2 H 7.279 . 1 23 29636 9 A C2 C 153.192 . 1 24 29636 9 A N1 N 221.266 . 1 25 29650 23 U H3 H 13.431 . 1 26 29650 23 U N3 N 162.074 . 1 27 29651 24 G H1 H 12.51 . 1 28 29651 24 G N1 N 147.305 . 1 29 29652 25 U H3 H 13.3334 . 1 30 29652 25 U N3 N 161.608 . 1 31 29653 26 A H2 H 6.7475 . 1 32 29653 26 A C2 C 152.521 . 1 33 29653 26 A N1 N 221.153 . 1 34 29654 27 G H1 H 13.4217 . 1 35 29654 27 G N1 N 148.036 . 1 36 29655 28 U H3 H 14.269 . 1 37 29655 28 U N3 N 162.37 . 1 38 29656 29 U H3 H 13.8232 . 1 39 29656 29 U N3 N 163.056 . 1 40 1 30 C H41 H 8.324 . 1 41 1 30 C H42 H 6.926 . 1 42 1 30 C N3 N 198.413 . 1 43 2 31 C H41 H 8.339 . 1 44 2 31 C H42 H 7.005 . 1 45 2 31 C N3 N 196.088 . 1 stop_ save_