data_50342 ####################### # Entry information # ####################### save_entry_information_1 _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information_1 _Entry.ID 50342 _Entry.Title ; Assignment of base 1H and 15N chemical shifts for 3_SL1 ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2020-06-23 _Entry.Accession_date 2020-06-23 _Entry.Last_release_date 2020-06-23 _Entry.Original_release_date 2020-06-23 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.6.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Harald Schwalbe . . . . 50342 2 Christian Richter . . . . 50342 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 3 50342 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '15N chemical shifts' 75 50342 '1H chemical shifts' 70 50342 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 2 . . 2020-12-18 2020-06-23 update BMRB 'update entry citation' 50342 1 . . 2020-07-10 2020-06-23 original author 'original release' 50342 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 50339 'chemical shifts of the 5_SL5B+C' 50342 BMRB 50340 'chemical shifts of the 5_SL5stem' 50342 BMRB 50341 'chemical shifts of the 3_s2m' 50342 BMRB 50343 'chemical shifts of the 2_SL3' 50342 BMRB 50344 'chemical shifts of the 5_SL2+3' 50342 BMRB 50346 'chemical shifts of the 5_SL5a' 50342 BMRB 50347 'chemical shifts of the 5_SL4' 50342 BMRB 50348 'chemical shifts of the PK (Pseudoknot)' 50342 BMRB 50349 'chemical shifts of the 5_SL1' 50342 BMRB 50350 'chemical shifts of the 3_SL3base' 50342 BMRB 50351 'chemical shifts of the 5_SL6' 50342 BMRB 50352 'chemical shifts of the 5_SL8' 50342 NCBI NC_045512.2 'Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome.' 50342 stop_ save_ ############### # Citations # ############### save_citations_1 _Citation.Sf_category citations _Citation.Sf_framecode citations_1 _Citation.Entry_ID 50342 _Citation.ID 1 _Citation.Name 'citations 1' _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 33167030 _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Secondary structure determination of conserved SARS-CoV-2 RNA elements by NMR spectroscopy ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'Nucleic Acids Res.' _Citation.Journal_name_full 'Nucleic acids research' _Citation.Journal_volume 48 _Citation.Journal_issue 22 _Citation.Journal_ASTM . _Citation.Journal_ISSN 1362-4962 _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 12415 _Citation.Page_last 12435 _Citation.Year 2020 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Anna Wacker . . . . 50342 1 2 Julia Weigand . E. . . 50342 1 3 Sabine Akabayov . R. . . 50342 1 4 Nadide Altincekic . . . . 50342 1 5 Jasleen 'Kaur Bains' . . . . 50342 1 6 Elnaz Banijamali . . . . 50342 1 7 Oliver Binas . . . . 50342 1 8 Jesus Castillo-Martinez . . . . 50342 1 9 Erhan Cetiner . . . . 50342 1 10 Betul Ceylan . . . . 50342 1 11 Liang-Yuan Chiu . . . . 50342 1 12 Jesse Davila-Calderon . . . . 50342 1 13 Vanessa 'De Jesus' . . . . 50342 1 14 Karthikeyan Dhamotharan . . . . 50342 1 15 Elke Duchardt-Ferner . . . . 50342 1 16 Jan Ferner . . . . 50342 1 17 Lucio Frydman . . . . 50342 1 18 Boris Furtig . . . . 50342 1 19 Jose Gallego . . . . 50342 1 20 'J. Tassilo' Grun . . . . 50342 1 21 Carolin Hacker . . . . 50342 1 22 Christina Haddad . . . . 50342 1 23 Martin Hahnke . . . . 50342 1 24 Martin Hengesbach . . . . 50342 1 25 Fabian Hiller . . . . 50342 1 26 Katharina Hohmann . F. . . 50342 1 27 Daniel Hymon . . . . 50342 1 28 Henry Jonker . . . . 50342 1 29 Heiko Keller . . . . 50342 1 30 Bozana Knezic . . . . 50342 1 31 Tom Landgraf . . . . 50342 1 32 Frank Lohr . . . . 50342 1 33 Luke Luo . . . . 50342 1 34 Klara Mertinkus . R. . . 50342 1 35 Christina Muhs . . . . 50342 1 36 Mihajlo Novakovic . . . . 50342 1 37 Andreas Oxenfarth . . . . 50342 1 38 Martina Palomino-Schatzlein . . . . 50342 1 39 Katja Petzold . . . . 50342 1 40 Stephen Peter . A. . . 50342 1 41 Dennis Pyper . J. . . 50342 1 42 Nusrat Qureshi . S. . . 50342 1 43 Magdalena Riad . . . . 50342 1 44 Christian Richter . . . . 50342 1 45 Krishna Saxena . . . . 50342 1 46 Tatjana Schamber . . . . 50342 1 47 Tali Scherf . . . . 50342 1 48 Judith Schlagnitweit . . . . 50342 1 49 Andreas Schlundt . . . . 50342 1 50 Robbin Schnieders . . . . 50342 1 51 Harald Schwalbe . . . . 50342 1 52 Alvaro Simba-Lahuasi . . . . 50342 1 53 Sridhar Sreeramulu . . . . 50342 1 54 Elke Stirnal . . . . 50342 1 55 Alexey Sudakov . . . . 50342 1 56 Jan-Niklas Tants . . . . 50342 1 57 Blanton Tolbert . S. . . 50342 1 58 Jenny Vogele . . . . 50342 1 59 Lena Weiss . . . . 50342 1 60 Julia Wirmer-Bartoschek . . . . 50342 1 61 Maria 'Wirtz Martin' . A. . . 50342 1 62 Jens Wohnert . . . . 50342 1 63 Heidi Zetzsche . . . . 50342 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly_1 _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly_1 _Assembly.Entry_ID 50342 _Assembly.ID 1 _Assembly.Name 3_SL1 _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands 0 _Assembly.Metal_ions 0 _Assembly.Non_standard_bonds no _Assembly.Ambiguous_conformational_states no _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange no _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 3_SL1 1 $entity_1 . . yes native no no . . . 50342 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 50342 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGGCACAAGGCAGAUGGGCU AUAUAAACGUUUUCGCUUUU CCGUUUACGAUAUAUAGUCU ACUCUUGUGCCC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 72 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 -2 G . 50342 1 2 -1 G . 50342 1 3 29547 G . 50342 1 4 29548 C . 50342 1 5 29549 A . 50342 1 6 29550 C . 50342 1 7 29551 A . 50342 1 8 29552 A . 50342 1 9 29553 G . 50342 1 10 29554 G . 50342 1 11 29555 C . 50342 1 12 29556 A . 50342 1 13 29557 G . 50342 1 14 29558 A . 50342 1 15 29559 U . 50342 1 16 29560 G . 50342 1 17 29561 G . 50342 1 18 29562 G . 50342 1 19 29563 C . 50342 1 20 29564 U . 50342 1 21 29565 A . 50342 1 22 29566 U . 50342 1 23 29567 A . 50342 1 24 29568 U . 50342 1 25 29569 A . 50342 1 26 29570 A . 50342 1 27 29571 A . 50342 1 28 29572 C . 50342 1 29 29573 G . 50342 1 30 29574 U . 50342 1 31 29575 U . 50342 1 32 29576 U . 50342 1 33 29577 U . 50342 1 34 29578 C . 50342 1 35 29579 G . 50342 1 36 29580 C . 50342 1 37 29581 U . 50342 1 38 29582 U . 50342 1 39 29583 U . 50342 1 40 29584 U . 50342 1 41 29585 C . 50342 1 42 29586 C . 50342 1 43 29587 G . 50342 1 44 29588 U . 50342 1 45 29589 U . 50342 1 46 29590 U . 50342 1 47 29591 A . 50342 1 48 29592 C . 50342 1 49 29593 G . 50342 1 50 29594 A . 50342 1 51 29595 U . 50342 1 52 29596 A . 50342 1 53 29597 U . 50342 1 54 29598 A . 50342 1 55 29599 U . 50342 1 56 29600 A . 50342 1 57 29601 G . 50342 1 58 29602 U . 50342 1 59 29603 C . 50342 1 60 29604 U . 50342 1 61 29605 A . 50342 1 62 29606 C . 50342 1 63 29607 U . 50342 1 64 29608 C . 50342 1 65 29609 U . 50342 1 66 29610 U . 50342 1 67 29611 G . 50342 1 68 29612 U . 50342 1 69 29613 G . 50342 1 70 29614 C . 50342 1 71 29615 C . 50342 1 72 1 C . 50342 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 50342 1 . G 2 2 50342 1 . G 3 3 50342 1 . C 4 4 50342 1 . A 5 5 50342 1 . C 6 6 50342 1 . A 7 7 50342 1 . A 8 8 50342 1 . G 9 9 50342 1 . G 10 10 50342 1 . C 11 11 50342 1 . A 12 12 50342 1 . G 13 13 50342 1 . A 14 14 50342 1 . U 15 15 50342 1 . G 16 16 50342 1 . G 17 17 50342 1 . G 18 18 50342 1 . C 19 19 50342 1 . U 20 20 50342 1 . A 21 21 50342 1 . U 22 22 50342 1 . A 23 23 50342 1 . U 24 24 50342 1 . A 25 25 50342 1 . A 26 26 50342 1 . A 27 27 50342 1 . C 28 28 50342 1 . G 29 29 50342 1 . U 30 30 50342 1 . U 31 31 50342 1 . U 32 32 50342 1 . U 33 33 50342 1 . C 34 34 50342 1 . G 35 35 50342 1 . C 36 36 50342 1 . U 37 37 50342 1 . U 38 38 50342 1 . U 39 39 50342 1 . U 40 40 50342 1 . C 41 41 50342 1 . C 42 42 50342 1 . G 43 43 50342 1 . U 44 44 50342 1 . U 45 45 50342 1 . U 46 46 50342 1 . A 47 47 50342 1 . C 48 48 50342 1 . G 49 49 50342 1 . A 50 50 50342 1 . U 51 51 50342 1 . A 52 52 50342 1 . U 53 53 50342 1 . A 54 54 50342 1 . U 55 55 50342 1 . A 56 56 50342 1 . G 57 57 50342 1 . U 58 58 50342 1 . C 59 59 50342 1 . U 60 60 50342 1 . A 61 61 50342 1 . C 62 62 50342 1 . U 63 63 50342 1 . C 64 64 50342 1 . U 65 65 50342 1 . U 66 66 50342 1 . G 67 67 50342 1 . U 68 68 50342 1 . G 69 69 50342 1 . C 70 70 50342 1 . C 71 71 50342 1 . C 72 72 50342 1 stop_ save_ #################### # Natural source # #################### save_natural_source_1 _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source_1 _Entity_natural_src_list.Entry_ID 50342 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 2697049 organism . 'Severe acute respiratory syndrome coronavirus 2' SARS-CoV-2 . . Viruses . Betacoronavirus HCoV-SARS SARS-CoV-2 . . . . . . . . . . . . 50342 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source_1 _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source_1 _Entity_experimental_src_list.Entry_ID 50342 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'reverse transcriptase' . . . . . . . . . . . . . . . . 50342 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 50342 _Sample.ID 1 _Sample.Name 3_SL1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '5% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 3_SL1 'natural abundance' . . 1 $entity_1 . . 766 . . uM . . . . 50342 1 2 'potassium phosphate' 'natural abundance' . . . . . . 25 . . mM . . . . 50342 1 3 KCl 'natural abundance' . . . . . . 50 . . mM . . . . 50342 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 50342 _Sample.ID 2 _Sample.Name 3_SL1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '5% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 3_SL1 [U-15N] . . 1 $entity_1 . . 600 . . uM . . . . 50342 2 2 'potassium phosphate' 'natural abundance' . . . . . . 25 . . mM . . . . 50342 2 3 KCl 'natural abundance' . . . . . . 50 . . mM . . . . 50342 2 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 50342 _Sample_condition_list.ID 1 _Sample_condition_list.Name '3_SL1 298K' _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 75 . mM 50342 1 pH 6.2 . pH 50342 1 pressure 1 . atm 50342 1 temperature 298 . K 50342 1 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 50342 _Sample_condition_list.ID 2 _Sample_condition_list.Name '3_SL1 298K' _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 75 . mM 50342 2 pH 6.2 . pH 50342 2 pressure 1 . atm 50342 2 temperature 298 . K 50342 2 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 50342 _Software.ID 1 _Software.Type . _Software.Name LOGS _Software.Version 2.2 _Software.DOI . _Software.Details . loop_ _Task.Software_module _Task.Task _Task.Entry_ID _Task.Software_ID . collection 50342 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 50342 _Software.ID 2 _Software.Type . _Software.Name SPARKY _Software.Version 3.114 _Software.DOI . _Software.Details . loop_ _Task.Software_module _Task.Task _Task.Entry_ID _Task.Software_ID . 'chemical shift assignment' 50342 2 . 'peak picking' 50342 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 50342 _Software.ID 3 _Software.Type . _Software.Name TOPSPIN _Software.Version 2.1 _Software.DOI . _Software.Details . loop_ _Task.Software_module _Task.Task _Task.Entry_ID _Task.Software_ID . collection 50342 3 stop_ save_ save_software_4 _Software.Sf_category software _Software.Sf_framecode software_4 _Software.Entry_ID 50342 _Software.ID 4 _Software.Type . _Software.Name TOPSPIN _Software.Version 3.6.2 _Software.DOI . _Software.Details . loop_ _Task.Software_module _Task.Task _Task.Entry_ID _Task.Software_ID . collection 50342 4 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 50342 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name 'Bruker Avance III 800 MHz' _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'Bruker Avance III 800 MHz' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 800 save_ save_NMR_spectrometer_2 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_2 _NMR_spectrometer.Entry_ID 50342 _NMR_spectrometer.ID 2 _NMR_spectrometer.Name 'Bruker Avance I 600 MHz' _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'Bruker Avance I 600 MHz' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 50342 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 NOESY no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . 50342 1 2 NOESY[15N]-Imino no . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . 50342 1 3 TROSY[15N] no . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . 50342 1 4 HNN-COSY[15N] no . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . 50342 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 50342 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name 'Chemical shift reference DSS' _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 DSS 'methyl protons' . . . . ppm 0.00 na indirect 0.251449530 . . . . . 50342 1 H 1 DSS 'methyl protons' . . . . ppm 0.00 internal direct 1.000000000 . . . . . 50342 1 N 15 DSS 'methyl protons' . . . . ppm 0.00 na indirect 0.101329118 . . . . . 50342 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 50342 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name 'Chemical shift list' _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 NOESY . . . 50342 1 2 NOESY[15N]-Imino . . . 50342 1 3 TROSY[15N] . . . 50342 1 4 HNN-COSY[15N] . . . 50342 1 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 2 $software_2 . . 50342 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 G H1 H 1 12.8416 . . 1 . . . . . -2 G H1 . 50342 1 2 . 1 . 1 1 1 G N1 N 15 147.734 . . 1 . . . . . -2 G N1 . 50342 1 3 . 1 . 1 2 2 G H1 H 1 13.1594 . . 1 . . . . . -1 G H1 . 50342 1 4 . 1 . 1 2 2 G N1 N 15 148.768 . . 1 . . . . . -1 G N1 . 50342 1 5 . 1 . 1 4 4 C H41 H 1 8.479 . . 1 . . . . . 29548 C H41 . 50342 1 6 . 1 . 1 4 4 C H42 H 1 6.847 . . 1 . . . . . 29548 C H42 . 50342 1 7 . 1 . 1 4 4 C N3 N 15 196.497 . . 1 . . . . . 29548 C N3 . 50342 1 8 . 1 . 1 4 4 C N4 N 15 98.189 . . 1 . . . . . 29548 C N4 . 50342 1 9 . 1 . 1 5 5 A H2 H 1 7.2455 . . 1 . . . . . 29549 A H2 . 50342 1 10 . 1 . 1 5 5 A N1 N 15 221.858 . . 1 . . . . . 29549 A N1 . 50342 1 11 . 1 . 1 5 5 A N3 N 15 212.677 . . 1 . . . . . 29549 A N3 . 50342 1 12 . 1 . 1 6 6 C H41 H 1 8.172 . . 1 . . . . . 29550 C H41 . 50342 1 13 . 1 . 1 6 6 C H42 H 1 6.894 . . 1 . . . . . 29550 C H42 . 50342 1 14 . 1 . 1 6 6 C N3 N 15 196.531 . . 1 . . . . . 29550 C N3 . 50342 1 15 . 1 . 1 6 6 C N4 N 15 97.876 . . 1 . . . . . 29550 C N4 . 50342 1 16 . 1 . 1 7 7 A H2 H 1 6.59587 . . 1 . . . . . 29551 A H2 . 50342 1 17 . 1 . 1 7 7 A N1 N 15 219.565 . . 1 . . . . . 29551 A N1 . 50342 1 18 . 1 . 1 7 7 A N3 N 15 212.51 . . 1 . . . . . 29551 A N3 . 50342 1 19 . 1 . 1 8 8 A H1' H 1 5.866 . . 1 . . . . . 29552 A H1' . 50342 1 20 . 1 . 1 8 8 A H2 H 1 7.406 . . 1 . . . . . 29552 A H2 . 50342 1 21 . 1 . 1 8 8 A N1 N 15 219.84 . . 1 . . . . . 29552 A N1 . 50342 1 22 . 1 . 1 8 8 A N3 N 15 211.507 . . 1 . . . . . 29552 A N3 . 50342 1 23 . 1 . 1 16 16 G H1 H 1 10.1693 . . 1 . . . . . 29560 G H1 . 50342 1 24 . 1 . 1 16 16 G N1 N 15 142.647 . . 1 . . . . . 29560 G N1 . 50342 1 25 . 1 . 1 17 17 G H1 H 1 12.7351 . . 1 . . . . . 29561 G H1 . 50342 1 26 . 1 . 1 17 17 G N1 N 15 147.566 . . 1 . . . . . 29561 G N1 . 50342 1 27 . 1 . 1 18 18 G H1 H 1 11.3631 . . 1 . . . . . 29562 G H1 . 50342 1 28 . 1 . 1 18 18 G H21 H 1 6.3455 . . 2 . . . . . 29562 G H21 . 50342 1 29 . 1 . 1 18 18 G H22 H 1 6.3455 . . 2 . . . . . 29562 G H22 . 50342 1 30 . 1 . 1 18 18 G N1 N 15 145.312 . . 1 . . . . . 29562 G N1 . 50342 1 31 . 1 . 1 18 18 G N2 N 15 74.047 . . 1 . . . . . 29562 G N2 . 50342 1 32 . 1 . 1 19 19 C H41 H 1 8.272 . . 1 . . . . . 29563 C H41 . 50342 1 33 . 1 . 1 19 19 C H42 H 1 6.946 . . 1 . . . . . 29563 C H42 . 50342 1 34 . 1 . 1 19 19 C N3 N 15 196.595 . . 1 . . . . . 29563 C N3 . 50342 1 35 . 1 . 1 19 19 C N4 N 15 98.958 . . 1 . . . . . 29563 C N4 . 50342 1 36 . 1 . 1 20 20 U H3 H 1 13.18 . . 1 . . . . . 29564 U H3 . 50342 1 37 . 1 . 1 20 20 U N3 N 15 161.469 . . 1 . . . . . 29564 U N3 . 50342 1 38 . 1 . 1 21 21 A H2 H 1 6.909 . . 5 . . . . . 29565 A H2 . 50342 1 39 . 1 . 1 21 21 A N1 N 15 221.822 . . 5 . . . . . 29565 A N1 . 50342 1 40 . 1 . 1 22 22 U H3 H 1 13.0844 . . 5 . . . . . 29566 U H3 . 50342 1 41 . 1 . 1 22 22 U N3 N 15 161.478 . . 5 . . . . . 29566 U N3 . 50342 1 42 . 1 . 1 23 23 A H2 H 1 6.909 . . 5 . . . . . 29567 A H2 . 50342 1 43 . 1 . 1 23 23 A N1 N 15 221.822 . . 5 . . . . . 29567 A N1 . 50342 1 44 . 1 . 1 24 24 U H3 H 1 13.0844 . . 5 . . . . . 29568 U H3 . 50342 1 45 . 1 . 1 24 24 U N3 N 15 161.478 . . 5 . . . . . 29568 U N3 . 50342 1 46 . 1 . 1 29 29 G H1 H 1 12.8651 . . 1 . . . . . 29573 G H1 . 50342 1 47 . 1 . 1 29 29 G N1 N 15 147.463 . . 1 . . . . . 29573 G N1 . 50342 1 48 . 1 . 1 30 30 U H3 H 1 14.4293 . . 1 . . . . . 29574 U H3 . 50342 1 49 . 1 . 1 30 30 U N1 N 15 145.945 . . 1 . . . . . 29574 U N1 . 50342 1 50 . 1 . 1 30 30 U N3 N 15 162.94 . . 1 . . . . . 29574 U N3 . 50342 1 51 . 1 . 1 31 31 U H3 H 1 11.1036 . . 5 . . . . . 29575 U H3 . 50342 1 52 . 1 . 1 31 31 U N1 N 15 145.588 . . 5 . . . . . 29575 U N1 . 50342 1 53 . 1 . 1 31 31 U N3 N 15 157.589 . . 5 . . . . . 29575 U N3 . 50342 1 54 . 1 . 1 32 32 U H3 H 1 11.2699 . . 5 . . . . . 29576 U H3 . 50342 1 55 . 1 . 1 32 32 U N1 N 15 146.588 . . 5 . . . . . 29576 U N1 . 50342 1 56 . 1 . 1 32 32 U N3 N 15 157.485 . . 5 . . . . . 29576 U N3 . 50342 1 57 . 1 . 1 33 33 U H3 H 1 10.7026 . . 5 . . . . . 29577 U H3 . 50342 1 58 . 1 . 1 33 33 U N1 N 15 148.395 . . 5 . . . . . 29577 U N1 . 50342 1 59 . 1 . 1 33 33 U N3 N 15 157.121 . . 5 . . . . . 29577 U N3 . 50342 1 60 . 1 . 1 34 34 C H41 H 1 8.38867 . . 1 . . . . . 29578 C H41 . 50342 1 61 . 1 . 1 34 34 C H42 H 1 7.216 . . 1 . . . . . 29578 C H42 . 50342 1 62 . 1 . 1 34 34 C N3 N 15 195.266 . . 1 . . . . . 29578 C N3 . 50342 1 63 . 1 . 1 34 34 C N4 N 15 99.5717 . . 1 . . . . . 29578 C N4 . 50342 1 64 . 1 . 1 43 43 G H1 H 1 12.9419 . . 1 . . . . . 29587 G H1 . 50342 1 65 . 1 . 1 43 43 G N1 N 15 147.548 . . 1 . . . . . 29587 G N1 . 50342 1 66 . 1 . 1 44 44 U H3 H 1 10.7026 . . 5 . . . . . 29588 U H3 . 50342 1 67 . 1 . 1 44 44 U N1 N 15 148.395 . . 5 . . . . . 29588 U N1 . 50342 1 68 . 1 . 1 44 44 U N3 N 15 157.121 . . 5 . . . . . 29588 U N3 . 50342 1 69 . 1 . 1 45 45 U H3 H 1 11.2699 . . 5 . . . . . 29589 U H3 . 50342 1 70 . 1 . 1 45 45 U N1 N 15 146.588 . . 5 . . . . . 29589 U N1 . 50342 1 71 . 1 . 1 45 45 U N3 N 15 157.485 . . 5 . . . . . 29589 U N3 . 50342 1 72 . 1 . 1 46 46 U H3 H 1 11.1036 . . 5 . . . . . 29590 U H3 . 50342 1 73 . 1 . 1 46 46 U N1 N 15 145.588 . . 5 . . . . . 29590 U N1 . 50342 1 74 . 1 . 1 46 46 U N3 N 15 157.589 . . 5 . . . . . 29590 U N3 . 50342 1 75 . 1 . 1 47 47 A H2 H 1 7.954 . . 1 . . . . . 29591 A H2 . 50342 1 76 . 1 . 1 47 47 A N1 N 15 221.83 . . 1 . . . . . 29591 A N1 . 50342 1 77 . 1 . 1 48 48 C H41 H 1 8.2865 . . 1 . . . . . 29592 C H41 . 50342 1 78 . 1 . 1 48 48 C H42 H 1 6.7265 . . 1 . . . . . 29592 C H42 . 50342 1 79 . 1 . 1 48 48 C N3 N 15 196.334 . . 1 . . . . . 29592 C N3 . 50342 1 80 . 1 . 1 48 48 C N4 N 15 97.8075 . . 1 . . . . . 29592 C N4 . 50342 1 81 . 1 . 1 52 52 A H2 H 1 6.909 . . 5 . . . . . 29596 A H2 . 50342 1 82 . 1 . 1 52 52 A N1 N 15 221.822 . . 5 . . . . . 29596 A N1 . 50342 1 83 . 1 . 1 53 53 U H3 H 1 13.0844 . . 5 . . . . . 29597 U H3 . 50342 1 84 . 1 . 1 53 53 U N3 N 15 161.478 . . 5 . . . . . 29597 U N3 . 50342 1 85 . 1 . 1 54 54 A H2 H 1 6.909 . . 5 . . . . . 29598 A H2 . 50342 1 86 . 1 . 1 54 54 A N1 N 15 221.822 . . 5 . . . . . 29598 A N1 . 50342 1 87 . 1 . 1 55 55 U H3 H 1 13.0844 . . 5 . . . . . 29599 U H3 . 50342 1 88 . 1 . 1 55 55 U N3 N 15 161.478 . . 5 . . . . . 29599 U N3 . 50342 1 89 . 1 . 1 56 56 A H2 H 1 6.69667 . . 1 . . . . . 29600 A H2 . 50342 1 90 . 1 . 1 56 56 A N1 N 15 220.067 . . 1 . . . . . 29600 A N1 . 50342 1 91 . 1 . 1 56 56 A N3 N 15 212.022 . . 1 . . . . . 29600 A N3 . 50342 1 92 . 1 . 1 57 57 G H1 H 1 13.4047 . . 1 . . . . . 29601 G H1 . 50342 1 93 . 1 . 1 57 57 G H21 H 1 6.185 . . 2 . . . . . 29601 G H21 . 50342 1 94 . 1 . 1 57 57 G H22 H 1 6.185 . . 2 . . . . . 29601 G H22 . 50342 1 95 . 1 . 1 57 57 G N1 N 15 148.063 . . 1 . . . . . 29601 G N1 . 50342 1 96 . 1 . 1 57 57 G N2 N 15 72.776 . . 1 . . . . . 29601 G N2 . 50342 1 97 . 1 . 1 58 58 U H3 H 1 12.1764 . . 1 . . . . . 29602 U H3 . 50342 1 98 . 1 . 1 58 58 U N3 N 15 158.758 . . 1 . . . . . 29602 U N3 . 50342 1 99 . 1 . 1 59 59 C H41 H 1 8.333 . . 1 . . . . . 29603 C H41 . 50342 1 100 . 1 . 1 59 59 C H42 H 1 7.286 . . 1 . . . . . 29603 C H42 . 50342 1 101 . 1 . 1 59 59 C N3 N 15 196.295 . . 1 . . . . . 29603 C N3 . 50342 1 102 . 1 . 1 59 59 C N4 N 15 98.719 . . 1 . . . . . 29603 C N4 . 50342 1 103 . 1 . 1 60 60 U H3 H 1 11.7137 . . 1 . . . . . 29604 U H3 . 50342 1 104 . 1 . 1 60 60 U N3 N 15 157.572 . . 1 . . . . . 29604 U N3 . 50342 1 105 . 1 . 1 65 65 U H3 H 1 13.861 . . 1 . . . . . 29609 U H3 . 50342 1 106 . 1 . 1 65 65 U N3 N 15 162.291 . . 1 . . . . . 29609 U N3 . 50342 1 107 . 1 . 1 66 66 U H1' H 1 5.589 . . 1 . . . . . 29610 U H1' . 50342 1 108 . 1 . 1 66 66 U H3 H 1 13.1933 . . 1 . . . . . 29610 U H3 . 50342 1 109 . 1 . 1 66 66 U H5 H 1 5.033 . . 1 . . . . . 29610 U H5 . 50342 1 110 . 1 . 1 66 66 U H6 H 1 7.71033 . . 1 . . . . . 29610 U H6 . 50342 1 111 . 1 . 1 66 66 U N3 N 15 162.464 . . 1 . . . . . 29610 U N3 . 50342 1 112 . 1 . 1 67 67 G H1 H 1 12.4461 . . 1 . . . . . 29611 G H1 . 50342 1 113 . 1 . 1 67 67 G H1' H 1 5.711 . . 5 . . . . . 29611 G H1' . 50342 1 114 . 1 . 1 67 67 G N1 N 15 147.285 . . 1 . . . . . 29611 G N1 . 50342 1 115 . 1 . 1 68 68 U H3 H 1 13.5644 . . 1 . . . . . 29612 U H3 . 50342 1 116 . 1 . 1 68 68 U N1 N 15 145.164 . . 1 . . . . . 29612 U N1 . 50342 1 117 . 1 . 1 68 68 U N3 N 15 162.08 . . 1 . . . . . 29612 U N3 . 50342 1 118 . 1 . 1 69 69 G H1 H 1 12.5148 . . 1 . . . . . 29613 G H1 . 50342 1 119 . 1 . 1 69 69 G N1 N 15 147.923 . . 1 . . . . . 29613 G N1 . 50342 1 120 . 1 . 1 70 70 C H41 H 1 8.517 . . 1 . . . . . 29614 C H41 . 50342 1 121 . 1 . 1 70 70 C N3 N 15 197.326 . . 1 . . . . . 29614 C N3 . 50342 1 122 . 1 . 1 70 70 C N4 N 15 99.069 . . 1 . . . . . 29614 C N4 . 50342 1 123 . 1 . 1 72 72 C H41 H 1 8.483 . . 1 . . . . . 1 C H41 . 50342 1 124 . 1 . 1 72 72 C H42 H 1 6.878 . . 1 . . . . . 1 C H42 . 50342 1 125 . 1 . 1 72 72 C N3 N 15 197.004 . . 1 . . . . . 1 C N3 . 50342 1 stop_ loop_ _Ambiguous_atom_chem_shift.Ambiguous_shift_set_ID _Ambiguous_atom_chem_shift.Atom_chem_shift_ID _Ambiguous_atom_chem_shift.Entry_ID _Ambiguous_atom_chem_shift.Assigned_chem_shift_list_ID 1 38 50342 1 1 42 50342 1 1 81 50342 1 1 85 50342 1 2 39 50342 1 2 43 50342 1 2 82 50342 1 2 86 50342 1 3 40 50342 1 3 44 50342 1 3 51 50342 1 3 54 50342 1 3 57 50342 1 3 66 50342 1 3 69 50342 1 3 72 50342 1 3 83 50342 1 3 87 50342 1 4 41 50342 1 4 45 50342 1 4 53 50342 1 4 56 50342 1 4 59 50342 1 4 68 50342 1 4 71 50342 1 4 74 50342 1 4 84 50342 1 4 88 50342 1 5 52 50342 1 5 55 50342 1 5 58 50342 1 5 67 50342 1 5 70 50342 1 5 73 50342 1 6 113 50342 1 stop_ save_ save_assigned_chemical_shifts_2 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_2 _Assigned_chem_shift_list.Entry_ID 50342 _Assigned_chem_shift_list.ID 2 _Assigned_chem_shift_list.Name 'Chemical shift list' _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 NOESY . . . 50342 2 2 NOESY[15N]-Imino . . . 50342 2 3 TROSY[15N] . . . 50342 2 4 HNN-COSY[15N] . . . 50342 2 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 2 $software_2 . . 50342 2 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 8 8 A H1' H 1 5.711 . . 5 . . . . . 8 A H1' . 50342 2 2 . 1 . 1 31 31 U H3 H 1 10.0514 . . 5 . . . . . 31 U H3 . 50342 2 3 . 1 . 1 31 31 U N1 N 15 147.4 . . 5 . . . . . 31 U N1 . 50342 2 4 . 1 . 1 31 31 U N3 N 15 155.809 . . 5 . . . . . 31 U N3 . 50342 2 5 . 1 . 1 32 32 U H3 H 1 11.376 . . 5 . . . . . 32 U H3 . 50342 2 6 . 1 . 1 32 32 U N1 N 15 147.356 . . 5 . . . . . 32 U N1 . 50342 2 7 . 1 . 1 32 32 U N3 N 15 157.484 . . 5 . . . . . 32 U N3 . 50342 2 8 . 1 . 1 33 33 U H3 H 1 11.3444 . . 5 . . . . . 33 U H3 . 50342 2 9 . 1 . 1 33 33 U N3 N 15 158.3 . . 5 . . . . . 33 U N3 . 50342 2 10 . 1 . 1 44 44 U H3 H 1 11.3444 . . 5 . . . . . 44 U H3 . 50342 2 11 . 1 . 1 44 44 U N3 N 15 158.3 . . 5 . . . . . 44 U N3 . 50342 2 12 . 1 . 1 45 45 U H3 H 1 11.376 . . 5 . . . . . 45 U H3 . 50342 2 13 . 1 . 1 45 45 U N1 N 15 147.356 . . 5 . . . . . 45 U N1 . 50342 2 14 . 1 . 1 45 45 U N3 N 15 157.484 . . 5 . . . . . 45 U N3 . 50342 2 15 . 1 . 1 46 46 U H3 H 1 10.0514 . . 5 . . . . . 46 U H3 . 50342 2 16 . 1 . 1 46 46 U N1 N 15 147.4 . . 5 . . . . . 46 U N1 . 50342 2 17 . 1 . 1 46 46 U N3 N 15 155.809 . . 5 . . . . . 46 U N3 . 50342 2 18 . 1 . 1 67 67 G H1' H 1 5.711 . . 1 . . . . . 67 G H1' . 50342 2 stop_ loop_ _Ambiguous_atom_chem_shift.Ambiguous_shift_set_ID _Ambiguous_atom_chem_shift.Atom_chem_shift_ID _Ambiguous_atom_chem_shift.Entry_ID _Ambiguous_atom_chem_shift.Assigned_chem_shift_list_ID 1 1 50342 2 2 2 50342 2 2 5 50342 2 2 8 50342 2 2 10 50342 2 2 12 50342 2 2 15 50342 2 3 3 50342 2 3 6 50342 2 3 13 50342 2 3 16 50342 2 4 4 50342 2 4 7 50342 2 4 9 50342 2 4 11 50342 2 4 14 50342 2 4 17 50342 2 stop_ save_ save_assigned_chemical_shifts_3 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_3 _Assigned_chem_shift_list.Entry_ID 50342 _Assigned_chem_shift_list.ID 3 _Assigned_chem_shift_list.Name 'Chemical shift list' _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 NOESY . . . 50342 3 2 NOESY[15N]-Imino . . . 50342 3 3 TROSY[15N] . . . 50342 3 4 HNN-COSY[15N] . . . 50342 3 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 2 $software_2 . . 50342 3 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 8 8 A H1' H 1 5.866 . . 5 . . . . . 29552 A H1' . 50342 3 2 . 1 . 1 67 67 G H1' H 1 5.866 . . 5 . . . . . 29611 G H1' . 50342 3 stop_ loop_ _Ambiguous_atom_chem_shift.Ambiguous_shift_set_ID _Ambiguous_atom_chem_shift.Atom_chem_shift_ID _Ambiguous_atom_chem_shift.Entry_ID _Ambiguous_atom_chem_shift.Assigned_chem_shift_list_ID 1 1 50342 3 2 2 50342 3 stop_ save_