data_50342 ####################### # Entry information # ####################### save_entry_information _Saveframe_category entry_information _Entry_title ; Assignment of base 1H and 15N chemical shifts for 3_SL1 ; _BMRB_accession_number 50342 _BMRB_flat_file_name bmr50342.str _Entry_type original _Submission_date 2020-06-23 _Accession_date 2020-06-23 _Entry_origination author _NMR_STAR_version 2.1.1 _Experimental_method NMR _Details . loop_ _Author_ordinal _Author_family_name _Author_given_name _Author_middle_initials _Author_family_title 1 Schwalbe Harald . . 2 Richter Christian . . stop_ loop_ _Saveframe_category_type _Saveframe_category_type_count assigned_chemical_shifts 3 stop_ loop_ _Data_type _Data_type_count "1H chemical shifts" 70 "15N chemical shifts" 75 stop_ loop_ _Revision_date _Revision_keyword _Revision_author _Revision_detail 2020-12-18 update BMRB 'update entry citation' 2020-07-10 original author 'original release' stop_ loop_ _Related_BMRB_accession_number _Relationship 50339 'chemical shifts of the 5_SL5B+C' 50340 'chemical shifts of the 5_SL5stem' 50341 'chemical shifts of the 3_s2m' 50343 'chemical shifts of the 2_SL3' 50344 'chemical shifts of the 5_SL2+3' 50346 'chemical shifts of the 5_SL5a' 50347 'chemical shifts of the 5_SL4' 50348 'chemical shifts of the PK (Pseudoknot)' 50349 'chemical shifts of the 5_SL1' 50350 'chemical shifts of the 3_SL3base' 50351 'chemical shifts of the 5_SL6' 50352 'chemical shifts of the 5_SL8' stop_ _Original_release_date 2020-06-23 save_ ############################# # Citation for this entry # ############################# save_citations_1 _Saveframe_category entry_citation _Citation_full . _Citation_title ; Secondary structure determination of conserved SARS-CoV-2 RNA elements by NMR spectroscopy ; _Citation_status published _Citation_type journal _CAS_abstract_code . _MEDLINE_UI_code . _PubMed_ID 33167030 loop_ _Author_ordinal _Author_family_name _Author_given_name _Author_middle_initials _Author_family_title 1 Wacker Anna . . 2 Weigand Julia E. . 3 Akabayov Sabine R. . 4 Altincekic Nadide . . 5 'Kaur Bains' Jasleen . . 6 Banijamali Elnaz . . 7 Binas Oliver . . 8 Castillo-Martinez Jesus . . 9 Cetiner Erhan . . 10 Ceylan Betul . . 11 Chiu Liang-Yuan . . 12 Davila-Calderon Jesse . . 13 'De Jesus' Vanessa . . 14 Dhamotharan Karthikeyan . . 15 Duchardt-Ferner Elke . . 16 Ferner Jan . . 17 Frydman Lucio . . 18 Furtig Boris . . 19 Gallego Jose . . 20 Grun 'J. Tassilo' . . 21 Hacker Carolin . . 22 Haddad Christina . . 23 Hahnke Martin . . 24 Hengesbach Martin . . 25 Hiller Fabian . . 26 Hohmann Katharina F. . 27 Hymon Daniel . . 28 Jonker Henry . . 29 Keller Heiko . . 30 Knezic Bozana . . 31 Landgraf Tom . . 32 Lohr Frank . . 33 Luo Luke . . 34 Mertinkus Klara R. . 35 Muhs Christina . . 36 Novakovic Mihajlo . . 37 Oxenfarth Andreas . . 38 Palomino-Schatzlein Martina . . 39 Petzold Katja . . 40 Peter Stephen A. . 41 Pyper Dennis J. . 42 Qureshi Nusrat S. . 43 Riad Magdalena . . 44 Richter Christian . . 45 Saxena Krishna . . 46 Schamber Tatjana . . 47 Scherf Tali . . 48 Schlagnitweit Judith . . 49 Schlundt Andreas . . 50 Schnieders Robbin . . 51 Schwalbe Harald . . 52 Simba-Lahuasi Alvaro . . 53 Sreeramulu Sridhar . . 54 Stirnal Elke . . 55 Sudakov Alexey . . 56 Tants Jan-Niklas . . 57 Tolbert Blanton S. . 58 Vogele Jenny . . 59 Weiss Lena . . 60 Wirmer-Bartoschek Julia . . 61 'Wirtz Martin' Maria A. . 62 Wohnert Jens . . 63 Zetzsche Heidi . . stop_ _Journal_abbreviation 'Nucleic Acids Res.' _Journal_name_full 'Nucleic acids research' _Journal_volume 48 _Journal_issue 22 _Journal_ISSN 1362-4962 _Journal_CSD . _Book_chapter_title . _Book_volume . _Book_series . _Book_ISBN . _Conference_state_province . _Conference_abstract_number . _Page_first 12415 _Page_last 12435 _Year 2020 _Details . save_ ################################## # Molecular system description # ################################## save_assembly_1 _Saveframe_category molecular_system _Mol_system_name 3_SL1 _Enzyme_commission_number . loop_ _Mol_system_component_name _Mol_label 3_SL1 $entity_1 stop_ _System_molecular_weight . _System_physical_state native _System_oligomer_state ? _System_paramagnetic no _System_thiol_state . _Database_query_date . _Details . save_ ######################## # Monomeric polymers # ######################## save_entity_1 _Saveframe_category monomeric_polymer _Mol_type polymer _Mol_polymer_class RNA _Name_common entity_1 _Molecular_mass . _Mol_thiol_state 'not present' _Details . ############################## # Polymer residue sequence # ############################## _Residue_count 72 _Mol_residue_sequence ; GGGCACAAGGCAGAUGGGCU AUAUAAACGUUUUCGCUUUU CCGUUUACGAUAUAUAGUCU ACUCUUGUGCCC ; loop_ _Residue_seq_code _Residue_author_seq_code _Residue_label 1 -2 G 2 -1 G 3 29547 G 4 29548 C 5 29549 A 6 29550 C 7 29551 A 8 29552 A 9 29553 G 10 29554 G 11 29555 C 12 29556 A 13 29557 G 14 29558 A 15 29559 U 16 29560 G 17 29561 G 18 29562 G 19 29563 C 20 29564 U 21 29565 A 22 29566 U 23 29567 A 24 29568 U 25 29569 A 26 29570 A 27 29571 A 28 29572 C 29 29573 G 30 29574 U 31 29575 U 32 29576 U 33 29577 U 34 29578 C 35 29579 G 36 29580 C 37 29581 U 38 29582 U 39 29583 U 40 29584 U 41 29585 C 42 29586 C 43 29587 G 44 29588 U 45 29589 U 46 29590 U 47 29591 A 48 29592 C 49 29593 G 50 29594 A 51 29595 U 52 29596 A 53 29597 U 54 29598 A 55 29599 U 56 29600 A 57 29601 G 58 29602 U 59 29603 C 60 29604 U 61 29605 A 62 29606 C 63 29607 U 64 29608 C 65 29609 U 66 29610 U 67 29611 G 68 29612 U 69 29613 G 70 29614 C 71 29615 C 72 1 C stop_ _Sequence_homology_query_date . _Sequence_homology_query_revised_last_date . save_ #################### # Natural source # #################### save_natural_source_1 _Saveframe_category natural_source loop_ _Mol_label _Organism_name_common _NCBI_taxonomy_ID _Superkingdom _Kingdom _Genus _Species _Strain $entity_1 SARS-CoV-2 2697049 Viruses . Betacoronavirus HCoV-SARS SARS-CoV-2 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source_1 _Saveframe_category experimental_source loop_ _Mol_label _Production_method _Host_organism_name_common _Genus _Species _Strain _Vector_name $entity_1 'reverse transcriptase' . . . . . stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Saveframe_category sample _Sample_type solution _Details . loop_ _Mol_label _Concentration_value _Concentration_value_units _Isotopic_labeling $entity_1 766 uM 'natural abundance' 'potassium phosphate' 25 mM 'natural abundance' KCl 50 mM 'natural abundance' stop_ save_ save_sample_2 _Saveframe_category sample _Sample_type solution _Details . loop_ _Mol_label _Concentration_value _Concentration_value_units _Isotopic_labeling $entity_1 600 uM [U-15N] 'potassium phosphate' 25 mM 'natural abundance' KCl 50 mM 'natural abundance' stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Saveframe_category software _Name LOGS _Version 2.2 loop_ _Task collection stop_ _Details . save_ save_software_2 _Saveframe_category software _Name SPARKY _Version 3.114 loop_ _Task 'chemical shift assignment' 'peak picking' stop_ _Details . save_ save_software_3 _Saveframe_category software _Name TOPSPIN _Version 2.1 loop_ _Task collection stop_ _Details . save_ save_software_4 _Saveframe_category software _Name TOPSPIN _Version 3.6.2 loop_ _Task collection stop_ _Details . save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _Saveframe_category NMR_spectrometer _Manufacturer Bruker _Model 'Bruker Avance III 800 MHz' _Field_strength 800 _Details . save_ save_NMR_spectrometer_2 _Saveframe_category NMR_spectrometer _Manufacturer Bruker _Model 'Bruker Avance I 600 MHz' _Field_strength 600 _Details . save_ ############################# # NMR applied experiments # ############################# save_NOESY_1 _Saveframe_category NMR_applied_experiment _Experiment_name NOESY _Sample_label $sample_1 save_ save_NOESY[15N]-Imino_2 _Saveframe_category NMR_applied_experiment _Experiment_name NOESY[15N]-Imino _Sample_label $sample_2 save_ save_TROSY[15N]_3 _Saveframe_category NMR_applied_experiment _Experiment_name TROSY[15N] _Sample_label $sample_2 save_ save_HNN-COSY[15N]_4 _Saveframe_category NMR_applied_experiment _Experiment_name HNN-COSY[15N] _Sample_label $sample_2 save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Saveframe_category sample_conditions _Details . loop_ _Variable_type _Variable_value _Variable_value_error _Variable_value_units 'ionic strength' 75 . mM pH 6.2 . pH pressure 1 . atm temperature 298 . K stop_ save_ save_sample_conditions_2 _Saveframe_category sample_conditions _Details . loop_ _Variable_type _Variable_value _Variable_value_error _Variable_value_units 'ionic strength' 75 . mM pH 6.2 . pH pressure 1 . atm temperature 298 . K stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Saveframe_category chemical_shift_reference _Details . loop_ _Mol_common_name _Atom_type _Atom_isotope_number _Atom_group _Chem_shift_units _Chem_shift_value _Reference_method _Reference_type _External_reference_sample_geometry _External_reference_location _External_reference_axis _Indirect_shift_ratio DSS C 13 'methyl protons' ppm 0.00 na indirect . . . 0.251449530 DSS H 1 'methyl protons' ppm 0.00 internal direct . . . 1.000000000 DSS N 15 'methyl protons' ppm 0.00 na indirect . . . 0.101329118 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Saveframe_category assigned_chemical_shifts _Details . loop_ _Software_label $software_2 stop_ loop_ _Experiment_label NOESY NOESY[15N]-Imino TROSY[15N] HNN-COSY[15N] stop_ loop_ _Sample_label $sample_1 $sample_2 stop_ _Sample_conditions_label $sample_conditions_1 _Chem_shift_reference_set_label $chem_shift_reference_1 _Mol_system_component_name 3_SL1 _Text_data_format . _Text_data . loop_ _Atom_shift_assign_ID _Residue_author_seq_code _Residue_seq_code _Residue_label _Atom_name _Atom_type _Chem_shift_value _Chem_shift_value_error _Chem_shift_ambiguity_code 1 -2 1 G H1 H 12.8416 . 1 2 -2 1 G N1 N 147.734 . 1 3 -1 2 G H1 H 13.1594 . 1 4 -1 2 G N1 N 148.768 . 1 5 29548 4 C H41 H 8.479 . 1 6 29548 4 C H42 H 6.847 . 1 7 29548 4 C N3 N 196.497 . 1 8 29548 4 C N4 N 98.189 . 1 9 29549 5 A H2 H 7.2455 . 1 10 29549 5 A N1 N 221.858 . 1 11 29549 5 A N3 N 212.677 . 1 12 29550 6 C H41 H 8.172 . 1 13 29550 6 C H42 H 6.894 . 1 14 29550 6 C N3 N 196.531 . 1 15 29550 6 C N4 N 97.876 . 1 16 29551 7 A H2 H 6.59587 . 1 17 29551 7 A N1 N 219.565 . 1 18 29551 7 A N3 N 212.51 . 1 19 29552 8 A H1' H 5.866 . 1 20 29552 8 A H2 H 7.406 . 1 21 29552 8 A N1 N 219.84 . 1 22 29552 8 A N3 N 211.507 . 1 23 29560 16 G H1 H 10.1693 . 1 24 29560 16 G N1 N 142.647 . 1 25 29561 17 G H1 H 12.7351 . 1 26 29561 17 G N1 N 147.566 . 1 27 29562 18 G H1 H 11.3631 . 1 28 29562 18 G H21 H 6.3455 . 2 29 29562 18 G H22 H 6.3455 . 2 30 29562 18 G N1 N 145.312 . 1 31 29562 18 G N2 N 74.047 . 1 32 29563 19 C H41 H 8.272 . 1 33 29563 19 C H42 H 6.946 . 1 34 29563 19 C N3 N 196.595 . 1 35 29563 19 C N4 N 98.958 . 1 36 29564 20 U H3 H 13.18 . 1 37 29564 20 U N3 N 161.469 . 1 38 29565 21 A H2 H 6.909 . 5 39 29565 21 A N1 N 221.822 . 5 40 29566 22 U H3 H 13.0844 . 5 41 29566 22 U N3 N 161.478 . 5 42 29567 23 A H2 H 6.909 . 5 43 29567 23 A N1 N 221.822 . 5 44 29568 24 U H3 H 13.0844 . 5 45 29568 24 U N3 N 161.478 . 5 46 29573 29 G H1 H 12.8651 . 1 47 29573 29 G N1 N 147.463 . 1 48 29574 30 U H3 H 14.4293 . 1 49 29574 30 U N1 N 145.945 . 1 50 29574 30 U N3 N 162.94 . 1 51 29575 31 U H3 H 11.1036 . 5 52 29575 31 U N1 N 145.588 . 5 53 29575 31 U N3 N 157.589 . 5 54 29576 32 U H3 H 11.2699 . 5 55 29576 32 U N1 N 146.588 . 5 56 29576 32 U N3 N 157.485 . 5 57 29577 33 U H3 H 10.7026 . 5 58 29577 33 U N1 N 148.395 . 5 59 29577 33 U N3 N 157.121 . 5 60 29578 34 C H41 H 8.38867 . 1 61 29578 34 C H42 H 7.216 . 1 62 29578 34 C N3 N 195.266 . 1 63 29578 34 C N4 N 99.5717 . 1 64 29587 43 G H1 H 12.9419 . 1 65 29587 43 G N1 N 147.548 . 1 66 29588 44 U H3 H 10.7026 . 5 67 29588 44 U N1 N 148.395 . 5 68 29588 44 U N3 N 157.121 . 5 69 29589 45 U H3 H 11.2699 . 5 70 29589 45 U N1 N 146.588 . 5 71 29589 45 U N3 N 157.485 . 5 72 29590 46 U H3 H 11.1036 . 5 73 29590 46 U N1 N 145.588 . 5 74 29590 46 U N3 N 157.589 . 5 75 29591 47 A H2 H 7.954 . 1 76 29591 47 A N1 N 221.83 . 1 77 29592 48 C H41 H 8.2865 . 1 78 29592 48 C H42 H 6.7265 . 1 79 29592 48 C N3 N 196.334 . 1 80 29592 48 C N4 N 97.8075 . 1 81 29596 52 A H2 H 6.909 . 5 82 29596 52 A N1 N 221.822 . 5 83 29597 53 U H3 H 13.0844 . 5 84 29597 53 U N3 N 161.478 . 5 85 29598 54 A H2 H 6.909 . 5 86 29598 54 A N1 N 221.822 . 5 87 29599 55 U H3 H 13.0844 . 5 88 29599 55 U N3 N 161.478 . 5 89 29600 56 A H2 H 6.69667 . 1 90 29600 56 A N1 N 220.067 . 1 91 29600 56 A N3 N 212.022 . 1 92 29601 57 G H1 H 13.4047 . 1 93 29601 57 G H21 H 6.185 . 2 94 29601 57 G H22 H 6.185 . 2 95 29601 57 G N1 N 148.063 . 1 96 29601 57 G N2 N 72.776 . 1 97 29602 58 U H3 H 12.1764 . 1 98 29602 58 U N3 N 158.758 . 1 99 29603 59 C H41 H 8.333 . 1 100 29603 59 C H42 H 7.286 . 1 101 29603 59 C N3 N 196.295 . 1 102 29603 59 C N4 N 98.719 . 1 103 29604 60 U H3 H 11.7137 . 1 104 29604 60 U N3 N 157.572 . 1 105 29609 65 U H3 H 13.861 . 1 106 29609 65 U N3 N 162.291 . 1 107 29610 66 U H1' H 5.589 . 1 108 29610 66 U H3 H 13.1933 . 1 109 29610 66 U H5 H 5.033 . 1 110 29610 66 U H6 H 7.71033 . 1 111 29610 66 U N3 N 162.464 . 1 112 29611 67 G H1 H 12.4461 . 1 113 29611 67 G H1' H 5.711 . 5 114 29611 67 G N1 N 147.285 . 1 115 29612 68 U H3 H 13.5644 . 1 116 29612 68 U N1 N 145.164 . 1 117 29612 68 U N3 N 162.08 . 1 118 29613 69 G H1 H 12.5148 . 1 119 29613 69 G N1 N 147.923 . 1 120 29614 70 C H41 H 8.517 . 1 121 29614 70 C N3 N 197.326 . 1 122 29614 70 C N4 N 99.069 . 1 123 1 72 C H41 H 8.483 . 1 124 1 72 C H42 H 6.878 . 1 125 1 72 C N3 N 197.004 . 1 stop_ loop_ _Atom_shift_assign_ID_ambiguity 38 '42,81,85' '39,43,82,86' '40,44,51,54,57,66,69,72,83,87' '41,45,53,56,59,68,71,74,84,88' '52,55,58,67,70,73' 113 stop_ save_ save_assigned_chemical_shifts_2 _Saveframe_category assigned_chemical_shifts _Details . loop_ _Software_label $software_2 stop_ loop_ _Experiment_label NOESY NOESY[15N]-Imino TROSY[15N] HNN-COSY[15N] stop_ loop_ _Sample_label $sample_1 $sample_2 stop_ _Sample_conditions_label $sample_conditions_1 _Chem_shift_reference_set_label $chem_shift_reference_1 _Mol_system_component_name 3_SL1 _Text_data_format . _Text_data . loop_ _Atom_shift_assign_ID _Residue_author_seq_code _Residue_seq_code _Residue_label _Atom_name _Atom_type _Chem_shift_value _Chem_shift_value_error _Chem_shift_ambiguity_code 1 8 8 A H1' H 5.711 . 5 2 31 31 U H3 H 10.0514 . 5 3 31 31 U N1 N 147.4 . 5 4 31 31 U N3 N 155.809 . 5 5 32 32 U H3 H 11.376 . 5 6 32 32 U N1 N 147.356 . 5 7 32 32 U N3 N 157.484 . 5 8 33 33 U H3 H 11.3444 . 5 9 33 33 U N3 N 158.3 . 5 10 44 44 U H3 H 11.3444 . 5 11 44 44 U N3 N 158.3 . 5 12 45 45 U H3 H 11.376 . 5 13 45 45 U N1 N 147.356 . 5 14 45 45 U N3 N 157.484 . 5 15 46 46 U H3 H 10.0514 . 5 16 46 46 U N1 N 147.4 . 5 17 46 46 U N3 N 155.809 . 5 18 67 67 G H1' H 5.711 . 1 stop_ loop_ _Atom_shift_assign_ID_ambiguity 1 '2,5,8,10,12,15' '3,6,13,16' '4,7,9,11,14,17' stop_ save_ save_assigned_chemical_shifts_3 _Saveframe_category assigned_chemical_shifts _Details . loop_ _Software_label $software_2 stop_ loop_ _Experiment_label NOESY NOESY[15N]-Imino TROSY[15N] HNN-COSY[15N] stop_ loop_ _Sample_label $sample_1 $sample_2 stop_ _Sample_conditions_label $sample_conditions_1 _Chem_shift_reference_set_label $chem_shift_reference_1 _Mol_system_component_name 3_SL1 _Text_data_format . _Text_data . loop_ _Atom_shift_assign_ID _Residue_author_seq_code _Residue_seq_code _Residue_label _Atom_name _Atom_type _Chem_shift_value _Chem_shift_value_error _Chem_shift_ambiguity_code 1 29552 8 A H1' H 5.866 . 5 2 29611 67 G H1' H 5.866 . 5 stop_ loop_ _Atom_shift_assign_ID_ambiguity 1 2 stop_ save_