data_50339 ####################### # Entry information # ####################### save_entry_information _Saveframe_category entry_information _Entry_title ; Assignment of base 15N and 1H chemical shifts for <5_SL5B+C> ; _BMRB_accession_number 50339 _BMRB_flat_file_name bmr50339.str _Entry_type original _Submission_date 2020-06-23 _Accession_date 2020-06-23 _Entry_origination author _NMR_STAR_version 2.1.1 _Experimental_method NMR _Details . loop_ _Author_ordinal _Author_family_name _Author_given_name _Author_middle_initials _Author_family_title 1 Schwalbe Harald . . 2 Richter Christian . . stop_ loop_ _Saveframe_category_type _Saveframe_category_type_count assigned_chemical_shifts 1 stop_ loop_ _Data_type _Data_type_count "1H chemical shifts" 14 "15N chemical shifts" 15 stop_ loop_ _Revision_date _Revision_keyword _Revision_author _Revision_detail 2020-12-18 update BMRB 'update entry citation' 2020-07-10 original author 'original release' stop_ loop_ _Related_BMRB_accession_number _Relationship 50340 'chemical shifts of the 5_SL5stem' 50341 'chemical shifts of the 3_s2m' 50342 'chemical shifts of the 3_SL1' 50343 'chemical shifts of the 2_SL3' 50344 'chemical shifts of the 5_SL2+3' 50346 'chemical shifts of the 5_SL5a' 50347 'chemical shifts of the 5_SL4' 50348 'chemical shifts of the PK (Pseudoknot)' 50349 'chemical shifts of the 5_SL1' 50350 'chemical shifts of the 3_SL3base' 50351 'chemical shifts of the 5_SL6' 50352 'chemical shifts of the 5_SL8' stop_ _Original_release_date 2020-06-23 save_ ############################# # Citation for this entry # ############################# save_citations_1 _Saveframe_category entry_citation _Citation_full . _Citation_title ; Secondary structure determination of conserved SARS-CoV-2 RNA elements by NMR spectroscopy ; _Citation_status published _Citation_type journal _CAS_abstract_code . _MEDLINE_UI_code . _PubMed_ID 33167030 loop_ _Author_ordinal _Author_family_name _Author_given_name _Author_middle_initials _Author_family_title 1 Wacker Anna . . 2 Weigand Julia E. . 3 Akabayov Sabine R. . 4 Altincekic Nadide . . 5 'Kaur Bains' Jasleen . . 6 Banijamali Elnaz . . 7 Binas Oliver . . 8 Castillo-Martinez Jesus . . 9 Cetiner Erhan . . 10 Ceylan Betul . . 11 Chiu Liang-Yuan . . 12 Davila-Calderon Jesse . . 13 'De Jesus' Vanessa . . 14 Dhamotharan Karthikeyan . . 15 Duchardt-Ferner Elke . . 16 Ferner Jan . . 17 Frydman Lucio . . 18 Furtig Boris . . 19 Gallego Jose . . 20 Grun 'J. Tassilo' . . 21 Hacker Carolin . . 22 Haddad Christina . . 23 Hahnke Martin . . 24 Hengesbach Martin . . 25 Hiller Fabian . . 26 Hohmann Katharina F. . 27 Hymon Daniel . . 28 Jonker Henry . . 29 Keller Heiko . . 30 Knezic Bozana . . 31 Landgraf Tom . . 32 Lohr Frank . . 33 Luo Luke . . 34 Mertinkus Klara R. . 35 Muhs Christina . . 36 Novakovic Mihajlo . . 37 Oxenfarth Andreas . . 38 Palomino-Schatzlein Martina . . 39 Petzold Katja . . 40 Peter Stephen A. . 41 Pyper Dennis J. . 42 Qureshi Nusrat S. . 43 Riad Magdalena . . 44 Richter Christian . . 45 Saxena Krishna . . 46 Schamber Tatjana . . 47 Scherf Tali . . 48 Schlagnitweit Judith . . 49 Schlundt Andreas . . 50 Schnieders Robbin . . 51 Schwalbe Harald . . 52 Simba-Lahuasi Alvaro . . 53 Sreeramulu Sridhar . . 54 Stirnal Elke . . 55 Sudakov Alexey . . 56 Tants Jan-Niklas . . 57 Tolbert Blanton S. . 58 Vogele Jenny . . 59 Weiss Lena . . 60 Wirmer-Bartoschek Julia . . 61 'Wirtz Martin' Maria A. . 62 Wohnert Jens . . 63 Zetzsche Heidi . . stop_ _Journal_abbreviation 'Nucleic Acids Res.' _Journal_name_full 'Nucleic acids research' _Journal_volume 48 _Journal_issue 22 _Journal_ISSN 1362-4962 _Journal_CSD . _Book_chapter_title . _Book_volume . _Book_series . _Book_ISBN . _Conference_state_province . _Conference_abstract_number . _Page_first 12415 _Page_last 12435 _Year 2020 _Details . save_ ################################## # Molecular system description # ################################## save_assembly_1 _Saveframe_category molecular_system _Mol_system_name 5_SL5B+C _Enzyme_commission_number . loop_ _Mol_system_component_name _Mol_label 5_SL5B+C $entity_1 stop_ _System_molecular_weight . _System_physical_state native _System_oligomer_state ? _System_paramagnetic no _System_thiol_state . _Database_query_date . _Details . save_ ######################## # Monomeric polymers # ######################## save_entity_1 _Saveframe_category monomeric_polymer _Mol_type polymer _Mol_polymer_class RNA _Name_common entity_1 _Molecular_mass . _Mol_thiol_state 'not present' _Details . ############################## # Polymer residue sequence # ############################## _Residue_count 37 _Mol_residue_sequence ; GCACAUCUAGGUUUCGUCCG GGUGUGACCGAAAGGUA ; loop_ _Residue_seq_code _Residue_author_seq_code _Residue_label 1 227 G 2 228 C 3 229 A 4 230 C 5 231 A 6 232 U 7 233 C 8 234 U 9 235 A 10 236 G 11 237 G 12 238 U 13 239 U 14 240 U 15 241 C 16 242 G 17 243 U 18 244 C 19 245 C 20 246 G 21 247 G 22 248 G 23 249 U 24 250 G 25 251 U 26 252 G 27 253 A 28 254 C 29 255 C 30 256 G 31 257 A 32 258 A 33 259 A 34 260 G 35 261 G 36 262 U 37 263 A stop_ _Sequence_homology_query_date . _Sequence_homology_query_revised_last_date . save_ #################### # Natural source # #################### save_natural_source_1 _Saveframe_category natural_source loop_ _Mol_label _Organism_name_common _NCBI_taxonomy_ID _Superkingdom _Kingdom _Genus _Species _Strain $entity_1 SARS-CoV-2 2697049 Viruses . Betacoronavirus HCoV-SARS SARS-CoV-2 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source_1 _Saveframe_category experimental_source loop_ _Mol_label _Production_method _Host_organism_name_common _Genus _Species _Strain _Vector_name $entity_1 'reverse transcriptase' . . . . . stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Saveframe_category sample _Sample_type solution _Details . loop_ _Mol_label _Concentration_value _Concentration_value_units _Isotopic_labeling $entity_1 350 uM [U-15N] 'potassium phosphate' 25 mM 'natural abundance' KCl 50 mM 'natural abundance' stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Saveframe_category software _Name LOGS _Version 2.2 loop_ _Task collection stop_ _Details . save_ save_software_2 _Saveframe_category software _Name SPARKY _Version 3.114 loop_ _Task 'chemical shift assignment' 'peak picking' stop_ _Details . save_ save_software_3 _Saveframe_category software _Name TOPSPIN _Version 4.0.7 loop_ _Task collection stop_ _Details . save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _Saveframe_category NMR_spectrometer _Manufacturer Bruker _Model 'Bruker Avance neo 600 MHz' _Field_strength 600 _Details . save_ save_NMR_spectrometer_2 _Saveframe_category NMR_spectrometer _Manufacturer Bruker _Model 'Bruker Avance neo 1000 MHz' _Field_strength 1000 _Details . save_ ############################# # NMR applied experiments # ############################# save_P_TROSY[15N]_1 _Saveframe_category NMR_applied_experiment _Experiment_name P_TROSY[15N] _Sample_label $sample_1 save_ save_1H-JR[15N]_2 _Saveframe_category NMR_applied_experiment _Experiment_name 1H-JR[15N] _Sample_label $sample_1 save_ save_HNN-COSY[15N]_3 _Saveframe_category NMR_applied_experiment _Experiment_name HNN-COSY[15N] _Sample_label $sample_1 save_ save_HSQC[15N]-2J_4 _Saveframe_category NMR_applied_experiment _Experiment_name HSQC[15N]-2J _Sample_label $sample_1 save_ save_NOESY-JR[15N]-Amino_5 _Saveframe_category NMR_applied_experiment _Experiment_name NOESY-JR[15N]-Amino _Sample_label $sample_1 save_ save_NOESY[15N]-Imino_6 _Saveframe_category NMR_applied_experiment _Experiment_name NOESY[15N]-Imino _Sample_label $sample_1 save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Saveframe_category sample_conditions _Details . loop_ _Variable_type _Variable_value _Variable_value_error _Variable_value_units 'ionic strength' 75 . mM pH 6.2 . pH pressure 1 . atm temperature 283 . K stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Saveframe_category chemical_shift_reference _Details . loop_ _Mol_common_name _Atom_type _Atom_isotope_number _Atom_group _Chem_shift_units _Chem_shift_value _Reference_method _Reference_type _External_reference_sample_geometry _External_reference_location _External_reference_axis _Indirect_shift_ratio DSS C 13 'methyl protons' ppm 0.00 na indirect . . . 0.251449530 DSS H 1 'methyl protons' ppm 0.00 internal direct . . . 1.000000000 DSS N 15 'methyl protons' ppm 0.00 na indirect . . . 0.101329118 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Saveframe_category assigned_chemical_shifts _Details . loop_ _Software_label $software_2 stop_ loop_ _Experiment_label P_TROSY[15N] 1H-JR[15N] HNN-COSY[15N] HSQC[15N]-2J NOESY-JR[15N]-Amino NOESY[15N]-Imino stop_ loop_ _Sample_label $sample_1 stop_ _Sample_conditions_label $sample_conditions_1 _Chem_shift_reference_set_label $chem_shift_reference_1 _Mol_system_component_name 5_SL5B+C _Text_data_format . _Text_data . loop_ _Atom_shift_assign_ID _Residue_author_seq_code _Residue_seq_code _Residue_label _Atom_name _Atom_type _Chem_shift_value _Chem_shift_value_error _Chem_shift_ambiguity_code 1 229 3 A H2 H 7.50886 . 1 2 229 3 A N1 N 221.551 . 1 3 229 3 A N3 N 212.102 . 1 4 230 4 C H41 H 8.308 . 1 5 230 4 C H42 H 6.99267 . 1 6 230 4 C N4 N 98.216 . 1 7 231 5 A H2 H 7.39618 . 1 8 231 5 A N1 N 220.674 . 1 9 231 5 A N3 N 213.859 . 1 10 232 6 U H3 H 11.9748 . 1 11 232 6 U N3 N 158.387 . 1 12 233 7 C H41 H 8.416 . 1 13 233 7 C H42 H 6.8476 . 1 14 233 7 C N3 N 195.631 . 1 15 233 7 C N4 N 98.1205 . 1 16 234 8 U H3 H 11.9794 . 1 17 234 8 U N3 N 157.674 . 1 18 246 20 G H1 H 10.5388 . 1 19 246 20 G N1 N 143.769 . 1 20 247 21 G H1 H 12.8844 . 1 21 247 21 G N1 N 148.108 . 1 22 248 22 G H1 H 11.5384 . 1 23 248 22 G N1 N 144.754 . 1 24 249 23 U H3 H 13.6816 . 1 25 249 23 U N3 N 162.594 . 1 26 250 24 G H1 H 12.5534 . 1 27 250 24 G N1 N 147.309 . 1 28 251 25 U H3 H 13.9372 . 1 29 251 25 U N3 N 162.217 . 1 stop_ save_