data_36680 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 36680 _Entry.Title ; Solution structure of MAX1A G-quadruplex DNA ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2024-07-05 _Entry.Accession_date 2024-07-05 _Entry.Last_release_date 2026-04-01 _Entry.Original_release_date 2026-04-01 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.2.0.16 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype 'SOLUTION NMR' _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 X. Hu X. . . . 36680 2 C. Cao C. . . . 36680 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID DNA . 36680 MAX . 36680 Quadruplex . 36680 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 36680 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 230 36680 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2026-06-08 . original BMRB . 36680 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 9IMY 'BMRB Entry Tracking System' 36680 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 36680 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID . _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Solution structure of MAX G-quadruplex DNA ; _Citation.Status 'in preparation' _Citation.Type journal _Citation.Journal_abbrev . _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year . _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 X. Hu X. . . . 36680 1 2 C. Cao C. . . . 36680 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 36680 _Assembly.ID 1 _Assembly.Name d(AGGGAGGGGAAGGGGTGAAGGGGA) _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state 'not present' _Assembly.Molecular_mass 7718.978 _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 entity_1 1 $entity_1 A A yes . . . . . . 36680 1 stop_ loop_ _Chem_comp_assembly.Assembly_chem_comp_ID _Chem_comp_assembly.Entity_assembly_ID _Chem_comp_assembly.Entity_ID _Chem_comp_assembly.Comp_index_ID _Chem_comp_assembly.Comp_ID _Chem_comp_assembly.Seq_ID _Chem_comp_assembly.Auth_entity_assembly_ID _Chem_comp_assembly.Auth_asym_ID _Chem_comp_assembly.Auth_seq_ID _Chem_comp_assembly.Auth_comp_ID _Chem_comp_assembly.Auth_variant_ID _Chem_comp_assembly.Sequence_linking _Chem_comp_assembly.Cis_residue _Chem_comp_assembly.NEF_index _Chem_comp_assembly.Entry_ID _Chem_comp_assembly.Assembly_ID . 1 1 1 DA 1 . A 1 DA . start . . 36680 1 . 1 1 10 DA 10 . A 10 DA . middle . . 36680 1 . 1 1 11 DA 11 . A 11 DA . middle . . 36680 1 . 1 1 12 DG 12 . A 12 DG . middle . . 36680 1 . 1 1 13 DG 13 . A 13 DG . middle . . 36680 1 . 1 1 14 DG 14 . A 14 DG . middle . . 36680 1 . 1 1 15 DG 15 . A 15 DG . middle . . 36680 1 . 1 1 16 DT 16 . A 16 DT . middle . . 36680 1 . 1 1 17 DG 17 . A 17 DG . middle . . 36680 1 . 1 1 18 DA 18 . A 18 DA . middle . . 36680 1 . 1 1 19 DA 19 . A 19 DA . middle . . 36680 1 . 1 1 2 DG 2 . A 2 DG . middle . . 36680 1 . 1 1 20 DG 20 . A 20 DG . middle . . 36680 1 . 1 1 21 DG 21 . A 21 DG . middle . . 36680 1 . 1 1 22 DG 22 . A 22 DG . middle . . 36680 1 . 1 1 23 DG 23 . A 23 DG . middle . . 36680 1 . 1 1 24 DA 24 . A 24 DA . end . . 36680 1 . 1 1 3 DG 3 . A 3 DG . middle . . 36680 1 . 1 1 4 DG 4 . A 4 DG . middle . . 36680 1 . 1 1 5 DA 5 . A 5 DA . middle . . 36680 1 . 1 1 6 DG 6 . A 6 DG . middle . . 36680 1 . 1 1 7 DG 7 . A 7 DG . middle . . 36680 1 . 1 1 8 DG 8 . A 8 DG . middle . . 36680 1 . 1 1 9 DG 9 . A 9 DG . middle . . 36680 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 36680 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name "DNA (5'-D(*AP*GP*GP*GP*AP*GP*GP*GP*GP*AP*AP*GP*GP*GP*GP*TP*GP*AP*AP*GP*GP*GP*GP*A)-3')" _Entity.Type polymer _Entity.Polymer_common_type DNA _Entity.Polymer_type polydeoxyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; AGGGAGGGGAAGGGGTGAAG GGGA ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 24 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 7718.978 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 1 DA . 36680 1 2 2 DG . 36680 1 3 3 DG . 36680 1 4 4 DG . 36680 1 5 5 DA . 36680 1 6 6 DG . 36680 1 7 7 DG . 36680 1 8 8 DG . 36680 1 9 9 DG . 36680 1 10 10 DA . 36680 1 11 11 DA . 36680 1 12 12 DG . 36680 1 13 13 DG . 36680 1 14 14 DG . 36680 1 15 15 DG . 36680 1 16 16 DT . 36680 1 17 17 DG . 36680 1 18 18 DA . 36680 1 19 19 DA . 36680 1 20 20 DG . 36680 1 21 21 DG . 36680 1 22 22 DG . 36680 1 23 23 DG . 36680 1 24 24 DA . 36680 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . DA 1 1 36680 1 . DG 2 2 36680 1 . DG 3 3 36680 1 . DG 4 4 36680 1 . DA 5 5 36680 1 . DG 6 6 36680 1 . DG 7 7 36680 1 . DG 8 8 36680 1 . DG 9 9 36680 1 . DA 10 10 36680 1 . DA 11 11 36680 1 . DG 12 12 36680 1 . DG 13 13 36680 1 . DG 14 14 36680 1 . DG 15 15 36680 1 . DT 16 16 36680 1 . DG 17 17 36680 1 . DA 18 18 36680 1 . DA 19 19 36680 1 . DG 20 20 36680 1 . DG 21 21 36680 1 . DG 22 22 36680 1 . DG 23 23 36680 1 . DA 24 24 36680 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 36680 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 9606 organism . 'Homo sapiens' Human . . Eukaryota Metazoa Homo sapiens . . . . . . . . . . . . . 36680 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 36680 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' unidentified . . . . . . . . . . . . . . . 36680 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 36680 _Sample.ID 1 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '1.0 mM MAX1A, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 MAX1A 'natural abundance' 1 $assembly 1 $entity_1 . DNA 1.0 . . mM . . . . 36680 1 2 H2O 'natural abundance' . . . . . solvent 90 . . % . . . . 36680 1 3 D2O [U-2H] . . . . . solvent 10 . . % . . . . 36680 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 36680 _Sample.ID 2 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '1.0 mM MAX1A, 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 MAX1A 'natural abundance' 1 $assembly 1 $entity_1 . DNA 1.0 . . mM . . . . 36680 2 2 D2O [U-2H] . . . . . solvent 100 . . % . . . . 36680 2 stop_ save_ save_sample_3 _Sample.Sf_category sample _Sample.Sf_framecode sample_3 _Sample.Entry_ID 36680 _Sample.ID 3 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '1.0 mM MAX1A, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 MAX1A 'natural abundance' 1 $assembly 1 $entity_1 . DNA 1.0 . . mM . . . . 36680 3 2 H2O 'natural abundance' . . . . . solvent 90 . . % . . . . 36680 3 3 D2O [U-2H] . . . . . solvent 10 . . % . . . . 36680 3 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 36680 _Sample_condition_list.ID 1 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 100 . mM 36680 1 pH 7 . pH 36680 1 pressure 1 . atm 36680 1 temperature 298 . K 36680 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 36680 _Software.ID 1 _Software.Type . _Software.Name VnmrJ _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Varian . . 36680 1 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID collection . 36680 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 36680 _Software.ID 2 _Software.Type . _Software.Name NMRPipe _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' . . 36680 2 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID processing . 36680 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 36680 _Software.ID 3 _Software.Type . _Software.Name Sparky _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Goddard . . 36680 3 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'peak picking' . 36680 3 stop_ save_ save_software_4 _Software.Sf_category software _Software.Sf_framecode software_4 _Software.Entry_ID 36680 _Software.ID 4 _Software.Type . _Software.Name 'X-PLOR NIH' _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 36680 4 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'structure calculation' . 36680 4 stop_ save_ save_software_5 _Software.Sf_category software _Software.Sf_framecode software_5 _Software.Entry_ID 36680 _Software.ID 5 _Software.Type . _Software.Name 'X-PLOR NIH' _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 36680 5 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID refinement . 36680 5 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 36680 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Agilent _NMR_spectrometer.Model Premium _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 800 save_ save_NMR_spectrometer_2 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_2 _NMR_spectrometer.Entry_ID 36680 _NMR_spectrometer.ID 2 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model AVANCE _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_NMR_spectrometer_list_1 _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list_1 _NMR_spectrometer_list.Entry_ID 36680 _NMR_spectrometer_list.ID 1 _NMR_spectrometer_list.Name . loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Agilent Premium . 800 . . . 36680 1 2 NMR_spectrometer_2 Bruker AVANCE . 600 . . . 36680 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 36680 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D DQF-COSY' . . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36680 1 2 '2D 1H-1H TOCSY' . . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36680 1 3 '2D 1H-1H NOESY' . . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36680 1 4 '2D DQF-COSY' . . . . . . . . . . . . . 2 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36680 1 5 '2D 1H-1H TOCSY' . . . . . . . . . . . . . 2 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36680 1 6 '2D 1H-1H NOESY' . . . . . . . . . . . . . 2 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36680 1 7 '2D 1H-13C HSQC' . . . . . . . . . . . . . 3 $sample_3 isotropic . . 1 $sample_conditions_1 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 36680 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 36680 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name . _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 water protons . . . . ppm 4.744 internal direct 1.0 . . . . . 36680 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_nef_chemical_shift_list _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode nef_chemical_shift_list _Assigned_chem_shift_list.Entry_ID 36680 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 3 '2D 1H-1H NOESY' 1 $sample_1 isotropic 36680 1 4 '2D DQF-COSY' 2 $sample_2 isotropic 36680 1 7 '2D 1H-13C HSQC' 3 $sample_3 isotropic 36680 1 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 3 $software_3 . . 36680 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 DA H1' H 1 5.915 . . 1 . . . . A 1 DA H1' . 36680 1 2 . 1 . 1 1 1 DA H2 H 1 8.091 . . 1 . . . . A 1 DA H2 . 36680 1 3 . 1 . 1 1 1 DA H2' H 1 2.061 . . 1 . . . . A 1 DA H2' . 36680 1 4 . 1 . 1 1 1 DA H2'' H 1 2.546 . . 1 . . . . A 1 DA H2'' . 36680 1 5 . 1 . 1 1 1 DA H3' H 1 4.743 . . 1 . . . . A 1 DA H3' . 36680 1 6 . 1 . 1 1 1 DA H4' H 1 4.184 . . 1 . . . . A 1 DA H4' . 36680 1 7 . 1 . 1 1 1 DA H5' H 1 3.699 . . 1 . . . . A 1 DA H5' . 36680 1 8 . 1 . 1 1 1 DA H8 H 1 7.969 . . 1 . . . . A 1 DA H8 . 36680 1 9 . 1 . 1 2 2 DG H1 H 1 11.618 . . 1 . . . . A 2 DG H1 . 36680 1 10 . 1 . 1 2 2 DG H1' H 1 5.873 . . 1 . . . . A 2 DG H1' . 36680 1 11 . 1 . 1 2 2 DG H2' H 1 2.767 . . 1 . . . . A 2 DG H2' . 36680 1 12 . 1 . 1 2 2 DG H2'' H 1 2.985 . . 1 . . . . A 2 DG H2'' . 36680 1 13 . 1 . 1 2 2 DG H21 H 1 5.405 . . 1 . . . . A 2 DG H21 . 36680 1 14 . 1 . 1 2 2 DG H22 H 1 10.034 . . 1 . . . . A 2 DG H22 . 36680 1 15 . 1 . 1 2 2 DG H3' H 1 4.95 . . 1 . . . . A 2 DG H3' . 36680 1 16 . 1 . 1 2 2 DG H4' H 1 4.413 . . 1 . . . . A 2 DG H4' . 36680 1 17 . 1 . 1 2 2 DG H5' H 1 4.092 . . 1 . . . . A 2 DG H5' . 36680 1 18 . 1 . 1 2 2 DG H5'' H 1 4.135 . . 1 . . . . A 2 DG H5'' . 36680 1 19 . 1 . 1 2 2 DG H8 H 1 8.124 . . 1 . . . . A 2 DG H8 . 36680 1 20 . 1 . 1 3 3 DG H1 H 1 10.823 . . 1 . . . . A 3 DG H1 . 36680 1 21 . 1 . 1 3 3 DG H1' H 1 6.038 . . 1 . . . . A 3 DG H1' . 36680 1 22 . 1 . 1 3 3 DG H2' H 1 2.408 . . 1 . . . . A 3 DG H2' . 36680 1 23 . 1 . 1 3 3 DG H2'' H 1 2.828 . . 1 . . . . A 3 DG H2'' . 36680 1 24 . 1 . 1 3 3 DG H21 H 1 6.409 . . 1 . . . . A 3 DG H21 . 36680 1 25 . 1 . 1 3 3 DG H22 H 1 8.744 . . 1 . . . . A 3 DG H22 . 36680 1 26 . 1 . 1 3 3 DG H3' H 1 4.853 . . 1 . . . . A 3 DG H3' . 36680 1 27 . 1 . 1 3 3 DG H4' H 1 4.444 . . 1 . . . . A 3 DG H4' . 36680 1 28 . 1 . 1 3 3 DG H5' H 1 4.15 . . 1 . . . . A 3 DG H5' . 36680 1 29 . 1 . 1 3 3 DG H5'' H 1 4.24 . . 1 . . . . A 3 DG H5'' . 36680 1 30 . 1 . 1 3 3 DG H8 H 1 7.415 . . 1 . . . . A 3 DG H8 . 36680 1 31 . 1 . 1 4 4 DG H1 H 1 10.909 . . 1 . . . . A 4 DG H1 . 36680 1 32 . 1 . 1 4 4 DG H1' H 1 6.29 . . 1 . . . . A 4 DG H1' . 36680 1 33 . 1 . 1 4 4 DG H2' H 1 2.605 . . 1 . . . . A 4 DG H2' . 36680 1 34 . 1 . 1 4 4 DG H2'' H 1 2.605 . . 1 . . . . A 4 DG H2'' . 36680 1 35 . 1 . 1 4 4 DG H21 H 1 6.466 . . 1 . . . . A 4 DG H21 . 36680 1 36 . 1 . 1 4 4 DG H22 H 1 8.66 . . 1 . . . . A 4 DG H22 . 36680 1 37 . 1 . 1 4 4 DG H3' H 1 5.07 . . 1 . . . . A 4 DG H3' . 36680 1 38 . 1 . 1 4 4 DG H4' H 1 4.52 . . 1 . . . . A 4 DG H4' . 36680 1 39 . 1 . 1 4 4 DG H5' H 1 4.237 . . 1 . . . . A 4 DG H5' . 36680 1 40 . 1 . 1 4 4 DG H8 H 1 7.357 . . 1 . . . . A 4 DG H8 . 36680 1 41 . 1 . 1 5 5 DA H1' H 1 6.572 . . 1 . . . . A 5 DA H1' . 36680 1 42 . 1 . 1 5 5 DA H2 H 1 8.209 . . 1 . . . . A 5 DA H2 . 36680 1 43 . 1 . 1 5 5 DA H2' H 1 2.837 . . 1 . . . . A 5 DA H2' . 36680 1 44 . 1 . 1 5 5 DA H2'' H 1 2.836 . . 1 . . . . A 5 DA H2'' . 36680 1 45 . 1 . 1 5 5 DA H3' H 1 5.132 . . 1 . . . . A 5 DA H3' . 36680 1 46 . 1 . 1 5 5 DA H4' H 1 4.552 . . 1 . . . . A 5 DA H4' . 36680 1 47 . 1 . 1 5 5 DA H5' H 1 4.256 . . 1 . . . . A 5 DA H5' . 36680 1 48 . 1 . 1 5 5 DA H8 H 1 8.436 . . 1 . . . . A 5 DA H8 . 36680 1 49 . 1 . 1 6 6 DG H1 H 1 11.23 . . 1 . . . . A 6 DG H1 . 36680 1 50 . 1 . 1 6 6 DG H1' H 1 6.064 . . 1 . . . . A 6 DG H1' . 36680 1 51 . 1 . 1 6 6 DG H2' H 1 2.383 . . 1 . . . . A 6 DG H2' . 36680 1 52 . 1 . 1 6 6 DG H2'' H 1 2.786 . . 1 . . . . A 6 DG H2'' . 36680 1 53 . 1 . 1 6 6 DG H21 H 1 6.158 . . 1 . . . . A 6 DG H21 . 36680 1 54 . 1 . 1 6 6 DG H22 H 1 9.407 . . 1 . . . . A 6 DG H22 . 36680 1 55 . 1 . 1 6 6 DG H3' H 1 5.099 . . 1 . . . . A 6 DG H3' . 36680 1 56 . 1 . 1 6 6 DG H4' H 1 4.408 . . 1 . . . . A 6 DG H4' . 36680 1 57 . 1 . 1 6 6 DG H5' H 1 4.154 . . 1 . . . . A 6 DG H5' . 36680 1 58 . 1 . 1 6 6 DG H5'' H 1 4.278 . . 1 . . . . A 6 DG H5'' . 36680 1 59 . 1 . 1 6 6 DG H8 H 1 7.984 . . 1 . . . . A 6 DG H8 . 36680 1 60 . 1 . 1 7 7 DG H1 H 1 11.111 . . 1 . . . . A 7 DG H1 . 36680 1 61 . 1 . 1 7 7 DG H1' H 1 5.716 . . 1 . . . . A 7 DG H1' . 36680 1 62 . 1 . 1 7 7 DG H2' H 1 2.506 . . 1 . . . . A 7 DG H2' . 36680 1 63 . 1 . 1 7 7 DG H2'' H 1 2.468 . . 1 . . . . A 7 DG H2'' . 36680 1 64 . 1 . 1 7 7 DG H21 H 1 5.806 . . 1 . . . . A 7 DG H21 . 36680 1 65 . 1 . 1 7 7 DG H22 H 1 8.872 . . 1 . . . . A 7 DG H22 . 36680 1 66 . 1 . 1 7 7 DG H3' H 1 4.95 . . 1 . . . . A 7 DG H3' . 36680 1 67 . 1 . 1 7 7 DG H4' H 1 4.34 . . 1 . . . . A 7 DG H4' . 36680 1 68 . 1 . 1 7 7 DG H5' H 1 4.179 . . 1 . . . . A 7 DG H5' . 36680 1 69 . 1 . 1 7 7 DG H5'' H 1 4.061 . . 1 . . . . A 7 DG H5'' . 36680 1 70 . 1 . 1 7 7 DG H8 H 1 7.738 . . 1 . . . . A 7 DG H8 . 36680 1 71 . 1 . 1 8 8 DG H1 H 1 10.549 . . 1 . . . . A 8 DG H1 . 36680 1 72 . 1 . 1 8 8 DG H1' H 1 5.831 . . 1 . . . . A 8 DG H1' . 36680 1 73 . 1 . 1 8 8 DG H2' H 1 1.591 . . 1 . . . . A 8 DG H2' . 36680 1 74 . 1 . 1 8 8 DG H2'' H 1 2.047 . . 1 . . . . A 8 DG H2'' . 36680 1 75 . 1 . 1 8 8 DG H21 H 1 6.785 . . 1 . . . . A 8 DG H21 . 36680 1 76 . 1 . 1 8 8 DG H22 H 1 6.833 . . 1 . . . . A 8 DG H22 . 36680 1 77 . 1 . 1 8 8 DG H3' H 1 4.765 . . 1 . . . . A 8 DG H3' . 36680 1 78 . 1 . 1 8 8 DG H4' H 1 4.303 . . 1 . . . . A 8 DG H4' . 36680 1 79 . 1 . 1 8 8 DG H5' H 1 3.982 . . 1 . . . . A 8 DG H5' . 36680 1 80 . 1 . 1 8 8 DG H5'' H 1 4.054 . . 1 . . . . A 8 DG H5'' . 36680 1 81 . 1 . 1 8 8 DG H8 H 1 7.084 . . 1 . . . . A 8 DG H8 . 36680 1 82 . 1 . 1 9 9 DG H1 H 1 10.422 . . 1 . . . . A 9 DG H1 . 36680 1 83 . 1 . 1 9 9 DG H1' H 1 5.166 . . 1 . . . . A 9 DG H1' . 36680 1 84 . 1 . 1 9 9 DG H2' H 1 2.643 . . 1 . . . . A 9 DG H2' . 36680 1 85 . 1 . 1 9 9 DG H2'' H 1 2.463 . . 1 . . . . A 9 DG H2'' . 36680 1 86 . 1 . 1 9 9 DG H21 H 1 8.099 . . 1 . . . . A 9 DG H21 . 36680 1 87 . 1 . 1 9 9 DG H22 H 1 8.582 . . 1 . . . . A 9 DG H22 . 36680 1 88 . 1 . 1 9 9 DG H3' H 1 4.831 . . 1 . . . . A 9 DG H3' . 36680 1 89 . 1 . 1 9 9 DG H4' H 1 4.522 . . 1 . . . . A 9 DG H4' . 36680 1 90 . 1 . 1 9 9 DG H5' H 1 4.09 . . 1 . . . . A 9 DG H5' . 36680 1 91 . 1 . 1 9 9 DG H5'' H 1 4.006 . . 1 . . . . A 9 DG H5'' . 36680 1 92 . 1 . 1 9 9 DG H8 H 1 7.812 . . 1 . . . . A 9 DG H8 . 36680 1 93 . 1 . 1 10 10 DA H1' H 1 5.339 . . 1 . . . . A 10 DA H1' . 36680 1 94 . 1 . 1 10 10 DA H2 H 1 7.11 . . 1 . . . . A 10 DA H2 . 36680 1 95 . 1 . 1 10 10 DA H2' H 1 1.901 . . 1 . . . . A 10 DA H2' . 36680 1 96 . 1 . 1 10 10 DA H2'' H 1 2.017 . . 1 . . . . A 10 DA H2'' . 36680 1 97 . 1 . 1 10 10 DA H3' H 1 4.258 . . 1 . . . . A 10 DA H3' . 36680 1 98 . 1 . 1 10 10 DA H5' H 1 3.437 . . 1 . . . . A 10 DA H5' . 36680 1 99 . 1 . 1 10 10 DA H5'' H 1 3.408 . . 1 . . . . A 10 DA H5'' . 36680 1 100 . 1 . 1 10 10 DA H8 H 1 7.774 . . 1 . . . . A 10 DA H8 . 36680 1 101 . 1 . 1 11 11 DA H1' H 1 5.366 . . 1 . . . . A 11 DA H1' . 36680 1 102 . 1 . 1 11 11 DA H2 H 1 7.343 . . 1 . . . . A 11 DA H2 . 36680 1 103 . 1 . 1 11 11 DA H2' H 1 2.368 . . 1 . . . . A 11 DA H2' . 36680 1 104 . 1 . 1 11 11 DA H2'' H 1 2.313 . . 1 . . . . A 11 DA H2'' . 36680 1 105 . 1 . 1 11 11 DA H3' H 1 4.297 . . 1 . . . . A 11 DA H3' . 36680 1 106 . 1 . 1 11 11 DA H4' H 1 3.605 . . 1 . . . . A 11 DA H4' . 36680 1 107 . 1 . 1 11 11 DA H5' H 1 3.705 . . 1 . . . . A 11 DA H5' . 36680 1 108 . 1 . 1 11 11 DA H5'' H 1 2.89 . . 1 . . . . A 11 DA H5'' . 36680 1 109 . 1 . 1 11 11 DA H8 H 1 7.335 . . 1 . . . . A 11 DA H8 . 36680 1 110 . 1 . 1 12 12 DG H1' H 1 5.6 . . 1 . . . . A 12 DG H1' . 36680 1 111 . 1 . 1 12 12 DG H2' H 1 1.668 . . 1 . . . . A 12 DG H2' . 36680 1 112 . 1 . 1 12 12 DG H2'' H 1 2.487 . . 1 . . . . A 12 DG H2'' . 36680 1 113 . 1 . 1 12 12 DG H3' H 1 4.544 . . 1 . . . . A 12 DG H3' . 36680 1 114 . 1 . 1 12 12 DG H4' H 1 3.934 . . 1 . . . . A 12 DG H4' . 36680 1 115 . 1 . 1 12 12 DG H5' H 1 3.552 . . 1 . . . . A 12 DG H5' . 36680 1 116 . 1 . 1 12 12 DG H5'' H 1 2.261 . . 1 . . . . A 12 DG H5'' . 36680 1 117 . 1 . 1 12 12 DG H8 H 1 7.096 . . 1 . . . . A 12 DG H8 . 36680 1 118 . 1 . 1 13 13 DG H1 H 1 11.47 . . 1 . . . . A 13 DG H1 . 36680 1 119 . 1 . 1 13 13 DG H1' H 1 6.035 . . 1 . . . . A 13 DG H1' . 36680 1 120 . 1 . 1 13 13 DG H2' H 1 3.689 . . 1 . . . . A 13 DG H2' . 36680 1 121 . 1 . 1 13 13 DG H2'' H 1 3.123 . . 1 . . . . A 13 DG H2'' . 36680 1 122 . 1 . 1 13 13 DG H21 H 1 7.108 . . 1 . . . . A 13 DG H21 . 36680 1 123 . 1 . 1 13 13 DG H3' H 1 4.758 . . 1 . . . . A 13 DG H3' . 36680 1 124 . 1 . 1 13 13 DG H4' H 1 4.357 . . 1 . . . . A 13 DG H4' . 36680 1 125 . 1 . 1 13 13 DG H5' H 1 4.045 . . 1 . . . . A 13 DG H5' . 36680 1 126 . 1 . 1 13 13 DG H5'' H 1 4.09 . . 1 . . . . A 13 DG H5'' . 36680 1 127 . 1 . 1 13 13 DG H8 H 1 7.399 . . 1 . . . . A 13 DG H8 . 36680 1 128 . 1 . 1 14 14 DG H1 H 1 11.131 . . 1 . . . . A 14 DG H1 . 36680 1 129 . 1 . 1 14 14 DG H1' H 1 5.807 . . 1 . . . . A 14 DG H1' . 36680 1 130 . 1 . 1 14 14 DG H2' H 1 2.966 . . 1 . . . . A 14 DG H2' . 36680 1 131 . 1 . 1 14 14 DG H2'' H 1 2.723 . . 1 . . . . A 14 DG H2'' . 36680 1 132 . 1 . 1 14 14 DG H3' H 1 4.941 . . 1 . . . . A 14 DG H3' . 36680 1 133 . 1 . 1 14 14 DG H4' H 1 4.306 . . 1 . . . . A 14 DG H4' . 36680 1 134 . 1 . 1 14 14 DG H5' H 1 4.29 . . 1 . . . . A 14 DG H5' . 36680 1 135 . 1 . 1 14 14 DG H8 H 1 7.375 . . 1 . . . . A 14 DG H8 . 36680 1 136 . 1 . 1 15 15 DG H1 H 1 11.131 . . 1 . . . . A 15 DG H1 . 36680 1 137 . 1 . 1 15 15 DG H1' H 1 5.52 . . 1 . . . . A 15 DG H1' . 36680 1 138 . 1 . 1 15 15 DG H2' H 1 2.562 . . 1 . . . . A 15 DG H2' . 36680 1 139 . 1 . 1 15 15 DG H2'' H 1 2.311 . . 1 . . . . A 15 DG H2'' . 36680 1 140 . 1 . 1 15 15 DG H21 H 1 6.702 . . 1 . . . . A 15 DG H21 . 36680 1 141 . 1 . 1 15 15 DG H22 H 1 9.483 . . 1 . . . . A 15 DG H22 . 36680 1 142 . 1 . 1 15 15 DG H3' H 1 4.81 . . 1 . . . . A 15 DG H3' . 36680 1 143 . 1 . 1 15 15 DG H4' H 1 4.188 . . 1 . . . . A 15 DG H4' . 36680 1 144 . 1 . 1 15 15 DG H5' H 1 4.077 . . 1 . . . . A 15 DG H5' . 36680 1 145 . 1 . 1 15 15 DG H8 H 1 7.326 . . 1 . . . . A 15 DG H8 . 36680 1 146 . 1 . 1 16 16 DT H1' H 1 5.695 . . 1 . . . . A 16 DT H1' . 36680 1 147 . 1 . 1 16 16 DT H2' H 1 1.115 . . 1 . . . . A 16 DT H2' . 36680 1 148 . 1 . 1 16 16 DT H2'' H 1 2.01 . . 1 . . . . A 16 DT H2'' . 36680 1 149 . 1 . 1 16 16 DT H3 H 1 12.194 . . 1 . . . . A 16 DT H3 . 36680 1 150 . 1 . 1 16 16 DT H3' H 1 4.624 . . 1 . . . . A 16 DT H3' . 36680 1 151 . 1 . 1 16 16 DT H4' H 1 4.386 . . 1 . . . . A 16 DT H4' . 36680 1 152 . 1 . 1 16 16 DT H5' H 1 3.955 . . 1 . . . . A 16 DT H5' . 36680 1 153 . 1 . 1 16 16 DT H5'' H 1 3.914 . . 1 . . . . A 16 DT H5'' . 36680 1 154 . 1 . 1 16 16 DT H6 H 1 6.668 . . 1 . . . . A 16 DT H6 . 36680 1 155 . 1 . 1 16 16 DT H71 H 1 1.414 . . 1 . . . . A 16 DT H71 . 36680 1 156 . 1 . 1 16 16 DT H72 H 1 1.414 . . 1 . . . . A 16 DT H72 . 36680 1 157 . 1 . 1 16 16 DT H73 H 1 1.414 . . 1 . . . . A 16 DT H73 . 36680 1 158 . 1 . 1 17 17 DG H1' H 1 5.104 . . 1 . . . . A 17 DG H1' . 36680 1 159 . 1 . 1 17 17 DG H2' H 1 2.531 . . 1 . . . . A 17 DG H2' . 36680 1 160 . 1 . 1 17 17 DG H2'' H 1 2.342 . . 1 . . . . A 17 DG H2'' . 36680 1 161 . 1 . 1 17 17 DG H3' H 1 4.738 . . 1 . . . . A 17 DG H3' . 36680 1 162 . 1 . 1 17 17 DG H4' H 1 4.387 . . 1 . . . . A 17 DG H4' . 36680 1 163 . 1 . 1 17 17 DG H5' H 1 3.921 . . 1 . . . . A 17 DG H5' . 36680 1 164 . 1 . 1 17 17 DG H8 H 1 7.807 . . 1 . . . . A 17 DG H8 . 36680 1 165 . 1 . 1 18 18 DA H1' H 1 5.538 . . 1 . . . . A 18 DA H1' . 36680 1 166 . 1 . 1 18 18 DA H2 H 1 7.606 . . 1 . . . . A 18 DA H2 . 36680 1 167 . 1 . 1 18 18 DA H2' H 1 2.023 . . 1 . . . . A 18 DA H2' . 36680 1 168 . 1 . 1 18 18 DA H2'' H 1 2.024 . . 1 . . . . A 18 DA H2'' . 36680 1 169 . 1 . 1 18 18 DA H3' H 1 4.351 . . 1 . . . . A 18 DA H3' . 36680 1 170 . 1 . 1 18 18 DA H4' H 1 2.128 . . 1 . . . . A 18 DA H4' . 36680 1 171 . 1 . 1 18 18 DA H5' H 1 2.962 . . 1 . . . . A 18 DA H5' . 36680 1 172 . 1 . 1 18 18 DA H5'' H 1 3.234 . . 1 . . . . A 18 DA H5'' . 36680 1 173 . 1 . 1 18 18 DA H8 H 1 7.857 . . 1 . . . . A 18 DA H8 . 36680 1 174 . 1 . 1 19 19 DA H1' H 1 5.979 . . 1 . . . . A 19 DA H1' . 36680 1 175 . 1 . 1 19 19 DA H2' H 1 2.57 . . 1 . . . . A 19 DA H2' . 36680 1 176 . 1 . 1 19 19 DA H2'' H 1 2.732 . . 1 . . . . A 19 DA H2'' . 36680 1 177 . 1 . 1 19 19 DA H3' H 1 4.653 . . 1 . . . . A 19 DA H3' . 36680 1 178 . 1 . 1 19 19 DA H4' H 1 4.15 . . 1 . . . . A 19 DA H4' . 36680 1 179 . 1 . 1 19 19 DA H5' H 1 3.713 . . 1 . . . . A 19 DA H5' . 36680 1 180 . 1 . 1 19 19 DA H5'' H 1 3.595 . . 1 . . . . A 19 DA H5'' . 36680 1 181 . 1 . 1 19 19 DA H8 H 1 7.709 . . 1 . . . . A 19 DA H8 . 36680 1 182 . 1 . 1 20 20 DG H1 H 1 10.083 . . 1 . . . . A 20 DG H1 . 36680 1 183 . 1 . 1 20 20 DG H1' H 1 5.47 . . 1 . . . . A 20 DG H1' . 36680 1 184 . 1 . 1 20 20 DG H2' H 1 2.181 . . 1 . . . . A 20 DG H2' . 36680 1 185 . 1 . 1 20 20 DG H2'' H 1 2.625 . . 1 . . . . A 20 DG H2'' . 36680 1 186 . 1 . 1 20 20 DG H3' H 1 4.694 . . 1 . . . . A 20 DG H3' . 36680 1 187 . 1 . 1 20 20 DG H4' H 1 4.286 . . 1 . . . . A 20 DG H4' . 36680 1 188 . 1 . 1 20 20 DG H5' H 1 4.127 . . 1 . . . . A 20 DG H5' . 36680 1 189 . 1 . 1 20 20 DG H5'' H 1 3.913 . . 1 . . . . A 20 DG H5'' . 36680 1 190 . 1 . 1 20 20 DG H8 H 1 7.676 . . 1 . . . . A 20 DG H8 . 36680 1 191 . 1 . 1 21 21 DG H1 H 1 11.204 . . 1 . . . . A 21 DG H1 . 36680 1 192 . 1 . 1 21 21 DG H1' H 1 5.811 . . 1 . . . . A 21 DG H1' . 36680 1 193 . 1 . 1 21 21 DG H2' H 1 2.392 . . 1 . . . . A 21 DG H2' . 36680 1 194 . 1 . 1 21 21 DG H2'' H 1 2.874 . . 1 . . . . A 21 DG H2'' . 36680 1 195 . 1 . 1 21 21 DG H21 H 1 5.814 . . 1 . . . . A 21 DG H21 . 36680 1 196 . 1 . 1 21 21 DG H22 H 1 9.705 . . 1 . . . . A 21 DG H22 . 36680 1 197 . 1 . 1 21 21 DG H3' H 1 4.897 . . 1 . . . . A 21 DG H3' . 36680 1 198 . 1 . 1 21 21 DG H4' H 1 4.319 . . 1 . . . . A 21 DG H4' . 36680 1 199 . 1 . 1 21 21 DG H5' H 1 4.121 . . 1 . . . . A 21 DG H5' . 36680 1 200 . 1 . 1 21 21 DG H5'' H 1 4.08 . . 1 . . . . A 21 DG H5'' . 36680 1 201 . 1 . 1 21 21 DG H8 H 1 7.688 . . 1 . . . . A 21 DG H8 . 36680 1 202 . 1 . 1 22 22 DG H1 H 1 10.867 . . 1 . . . . A 22 DG H1 . 36680 1 203 . 1 . 1 22 22 DG H1' H 1 5.814 . . 1 . . . . A 22 DG H1' . 36680 1 204 . 1 . 1 22 22 DG H2' H 1 2.454 . . 1 . . . . A 22 DG H2' . 36680 1 205 . 1 . 1 22 22 DG H2'' H 1 2.625 . . 1 . . . . A 22 DG H2'' . 36680 1 206 . 1 . 1 22 22 DG H21 H 1 6.169 . . 1 . . . . A 22 DG H21 . 36680 1 207 . 1 . 1 22 22 DG H22 H 1 9.352 . . 1 . . . . A 22 DG H22 . 36680 1 208 . 1 . 1 22 22 DG H3' H 1 4.96 . . 1 . . . . A 22 DG H3' . 36680 1 209 . 1 . 1 22 22 DG H4' H 1 4.313 . . 1 . . . . A 22 DG H4' . 36680 1 210 . 1 . 1 22 22 DG H5' H 1 4.176 . . 1 . . . . A 22 DG H5' . 36680 1 211 . 1 . 1 22 22 DG H8 H 1 7.477 . . 1 . . . . A 22 DG H8 . 36680 1 212 . 1 . 1 23 23 DG H1 H 1 10.793 . . 1 . . . . A 23 DG H1 . 36680 1 213 . 1 . 1 23 23 DG H1' H 1 6.167 . . 1 . . . . A 23 DG H1' . 36680 1 214 . 1 . 1 23 23 DG H2' H 1 2.635 . . 1 . . . . A 23 DG H2' . 36680 1 215 . 1 . 1 23 23 DG H2'' H 1 2.607 . . 1 . . . . A 23 DG H2'' . 36680 1 216 . 1 . 1 23 23 DG H21 H 1 6.38 . . 1 . . . . A 23 DG H21 . 36680 1 217 . 1 . 1 23 23 DG H3' H 1 4.938 . . 1 . . . . A 23 DG H3' . 36680 1 218 . 1 . 1 23 23 DG H4' H 1 4.107 . . 1 . . . . A 23 DG H4' . 36680 1 219 . 1 . 1 23 23 DG H5' H 1 3.846 . . 1 . . . . A 23 DG H5' . 36680 1 220 . 1 . 1 23 23 DG H5'' H 1 3.995 . . 1 . . . . A 23 DG H5'' . 36680 1 221 . 1 . 1 23 23 DG H8 H 1 7.546 . . 1 . . . . A 23 DG H8 . 36680 1 222 . 1 . 1 24 24 DA H1' H 1 6.385 . . 1 . . . . A 24 DA H1' . 36680 1 223 . 1 . 1 24 24 DA H2 H 1 8.21 . . 1 . . . . A 24 DA H2 . 36680 1 224 . 1 . 1 24 24 DA H2' H 1 2.832 . . 1 . . . . A 24 DA H2' . 36680 1 225 . 1 . 1 24 24 DA H2'' H 1 2.536 . . 1 . . . . A 24 DA H2'' . 36680 1 226 . 1 . 1 24 24 DA H3' H 1 4.156 . . 1 . . . . A 24 DA H3' . 36680 1 227 . 1 . 1 24 24 DA H4' H 1 4.06 . . 1 . . . . A 24 DA H4' . 36680 1 228 . 1 . 1 24 24 DA H5' H 1 3.987 . . 1 . . . . A 24 DA H5' . 36680 1 229 . 1 . 1 24 24 DA H5'' H 1 4.079 . . 1 . . . . A 24 DA H5'' . 36680 1 230 . 1 . 1 24 24 DA H8 H 1 8.334 . . 1 . . . . A 24 DA H8 . 36680 1 stop_ save_