data_36625 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 36625 _Entry.Title ; Solution NMR structure of an antiparallel chair-type G-quadruplex from NOP56 intron ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2023-12-15 _Entry.Accession_date 2023-12-22 _Entry.Last_release_date 2023-12-22 _Entry.Original_release_date 2023-12-22 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.2.0.16 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype 'SOLUTION NMR' _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Z. Yan Z. . . . 36625 2 P. Guo P. . . . 36625 3 D. Han D. . . . 36625 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID 'CC base pair' . 36625 'CGCG tetrad' . 36625 DNA . 36625 pH . 36625 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 36625 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 136 36625 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2025-12-12 . original BMRB . 36625 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 8XGP 'BMRB Entry Tracking System' 36625 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 36625 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 40047221 _Citation.DOI 10.1002/advs.202406230 _Citation.Full_citation . _Citation.Title ; Structural Insights into an Antiparallel Chair-Type G-Quadruplex From the Intron of NOP56 Oncogene. ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'Adv. Sci (Weinh).' _Citation.Journal_name_full 'Advanced science (Weinheim, Baden-Wurttemberg, Germany)' _Citation.Journal_volume 12 _Citation.Journal_issue 16 _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first e2406230 _Citation.Page_last e2406230 _Citation.Year 2025 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Zhenzhen Yan Z. . . . 36625 1 2 Axin He A. . . . 36625 1 3 Liqi Wan L. . . . 36625 1 4 Qian Gao Q. . . . 36625 1 5 Yan Jiang Y. . . . 36625 1 6 Yang Wang Y. . . . 36625 1 7 Ercheng Wang E. . . . 36625 1 8 Changling Li C. . . . 36625 1 9 Yingquan Yang Y. . . . 36625 1 10 Yingjie Li Y. . . . 36625 1 11 Pei Guo P. . . . 36625 1 12 Da Han D. . . . 36625 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 36625 _Assembly.ID 1 _Assembly.Name 'Antiparallel chair-type G-quadruplex from NOP56 intron' _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state 'not present' _Assembly.Molecular_mass 6553.182 _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 entity_1 1 $entity_1 A A yes . . . . . . 36625 1 stop_ loop_ _Chem_comp_assembly.Assembly_chem_comp_ID _Chem_comp_assembly.Entity_assembly_ID _Chem_comp_assembly.Entity_ID _Chem_comp_assembly.Comp_index_ID _Chem_comp_assembly.Comp_ID _Chem_comp_assembly.Seq_ID _Chem_comp_assembly.Auth_entity_assembly_ID _Chem_comp_assembly.Auth_asym_ID _Chem_comp_assembly.Auth_seq_ID _Chem_comp_assembly.Auth_comp_ID _Chem_comp_assembly.Auth_variant_ID _Chem_comp_assembly.Sequence_linking _Chem_comp_assembly.Cis_residue _Chem_comp_assembly.NEF_index _Chem_comp_assembly.Entry_ID _Chem_comp_assembly.Assembly_ID . 1 1 1 DG 1 . A 1 DG . start . . 36625 1 . 1 1 10 DC 10 . A 10 DC . middle . . 36625 1 . 1 1 11 DC 11 . A 11 DC . middle . . 36625 1 . 1 1 12 DT 12 . A 12 DT . middle . . 36625 1 . 1 1 13 DG 13 . A 13 DG . middle . . 36625 1 . 1 1 14 DG 14 . A 14 DG . middle . . 36625 1 . 1 1 15 DG 15 . A 15 DG . middle . . 36625 1 . 1 1 16 DC 16 . A 16 DC . middle . . 36625 1 . 1 1 17 DC 17 . A 17 DC . middle . . 36625 1 . 1 1 18 DT 18 . A 18 DT . middle . . 36625 1 . 1 1 19 DG 19 . A 19 DG . middle . . 36625 1 . 1 1 2 DG 2 . A 2 DG . middle . . 36625 1 . 1 1 20 DG 20 . A 20 DG . middle . . 36625 1 . 1 1 21 DG 21 . A 21 DG . end . . 36625 1 . 1 1 3 DG 3 . A 3 DG . middle . . 36625 1 . 1 1 4 DC 4 . A 4 DC . middle . . 36625 1 . 1 1 5 DC 5 . A 5 DC . middle . . 36625 1 . 1 1 6 DT 6 . A 6 DT . middle . . 36625 1 . 1 1 7 DG 7 . A 7 DG . middle . . 36625 1 . 1 1 8 DG 8 . A 8 DG . middle . . 36625 1 . 1 1 9 DG 9 . A 9 DG . middle . . 36625 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 36625 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name "DNA (5'-D(*GP*GP*GP*CP*CP*TP*GP*GP*GP*CP*CP*TP*GP*GP*GP*CP*CP*TP*GP*GP*G)-3')" _Entity.Type polymer _Entity.Polymer_common_type DNA _Entity.Polymer_type polydeoxyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGGCCTGGGCCTGGGCCTGG G ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 21 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 6553.182 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 1 DG . 36625 1 2 2 DG . 36625 1 3 3 DG . 36625 1 4 4 DC . 36625 1 5 5 DC . 36625 1 6 6 DT . 36625 1 7 7 DG . 36625 1 8 8 DG . 36625 1 9 9 DG . 36625 1 10 10 DC . 36625 1 11 11 DC . 36625 1 12 12 DT . 36625 1 13 13 DG . 36625 1 14 14 DG . 36625 1 15 15 DG . 36625 1 16 16 DC . 36625 1 17 17 DC . 36625 1 18 18 DT . 36625 1 19 19 DG . 36625 1 20 20 DG . 36625 1 21 21 DG . 36625 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . DG 1 1 36625 1 . DG 2 2 36625 1 . DG 3 3 36625 1 . DC 4 4 36625 1 . DC 5 5 36625 1 . DT 6 6 36625 1 . DG 7 7 36625 1 . DG 8 8 36625 1 . DG 9 9 36625 1 . DC 10 10 36625 1 . DC 11 11 36625 1 . DT 12 12 36625 1 . DG 13 13 36625 1 . DG 14 14 36625 1 . DG 15 15 36625 1 . DC 16 16 36625 1 . DC 17 17 36625 1 . DT 18 18 36625 1 . DG 19 19 36625 1 . DG 20 20 36625 1 . DG 21 21 36625 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 36625 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 9606 organism . 'Homo sapiens' Human . . Eukaryota Metazoa Homo sapiens . . . . . . . . . . . . . 36625 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 36625 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' unidentified . . . . . . . . . . . . . . . 36625 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 36625 _Sample.ID 1 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details ; 0.5 mM DNA (5'-D(*GP*GP*GP*CP*CP*TP*GP*GP*GP*CP*CP*TP*GP*GP*GP*CP*CP*TP*GP*GP*G)-3'), 1 mM sodium phosphate, 0.02 mM DSS, 99.96%D2O ; _Sample.Aggregate_sample_number . _Sample.Solvent_system 99.96%D2O _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 "DNA (5'-D(*GP*GP*GP*CP*CP*TP*GP*GP*GP*CP*CP*TP*GP*GP*GP*CP*CP*TP*GP*GP*G)-3')" 'natural abundance' 1 $assembly 1 $entity_1 . DNA 0.5 . . mM . . . . 36625 1 2 'sodium phosphate' 'natural abundance' . . . . . buffer 1 . . mM . . . . 36625 1 3 DSS 'natural abundance' . . . . . 'internal reference' 0.02 . . mM . . . . 36625 1 4 D2O [U-2H] . . . . . solvent 99.96 . . % . . . . 36625 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 36625 _Sample_condition_list.ID 1 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 1 . mM 36625 1 pH 5.0 . pH 36625 1 pressure 1 . atm 36625 1 temperature 298 . K 36625 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 36625 _Software.ID 1 _Software.Type . _Software.Name TopSpin _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Bruker Biospin' . . 36625 1 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 36625 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 36625 _Software.ID 2 _Software.Type . _Software.Name Amber _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman' . . 36625 2 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'structure calculation' . 36625 2 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 36625 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model AVANCE _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_NMR_spectrometer_list_1 _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list_1 _NMR_spectrometer_list.Entry_ID 36625 _NMR_spectrometer_list.ID 1 _NMR_spectrometer_list.Name . loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Bruker AVANCE . 600 . . . 36625 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 36625 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' . . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36625 1 2 '2D 1H-1H COSY' . . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36625 1 3 '2D 1H-1H TOCSY' . . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36625 1 4 '2D 1H-13C HSQC' . . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36625 1 5 '2D 1H-15N HSQC' . . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36625 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 36625 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name . _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0.000 internal direct 1.0 . . . . . 36625 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 36625 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' 1 $sample_1 isotropic 36625 1 2 '2D 1H-1H COSY' 1 $sample_1 isotropic 36625 1 3 '2D 1H-1H TOCSY' 1 $sample_1 isotropic 36625 1 4 '2D 1H-13C HSQC' 1 $sample_1 isotropic 36625 1 5 '2D 1H-15N HSQC' 1 $sample_1 isotropic 36625 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 DG H1' H 1 5.88 0.02 . 1 . . . . A 1 DG H1' . 36625 1 2 . 1 . 1 1 1 DG H2' H 1 2.51 0.02 . 1 . . . . A 1 DG H2' . 36625 1 3 . 1 . 1 1 1 DG H2'' H 1 2.78 0.02 . 1 . . . . A 1 DG H2'' . 36625 1 4 . 1 . 1 1 1 DG H3' H 1 4.86 0.02 . 1 . . . . A 1 DG H3' . 36625 1 5 . 1 . 1 1 1 DG H8 H 1 7.62 0.02 . 1 . . . . A 1 DG H8 . 36625 1 6 . 1 . 1 2 2 DG H1 H 1 11.48 0.02 . 1 . . . . A 2 DG H1 . 36625 1 7 . 1 . 1 2 2 DG H1' H 1 5.98 0.02 . 1 . . . . A 2 DG H1' . 36625 1 8 . 1 . 1 2 2 DG H2' H 1 3.33 0.02 . 1 . . . . A 2 DG H2' . 36625 1 9 . 1 . 1 2 2 DG H2'' H 1 2.84 0.02 . 1 . . . . A 2 DG H2'' . 36625 1 10 . 1 . 1 2 2 DG H3' H 1 4.96 0.02 . 1 . . . . A 2 DG H3' . 36625 1 11 . 1 . 1 2 2 DG H8 H 1 7.47 0.02 . 1 . . . . A 2 DG H8 . 36625 1 12 . 1 . 1 3 3 DG H1 H 1 12.13 0.02 . 1 . . . . A 3 DG H1 . 36625 1 13 . 1 . 1 3 3 DG H1' H 1 5.73 0.02 . 1 . . . . A 3 DG H1' . 36625 1 14 . 1 . 1 3 3 DG H2' H 1 2.73 0.02 . 1 . . . . A 3 DG H2' . 36625 1 15 . 1 . 1 3 3 DG H2'' H 1 2.59 0.02 . 1 . . . . A 3 DG H2'' . 36625 1 16 . 1 . 1 3 3 DG H3' H 1 5.04 0.02 . 1 . . . . A 3 DG H3' . 36625 1 17 . 1 . 1 3 3 DG H8 H 1 8.13 0.02 . 1 . . . . A 3 DG H8 . 36625 1 18 . 1 . 1 4 4 DC H1' H 1 6.09 0.02 . 1 . . . . A 4 DC H1' . 36625 1 19 . 1 . 1 4 4 DC H2' H 1 2.57 0.02 . 1 . . . . A 4 DC H2' . 36625 1 20 . 1 . 1 4 4 DC H2'' H 1 2.57 0.02 . 1 . . . . A 4 DC H2'' . 36625 1 21 . 1 . 1 4 4 DC H3' H 1 4.36 0.02 . 1 . . . . A 4 DC H3' . 36625 1 22 . 1 . 1 4 4 DC H5 H 1 5.08 0.02 . 1 . . . . A 4 DC H5 . 36625 1 23 . 1 . 1 4 4 DC H6 H 1 7.33 0.02 . 1 . . . . A 4 DC H6 . 36625 1 24 . 1 . 1 4 4 DC H41 H 1 9.31 0.02 . 1 . . . . A 4 DC H41 . 36625 1 25 . 1 . 1 4 4 DC H42 H 1 8.49 0.02 . 1 . . . . A 4 DC H42 . 36625 1 26 . 1 . 1 5 5 DC H1' H 1 5.38 0.02 . 1 . . . . A 5 DC H1' . 36625 1 27 . 1 . 1 5 5 DC H2' H 1 1.3 0.02 . 1 . . . . A 5 DC H2' . 36625 1 28 . 1 . 1 5 5 DC H2'' H 1 2.36 0.02 . 1 . . . . A 5 DC H2'' . 36625 1 29 . 1 . 1 5 5 DC H3' H 1 4.47 0.02 . 1 . . . . A 5 DC H3' . 36625 1 30 . 1 . 1 5 5 DC H5 H 1 5.5 0.02 . 1 . . . . A 5 DC H5 . 36625 1 31 . 1 . 1 5 5 DC H6 H 1 7.21 0.02 . 1 . . . . A 5 DC H6 . 36625 1 32 . 1 . 1 5 5 DC H41 H 1 8.61 0.02 . 1 . . . . A 5 DC H41 . 36625 1 33 . 1 . 1 5 5 DC H42 H 1 7.58 0.02 . 1 . . . . A 5 DC H42 . 36625 1 34 . 1 . 1 6 6 DT H1' H 1 6.06 0.02 . 1 . . . . A 6 DT H1' . 36625 1 35 . 1 . 1 6 6 DT H2' H 1 2.12 0.02 . 1 . . . . A 6 DT H2' . 36625 1 36 . 1 . 1 6 6 DT H2'' H 1 2.29 0.02 . 1 . . . . A 6 DT H2'' . 36625 1 37 . 1 . 1 6 6 DT H3' H 1 4.73 0.02 . 1 . . . . A 6 DT H3' . 36625 1 38 . 1 . 1 6 6 DT H6 H 1 7.4 0.02 . 1 . . . . A 6 DT H6 . 36625 1 39 . 1 . 1 6 6 DT H71 H 1 1.53 0.02 . 1 . . . . A 6 DT H71 . 36625 1 40 . 1 . 1 6 6 DT H72 H 1 1.53 0.02 . 1 . . . . A 6 DT H72 . 36625 1 41 . 1 . 1 6 6 DT H73 H 1 1.53 0.02 . 1 . . . . A 6 DT H73 . 36625 1 42 . 1 . 1 7 7 DG H1 H 1 13.01 0.02 . 1 . . . . A 7 DG H1 . 36625 1 43 . 1 . 1 7 7 DG H1' H 1 6.24 0.02 . 1 . . . . A 7 DG H1' . 36625 1 44 . 1 . 1 7 7 DG H2' H 1 2.6 0.02 . 1 . . . . A 7 DG H2' . 36625 1 45 . 1 . 1 7 7 DG H2'' H 1 2.9 0.02 . 1 . . . . A 7 DG H2'' . 36625 1 46 . 1 . 1 7 7 DG H3' H 1 4.82 0.02 . 1 . . . . A 7 DG H3' . 36625 1 47 . 1 . 1 7 7 DG H4' H 1 4.48 0.02 . 1 . . . . A 7 DG H4' . 36625 1 48 . 1 . 1 7 7 DG H8 H 1 7.92 0.02 . 1 . . . . A 7 DG H8 . 36625 1 49 . 1 . 1 8 8 DG H1 H 1 11.42 0.02 . 1 . . . . A 8 DG H1 . 36625 1 50 . 1 . 1 8 8 DG H1' H 1 5.94 0.02 . 1 . . . . A 8 DG H1' . 36625 1 51 . 1 . 1 8 8 DG H2' H 1 3.21 0.02 . 1 . . . . A 8 DG H2' . 36625 1 52 . 1 . 1 8 8 DG H2'' H 1 2.74 0.02 . 1 . . . . A 8 DG H2'' . 36625 1 53 . 1 . 1 8 8 DG H3' H 1 5.02 0.02 . 1 . . . . A 8 DG H3' . 36625 1 54 . 1 . 1 8 8 DG H8 H 1 7.34 0.02 . 1 . . . . A 8 DG H8 . 36625 1 55 . 1 . 1 9 9 DG H1 H 1 12.02 0.02 . 1 . . . . A 9 DG H1 . 36625 1 56 . 1 . 1 9 9 DG H1' H 1 5.88 0.02 . 1 . . . . A 9 DG H1' . 36625 1 57 . 1 . 1 9 9 DG H2' H 1 2.51 0.02 . 1 . . . . A 9 DG H2' . 36625 1 58 . 1 . 1 9 9 DG H2'' H 1 2.78 0.02 . 1 . . . . A 9 DG H2'' . 36625 1 59 . 1 . 1 9 9 DG H3' H 1 4.86 0.02 . 1 . . . . A 9 DG H3' . 36625 1 60 . 1 . 1 9 9 DG H8 H 1 7.62 0.02 . 1 . . . . A 9 DG H8 . 36625 1 61 . 1 . 1 10 10 DC H1' H 1 6.27 0.02 . 1 . . . . A 10 DC H1' . 36625 1 62 . 1 . 1 10 10 DC H2' H 1 2.71 0.02 . 1 . . . . A 10 DC H2' . 36625 1 63 . 1 . 1 10 10 DC H2'' H 1 2.4 0.02 . 1 . . . . A 10 DC H2'' . 36625 1 64 . 1 . 1 10 10 DC H3' H 1 4.95 0.02 . 1 . . . . A 10 DC H3' . 36625 1 65 . 1 . 1 10 10 DC H5 H 1 6.13 0.02 . 1 . . . . A 10 DC H5 . 36625 1 66 . 1 . 1 10 10 DC H6 H 1 7.99 0.02 . 1 . . . . A 10 DC H6 . 36625 1 67 . 1 . 1 11 11 DC H1' H 1 6.06 0.02 . 1 . . . . A 11 DC H1' . 36625 1 68 . 1 . 1 11 11 DC H2' H 1 2.14 0.02 . 1 . . . . A 11 DC H2' . 36625 1 69 . 1 . 1 11 11 DC H2'' H 1 2.37 0.02 . 1 . . . . A 11 DC H2'' . 36625 1 70 . 1 . 1 11 11 DC H3' H 1 4.5 0.02 . 1 . . . . A 11 DC H3' . 36625 1 71 . 1 . 1 11 11 DC H5 H 1 6.15 0.02 . 1 . . . . A 11 DC H5 . 36625 1 72 . 1 . 1 11 11 DC H6 H 1 7.76 0.02 . 1 . . . . A 11 DC H6 . 36625 1 73 . 1 . 1 12 12 DT H1' H 1 5.85 0.02 . 1 . . . . A 12 DT H1' . 36625 1 74 . 1 . 1 12 12 DT H2' H 1 1.76 0.02 . 1 . . . . A 12 DT H2' . 36625 1 75 . 1 . 1 12 12 DT H2'' H 1 1.67 0.02 . 1 . . . . A 12 DT H2'' . 36625 1 76 . 1 . 1 12 12 DT H3' H 1 4.49 0.02 . 1 . . . . A 12 DT H3' . 36625 1 77 . 1 . 1 12 12 DT H6 H 1 7.11 0.02 . 1 . . . . A 12 DT H6 . 36625 1 78 . 1 . 1 12 12 DT H71 H 1 1.43 0.02 . 1 . . . . A 12 DT H71 . 36625 1 79 . 1 . 1 12 12 DT H72 H 1 1.43 0.02 . 1 . . . . A 12 DT H72 . 36625 1 80 . 1 . 1 12 12 DT H73 H 1 1.43 0.02 . 1 . . . . A 12 DT H73 . 36625 1 81 . 1 . 1 14 14 DG H1 H 1 11.67 0.02 . 1 . . . . A 14 DG H1 . 36625 1 82 . 1 . 1 14 14 DG H1' H 1 6.01 0.02 . 1 . . . . A 14 DG H1' . 36625 1 83 . 1 . 1 14 14 DG H2' H 1 3.45 0.02 . 1 . . . . A 14 DG H2' . 36625 1 84 . 1 . 1 14 14 DG H2'' H 1 2.82 0.02 . 1 . . . . A 14 DG H2'' . 36625 1 85 . 1 . 1 14 14 DG H3' H 1 4.92 0.02 . 1 . . . . A 14 DG H3' . 36625 1 86 . 1 . 1 14 14 DG H8 H 1 7.38 0.02 . 1 . . . . A 14 DG H8 . 36625 1 87 . 1 . 1 15 15 DG H1 H 1 12.21 0.02 . 1 . . . . A 15 DG H1 . 36625 1 88 . 1 . 1 15 15 DG H1' H 1 5.79 0.02 . 1 . . . . A 15 DG H1' . 36625 1 89 . 1 . 1 15 15 DG H2' H 1 2.78 0.02 . 1 . . . . A 15 DG H2' . 36625 1 90 . 1 . 1 15 15 DG H2'' H 1 2.65 0.02 . 1 . . . . A 15 DG H2'' . 36625 1 91 . 1 . 1 15 15 DG H3' H 1 5.06 0.02 . 1 . . . . A 15 DG H3' . 36625 1 92 . 1 . 1 15 15 DG H8 H 1 8.17 0.02 . 1 . . . . A 15 DG H8 . 36625 1 93 . 1 . 1 16 16 DC H1' H 1 6.12 0.02 . 1 . . . . A 16 DC H1' . 36625 1 94 . 1 . 1 16 16 DC H2' H 1 2.55 0.02 . 1 . . . . A 16 DC H2' . 36625 1 95 . 1 . 1 16 16 DC H2'' H 1 2.55 0.02 . 1 . . . . A 16 DC H2'' . 36625 1 96 . 1 . 1 16 16 DC H3' H 1 4.44 0.02 . 1 . . . . A 16 DC H3' . 36625 1 97 . 1 . 1 16 16 DC H5 H 1 5.1 0.02 . 1 . . . . A 16 DC H5 . 36625 1 98 . 1 . 1 16 16 DC H6 H 1 7.34 0.02 . 1 . . . . A 16 DC H6 . 36625 1 99 . 1 . 1 16 16 DC H41 H 1 9.5 0.02 . 1 . . . . A 16 DC H41 . 36625 1 100 . 1 . 1 16 16 DC H42 H 1 8.53 0.02 . 1 . . . . A 16 DC H42 . 36625 1 101 . 1 . 1 17 17 DC H1' H 1 5.43 0.02 . 1 . . . . A 17 DC H1' . 36625 1 102 . 1 . 1 17 17 DC H2' H 1 1.3 0.02 . 1 . . . . A 17 DC H2' . 36625 1 103 . 1 . 1 17 17 DC H2'' H 1 2.36 0.02 . 1 . . . . A 17 DC H2'' . 36625 1 104 . 1 . 1 17 17 DC H3' H 1 4.47 0.02 . 1 . . . . A 17 DC H3' . 36625 1 105 . 1 . 1 17 17 DC H5 H 1 5.52 0.02 . 1 . . . . A 17 DC H5 . 36625 1 106 . 1 . 1 17 17 DC H6 H 1 7.2 0.02 . 1 . . . . A 17 DC H6 . 36625 1 107 . 1 . 1 17 17 DC H41 H 1 8.61 0.02 . 1 . . . . A 17 DC H41 . 36625 1 108 . 1 . 1 17 17 DC H42 H 1 7.58 0.02 . 1 . . . . A 17 DC H42 . 36625 1 109 . 1 . 1 18 18 DT H1' H 1 6.02 0.02 . 1 . . . . A 18 DT H1' . 36625 1 110 . 1 . 1 18 18 DT H2' H 1 2.11 0.02 . 1 . . . . A 18 DT H2' . 36625 1 111 . 1 . 1 18 18 DT H2'' H 1 2.27 0.02 . 1 . . . . A 18 DT H2'' . 36625 1 112 . 1 . 1 18 18 DT H3' H 1 4.72 0.02 . 1 . . . . A 18 DT H3' . 36625 1 113 . 1 . 1 18 18 DT H6 H 1 7.34 0.02 . 1 . . . . A 18 DT H6 . 36625 1 114 . 1 . 1 18 18 DT H71 H 1 1.5 0.02 . 1 . . . . A 18 DT H71 . 36625 1 115 . 1 . 1 18 18 DT H72 H 1 1.5 0.02 . 1 . . . . A 18 DT H72 . 36625 1 116 . 1 . 1 18 18 DT H73 H 1 1.5 0.02 . 1 . . . . A 18 DT H73 . 36625 1 117 . 1 . 1 19 19 DG H1 H 1 13.07 0.02 . 1 . . . . A 19 DG H1 . 36625 1 118 . 1 . 1 19 19 DG H1' H 1 6.2 0.02 . 1 . . . . A 19 DG H1' . 36625 1 119 . 1 . 1 19 19 DG H2' H 1 2.6 0.02 . 1 . . . . A 19 DG H2' . 36625 1 120 . 1 . 1 19 19 DG H2'' H 1 2.91 0.02 . 1 . . . . A 19 DG H2'' . 36625 1 121 . 1 . 1 19 19 DG H3' H 1 4.82 0.02 . 1 . . . . A 19 DG H3' . 36625 1 122 . 1 . 1 19 19 DG H4' H 1 4.48 0.02 . 1 . . . . A 19 DG H4' . 36625 1 123 . 1 . 1 19 19 DG H8 H 1 7.91 0.02 . 1 . . . . A 19 DG H8 . 36625 1 124 . 1 . 1 20 20 DG H1 H 1 11.28 0.02 . 1 . . . . A 20 DG H1 . 36625 1 125 . 1 . 1 20 20 DG H1' H 1 5.91 0.02 . 1 . . . . A 20 DG H1' . 36625 1 126 . 1 . 1 20 20 DG H2' H 1 3.21 0.02 . 1 . . . . A 20 DG H2' . 36625 1 127 . 1 . 1 20 20 DG H2'' H 1 2.74 0.02 . 1 . . . . A 20 DG H2'' . 36625 1 128 . 1 . 1 20 20 DG H3' H 1 5.02 0.02 . 1 . . . . A 20 DG H3' . 36625 1 129 . 1 . 1 20 20 DG H8 H 1 7.33 0.02 . 1 . . . . A 20 DG H8 . 36625 1 130 . 1 . 1 21 21 DG H1 H 1 11.91 0.02 . 1 . . . . A 21 DG H1 . 36625 1 131 . 1 . 1 21 21 DG H1' H 1 6.14 0.02 . 1 . . . . A 21 DG H1' . 36625 1 132 . 1 . 1 21 21 DG H2' H 1 2.67 0.02 . 1 . . . . A 21 DG H2' . 36625 1 133 . 1 . 1 21 21 DG H2'' H 1 2.51 0.02 . 1 . . . . A 21 DG H2'' . 36625 1 134 . 1 . 1 21 21 DG H3' H 1 4.77 0.02 . 1 . . . . A 21 DG H3' . 36625 1 135 . 1 . 1 21 21 DG H4' H 1 4.26 0.02 . 1 . . . . A 21 DG H4' . 36625 1 136 . 1 . 1 21 21 DG H8 H 1 7.93 0.02 . 1 . . . . A 21 DG H8 . 36625 1 stop_ save_