data_30868 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 30868 _Entry.Title ; Solution structure of the HIV-1 PBS-segment ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2021-02-24 _Entry.Accession_date 2021-02-24 _Entry.Last_release_date 2021-03-10 _Entry.Original_release_date 2021-03-10 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype 'SOLUTION NMR' _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 X. Heng X. . . . 30868 2 Z. Song Z. . . . 30868 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID 'Primer binding site' . 30868 RNA . 30868 'reverse transcription' . 30868 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 30868 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 474 30868 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 2 . . 2021-09-21 2021-02-24 update BMRB 'update entry citation' 30868 1 . . 2021-03-12 2021-02-24 original author 'original release' 30868 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 7LVA 'BMRB Entry Tracking System' 30868 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 30868 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 33978756 _Citation.DOI . _Citation.Full_citation . _Citation.Title ; The three-way junction structure of the HIV-1 PBS-segment binds host enzyme important for viral infectivity ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'Nucleic Acids Res.' _Citation.Journal_name_full 'Nucleic acids research' _Citation.Journal_volume 49 _Citation.Journal_issue 10 _Citation.Journal_ASTM . _Citation.Journal_ISSN 1362-4962 _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 5925 _Citation.Page_last 5942 _Citation.Year 2021 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Zhenwei Song Z. . . . 30868 1 2 Thomas Gremminger T. . . . 30868 1 3 Gatikrushna Singh G. . . . 30868 1 4 Yi Cheng Y. . . . 30868 1 5 Jun Li J. . . . 30868 1 6 Liming Qiu L. . . . 30868 1 7 Juan Ji J. . . . 30868 1 8 Margaret Lange M. J. . . 30868 1 9 Xiaobing Zuo X. . . . 30868 1 10 Shi-Jie Chen S. J. . . 30868 1 11 Xiaoqin Zou X. . . . 30868 1 12 Kathleen Boris-Lawrie K. . . . 30868 1 13 Xiao Heng X. . . . 30868 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 30868 _Assembly.ID 1 _Assembly.Name 'RNA (103-MER)' _Assembly.BMRB_code . _Assembly.Number_of_components . _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 unit_1 1 $entity_1 A A yes . . . . . . 30868 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 30868 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGCUCUGGUAACUAGAGAUC CCUCAGACCCUUUUAGUCAG UGUGGAAAAUCUCUAGCAGU GGCGCCCGAACAGGGACUUG AAAGCGAAAGUAAAGCCAGA GCC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 103 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 33249.836 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 123 G . 30868 1 2 124 G . 30868 1 3 125 C . 30868 1 4 126 U . 30868 1 5 127 C . 30868 1 6 128 U . 30868 1 7 129 G . 30868 1 8 130 G . 30868 1 9 131 U . 30868 1 10 132 A . 30868 1 11 133 A . 30868 1 12 134 C . 30868 1 13 135 U . 30868 1 14 136 A . 30868 1 15 137 G . 30868 1 16 138 A . 30868 1 17 139 G . 30868 1 18 140 A . 30868 1 19 141 U . 30868 1 20 142 C . 30868 1 21 143 C . 30868 1 22 144 C . 30868 1 23 145 U . 30868 1 24 146 C . 30868 1 25 147 A . 30868 1 26 148 G . 30868 1 27 149 A . 30868 1 28 150 C . 30868 1 29 151 C . 30868 1 30 152 C . 30868 1 31 153 U . 30868 1 32 154 U . 30868 1 33 155 U . 30868 1 34 156 U . 30868 1 35 157 A . 30868 1 36 158 G . 30868 1 37 159 U . 30868 1 38 160 C . 30868 1 39 161 A . 30868 1 40 162 G . 30868 1 41 163 U . 30868 1 42 164 G . 30868 1 43 165 U . 30868 1 44 166 G . 30868 1 45 167 G . 30868 1 46 168 A . 30868 1 47 169 A . 30868 1 48 170 A . 30868 1 49 171 A . 30868 1 50 172 U . 30868 1 51 173 C . 30868 1 52 174 U . 30868 1 53 175 C . 30868 1 54 176 U . 30868 1 55 177 A . 30868 1 56 178 G . 30868 1 57 179 C . 30868 1 58 180 A . 30868 1 59 181 G . 30868 1 60 182 U . 30868 1 61 183 G . 30868 1 62 184 G . 30868 1 63 185 C . 30868 1 64 186 G . 30868 1 65 187 C . 30868 1 66 188 C . 30868 1 67 189 C . 30868 1 68 190 G . 30868 1 69 191 A . 30868 1 70 192 A . 30868 1 71 193 C . 30868 1 72 194 A . 30868 1 73 195 G . 30868 1 74 196 G . 30868 1 75 197 G . 30868 1 76 198 A . 30868 1 77 199 C . 30868 1 78 200 U . 30868 1 79 201 U . 30868 1 80 202 G . 30868 1 81 203 A . 30868 1 82 204 A . 30868 1 83 205 A . 30868 1 84 206 G . 30868 1 85 207 C . 30868 1 86 208 G . 30868 1 87 209 A . 30868 1 88 210 A . 30868 1 89 211 A . 30868 1 90 212 G . 30868 1 91 213 U . 30868 1 92 214 A . 30868 1 93 215 A . 30868 1 94 216 A . 30868 1 95 217 G . 30868 1 96 218 C . 30868 1 97 219 C . 30868 1 98 220 A . 30868 1 99 221 G . 30868 1 100 222 A . 30868 1 101 223 G . 30868 1 102 224 C . 30868 1 103 225 C . 30868 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 30868 1 . G 2 2 30868 1 . C 3 3 30868 1 . U 4 4 30868 1 . C 5 5 30868 1 . U 6 6 30868 1 . G 7 7 30868 1 . G 8 8 30868 1 . U 9 9 30868 1 . A 10 10 30868 1 . A 11 11 30868 1 . C 12 12 30868 1 . U 13 13 30868 1 . A 14 14 30868 1 . G 15 15 30868 1 . A 16 16 30868 1 . G 17 17 30868 1 . A 18 18 30868 1 . U 19 19 30868 1 . C 20 20 30868 1 . C 21 21 30868 1 . C 22 22 30868 1 . U 23 23 30868 1 . C 24 24 30868 1 . A 25 25 30868 1 . G 26 26 30868 1 . A 27 27 30868 1 . C 28 28 30868 1 . C 29 29 30868 1 . C 30 30 30868 1 . U 31 31 30868 1 . U 32 32 30868 1 . U 33 33 30868 1 . U 34 34 30868 1 . A 35 35 30868 1 . G 36 36 30868 1 . U 37 37 30868 1 . C 38 38 30868 1 . A 39 39 30868 1 . G 40 40 30868 1 . U 41 41 30868 1 . G 42 42 30868 1 . U 43 43 30868 1 . G 44 44 30868 1 . G 45 45 30868 1 . A 46 46 30868 1 . A 47 47 30868 1 . A 48 48 30868 1 . A 49 49 30868 1 . U 50 50 30868 1 . C 51 51 30868 1 . U 52 52 30868 1 . C 53 53 30868 1 . U 54 54 30868 1 . A 55 55 30868 1 . G 56 56 30868 1 . C 57 57 30868 1 . A 58 58 30868 1 . G 59 59 30868 1 . U 60 60 30868 1 . G 61 61 30868 1 . G 62 62 30868 1 . C 63 63 30868 1 . G 64 64 30868 1 . C 65 65 30868 1 . C 66 66 30868 1 . C 67 67 30868 1 . G 68 68 30868 1 . A 69 69 30868 1 . A 70 70 30868 1 . C 71 71 30868 1 . A 72 72 30868 1 . G 73 73 30868 1 . G 74 74 30868 1 . G 75 75 30868 1 . A 76 76 30868 1 . C 77 77 30868 1 . U 78 78 30868 1 . U 79 79 30868 1 . G 80 80 30868 1 . A 81 81 30868 1 . A 82 82 30868 1 . A 83 83 30868 1 . G 84 84 30868 1 . C 85 85 30868 1 . G 86 86 30868 1 . A 87 87 30868 1 . A 88 88 30868 1 . A 89 89 30868 1 . G 90 90 30868 1 . U 91 91 30868 1 . A 92 92 30868 1 . A 93 93 30868 1 . A 94 94 30868 1 . G 95 95 30868 1 . C 96 96 30868 1 . C 97 97 30868 1 . A 98 98 30868 1 . G 99 99 30868 1 . A 100 100 30868 1 . G 101 101 30868 1 . C 102 102 30868 1 . C 103 103 30868 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 30868 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 11676 organism . 'Human immunodeficiency virus 1' HIV-1 . . Viruses . Lentivirus HIV-1 . . . . . . . . . . . . . 30868 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 30868 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' . . . . . . . . . . . . . . . . 30868 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 30868 _Sample.ID 1 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '250 uM 1H RNA (103-MER), 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (103-MER)' 1H 1 $assembly 1 $entity_1 . . 250 . . uM . . . . 30868 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 30868 _Sample.ID 2 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '250 uM A-8D, C-D, G-H, U-5,6-D2 RNA (103-MER), 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (103-MER)' '[A-8D, C-D, G-H, U-5,6-D2]' 1 $assembly 1 $entity_1 . . 250 . . uM . . . . 30868 2 stop_ save_ save_sample_3 _Sample.Sf_category sample _Sample.Sf_framecode sample_3 _Sample.Entry_ID 30868 _Sample.ID 3 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '250 uM A-8D, C-D, G-8D, U-H RNA (103-MER), 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (103-MER)' '[A-8D, C-D, G-8D, U-H]' 1 $assembly 1 $entity_1 . . 250 . . uM . . . . 30868 3 stop_ save_ save_sample_4 _Sample.Sf_category sample _Sample.Sf_framecode sample_4 _Sample.Entry_ID 30868 _Sample.ID 4 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '250 uM A-8D, C-5,6-D2, G-D, U-5,6-D2 RNA (103-MER), 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (103-MER)' '[A-8D, C-5,6-D2, G-D, U-5,6-D2]' 1 $assembly 1 $entity_1 . . 250 . . uM . . . . 30868 4 stop_ save_ save_sample_5 _Sample.Sf_category sample _Sample.Sf_framecode sample_5 _Sample.Entry_ID 30868 _Sample.ID 5 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '250 uM A-8D, C-D, G-8D, U-D RNA (103-MER), 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (103-MER)' '[A-8D, C-D, G-8D, U-D]' 1 $assembly 1 $entity_1 . . 250 . . uM . . . . 30868 5 stop_ save_ save_sample_6 _Sample.Sf_category sample _Sample.Sf_framecode sample_6 _Sample.Entry_ID 30868 _Sample.ID 6 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '250 uM A-H, C-D, G-H, U-D RNA (103-MER), 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (103-MER)' '[A-H, C-D, G-H, U-D]' 1 $assembly 1 $entity_1 . . 250 . . uM . . . . 30868 6 stop_ save_ save_sample_7 _Sample.Sf_category sample _Sample.Sf_framecode sample_7 _Sample.Entry_ID 30868 _Sample.ID 7 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '250 uM A-H, C-H, G-D, U-D RNA (103-MER), 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (103-MER)' '[A-H, C-H, G-D, U-D]' 1 $assembly 1 $entity_1 . . 250 . . uM . . . . 30868 7 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 30868 _Sample_condition_list.ID 1 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 3 . mM 30868 1 pH 7.5 . pD 30868 1 pressure 1 . atm 30868 1 temperature 308 . K 30868 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 30868 _Software.ID 1 _Software.Type . _Software.Name NMRPipe _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' . . 30868 1 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID processing . 30868 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 30868 _Software.ID 2 _Software.Type . _Software.Name NMRDraw _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' . . 30868 2 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID processing . 30868 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 30868 _Software.ID 3 _Software.Type . _Software.Name NMRView _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Johnson, One Moon Scientific' . . 30868 3 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 30868 3 'peak picking' . 30868 3 stop_ save_ save_software_4 _Software.Sf_category software _Software.Sf_framecode software_4 _Software.Entry_ID 30868 _Software.ID 4 _Software.Type . _Software.Name CYANA _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Guntert, Mumenthaler and Wuthrich' . . 30868 4 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'geometry optimization' . 30868 4 'structure calculation' . 30868 4 stop_ save_ save_software_5 _Software.Sf_category software _Software.Sf_framecode software_5 _Software.Entry_ID 30868 _Software.ID 5 _Software.Type . _Software.Name Amber _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, and Kollman' . . 30868 5 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID refinement . 30868 5 stop_ save_ save_software_6 _Software.Sf_category software _Software.Sf_framecode software_6 _Software.Entry_ID 30868 _Software.ID 6 _Software.Type . _Software.Name 'X-PLOR NIH' _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 30868 6 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID refinement . 30868 6 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 30868 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model AVANCE _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 800 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 30868 _NMR_spectrometer_list.ID 1 _NMR_spectrometer_list.Name . loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Bruker AVANCE . 800 . . . 30868 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 30868 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 30868 1 2 '2D 1H-1H NOESY' no . . . . . . . . . . . . 2 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 30868 1 3 '2D 1H-1H NOESY' no . . . . . . . . . . . . 3 $sample_3 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 30868 1 4 '2D 1H-1H NOESY' no . . . . . . . . . . . . 4 $sample_4 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 30868 1 5 '2D 1H-1H NOESY' no . . . . . . . . . . . . 5 $sample_5 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 30868 1 6 '2D 1H-1H NOESY' no . . . . . . . . . . . . 6 $sample_6 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 30868 1 7 '2D 1H-1H NOESY' no . . . . . . . . . . . . 7 $sample_7 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 30868 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 30868 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name . _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0 external indirect 1.0 . . . . . 30868 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 30868 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 30868 1 2 '2D 1H-1H NOESY' . . . 30868 1 3 '2D 1H-1H NOESY' . . . 30868 1 4 '2D 1H-1H NOESY' . . . 30868 1 5 '2D 1H-1H NOESY' . . . 30868 1 6 '2D 1H-1H NOESY' . . . 30868 1 7 '2D 1H-1H NOESY' . . . 30868 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 G H1' H 1 5.8712 0.0000 . 1 . . . . A 123 G H1' . 30868 1 2 . 1 . 1 1 1 G H2' H 1 4.8941 0.0000 . 1 . . . . A 123 G H2' . 30868 1 3 . 1 . 1 1 1 G H3' H 1 4.6687 0.0000 . 1 . . . . A 123 G H3' . 30868 1 4 . 1 . 1 1 1 G H8 H 1 8.1310 0.0000 . 1 . . . . A 123 G H8 . 30868 1 5 . 1 . 1 2 2 G H1' H 1 5.8795 0.0000 . 1 . . . . A 124 G H1' . 30868 1 6 . 1 . 1 2 2 G H2' H 1 4.5969 0.0000 . 1 . . . . A 124 G H2' . 30868 1 7 . 1 . 1 2 2 G H3' H 1 4.5260 0.0000 . 1 . . . . A 124 G H3' . 30868 1 8 . 1 . 1 2 2 G H8 H 1 7.4843 0.0000 . 1 . . . . A 124 G H8 . 30868 1 9 . 1 . 1 3 3 C H1' H 1 5.5505 0.0000 . 1 . . . . A 125 C H1' . 30868 1 10 . 1 . 1 3 3 C H2' H 1 4.3041 0.0000 . 1 . . . . A 125 C H2' . 30868 1 11 . 1 . 1 3 3 C H3' H 1 4.3911 0.0000 . 1 . . . . A 125 C H3' . 30868 1 12 . 1 . 1 3 3 C H5 H 1 5.2844 0.0000 . 1 . . . . A 125 C H5 . 30868 1 13 . 1 . 1 3 3 C H6 H 1 7.5874 0.0000 . 1 . . . . A 125 C H6 . 30868 1 14 . 1 . 1 4 4 U H1' H 1 5.5752 0.0000 . 1 . . . . A 126 U H1' . 30868 1 15 . 1 . 1 4 4 U H2' H 1 4.5341 0.0000 . 1 . . . . A 126 U H2' . 30868 1 16 . 1 . 1 4 4 U H3' H 1 4.4585 0.0000 . 1 . . . . A 126 U H3' . 30868 1 17 . 1 . 1 4 4 U H5 H 1 5.4607 0.0000 . 1 . . . . A 126 U H5 . 30868 1 18 . 1 . 1 4 4 U H6 H 1 7.8427 0.0000 . 1 . . . . A 126 U H6 . 30868 1 19 . 1 . 1 5 5 C H1' H 1 5.5010 0.0000 . 1 . . . . A 127 C H1' . 30868 1 20 . 1 . 1 5 5 C H2' H 1 4.5552 0.0000 . 1 . . . . A 127 C H2' . 30868 1 21 . 1 . 1 5 5 C H3' H 1 4.3979 0.0000 . 1 . . . . A 127 C H3' . 30868 1 22 . 1 . 1 5 5 C H5 H 1 5.6490 0.0000 . 1 . . . . A 127 C H5 . 30868 1 23 . 1 . 1 5 5 C H6 H 1 7.8163 0.0000 . 1 . . . . A 127 C H6 . 30868 1 24 . 1 . 1 6 6 U H1' H 1 5.4656 0.0000 . 1 . . . . A 128 U H1' . 30868 1 25 . 1 . 1 6 6 U H2' H 1 4.4413 0.0000 . 1 . . . . A 128 U H2' . 30868 1 26 . 1 . 1 6 6 U H3' H 1 4.3270 0.0000 . 1 . . . . A 128 U H3' . 30868 1 27 . 1 . 1 6 6 U H5 H 1 5.3610 0.0000 . 1 . . . . A 128 U H5 . 30868 1 28 . 1 . 1 6 6 U H6 H 1 7.7940 0.0000 . 1 . . . . A 128 U H6 . 30868 1 29 . 1 . 1 7 7 G H1' H 1 5.7582 0.0000 . 1 . . . . A 129 G H1' . 30868 1 30 . 1 . 1 7 7 G H2' H 1 4.4946 0.0000 . 1 . . . . A 129 G H2' . 30868 1 31 . 1 . 1 7 7 G H3' H 1 4.1619 0.0000 . 1 . . . . A 129 G H3' . 30868 1 32 . 1 . 1 7 7 G H8 H 1 7.7056 0.0000 . 1 . . . . A 129 G H8 . 30868 1 33 . 1 . 1 8 8 G H1' H 1 5.6678 0.0000 . 1 . . . . A 130 G H1' . 30868 1 34 . 1 . 1 8 8 G H2' H 1 4.3827 0.0000 . 1 . . . . A 130 G H2' . 30868 1 35 . 1 . 1 8 8 G H3' H 1 4.3299 0.0000 . 1 . . . . A 130 G H3' . 30868 1 36 . 1 . 1 8 8 G H8 H 1 7.1606 0.0000 . 1 . . . . A 130 G H8 . 30868 1 37 . 1 . 1 9 9 U H1' H 1 5.3508 0.0000 . 1 . . . . A 131 U H1' . 30868 1 38 . 1 . 1 9 9 U H2' H 1 4.4731 0.0000 . 1 . . . . A 131 U H2' . 30868 1 39 . 1 . 1 9 9 U H3' H 1 4.5142 0.0000 . 1 . . . . A 131 U H3' . 30868 1 40 . 1 . 1 9 9 U H5 H 1 5.3344 0.0000 . 1 . . . . A 131 U H5 . 30868 1 41 . 1 . 1 9 9 U H6 H 1 7.5166 0.0000 . 1 . . . . A 131 U H6 . 30868 1 42 . 1 . 1 10 10 A H1' H 1 5.5435 0.0000 . 1 . . . . A 132 A H1' . 30868 1 43 . 1 . 1 10 10 A H2 H 1 7.9103 0.0000 . 1 . . . . A 132 A H2 . 30868 1 44 . 1 . 1 10 10 A H2' H 1 4.5080 0.0000 . 1 . . . . A 132 A H2' . 30868 1 45 . 1 . 1 10 10 A H3' H 1 4.3990 0.0000 . 1 . . . . A 132 A H3' . 30868 1 46 . 1 . 1 10 10 A H8 H 1 8.0145 0.0000 . 1 . . . . A 132 A H8 . 30868 1 47 . 1 . 1 11 11 A H1' H 1 5.8750 0.0000 . 1 . . . . A 133 A H1' . 30868 1 48 . 1 . 1 11 11 A H2 H 1 7.5490 0.0000 . 1 . . . . A 133 A H2 . 30868 1 49 . 1 . 1 11 11 A H2' H 1 4.7023 0.0000 . 1 . . . . A 133 A H2' . 30868 1 50 . 1 . 1 11 11 A H3' H 1 4.6074 0.0000 . 1 . . . . A 133 A H3' . 30868 1 51 . 1 . 1 11 11 A H8 H 1 8.1882 0.0000 . 1 . . . . A 133 A H8 . 30868 1 52 . 1 . 1 12 12 C H1' H 1 5.8954 0.0000 . 1 . . . . A 134 C H1' . 30868 1 53 . 1 . 1 12 12 C H2' H 1 4.3199 0.0000 . 1 . . . . A 134 C H2' . 30868 1 54 . 1 . 1 12 12 C H3' H 1 4.3938 0.0000 . 1 . . . . A 134 C H3' . 30868 1 55 . 1 . 1 12 12 C H5 H 1 5.5600 0.0000 . 1 . . . . A 134 C H5 . 30868 1 56 . 1 . 1 12 12 C H6 H 1 7.6103 0.0000 . 1 . . . . A 134 C H6 . 30868 1 57 . 1 . 1 13 13 U H1' H 1 5.7466 0.0000 . 1 . . . . A 135 U H1' . 30868 1 58 . 1 . 1 13 13 U H2' H 1 4.5448 0.0000 . 1 . . . . A 135 U H2' . 30868 1 59 . 1 . 1 13 13 U H3' H 1 4.4828 0.0000 . 1 . . . . A 135 U H3' . 30868 1 60 . 1 . 1 13 13 U H5 H 1 5.5535 0.0000 . 1 . . . . A 135 U H5 . 30868 1 61 . 1 . 1 13 13 U H6 H 1 7.6214 0.0000 . 1 . . . . A 135 U H6 . 30868 1 62 . 1 . 1 14 14 A H1' H 1 5.9588 0.0000 . 1 . . . . A 136 A H1' . 30868 1 63 . 1 . 1 14 14 A H2 H 1 6.8311 0.0000 . 1 . . . . A 136 A H2 . 30868 1 64 . 1 . 1 14 14 A H2' H 1 4.4784 0.0000 . 1 . . . . A 136 A H2' . 30868 1 65 . 1 . 1 14 14 A H3' H 1 4.5306 0.0000 . 1 . . . . A 136 A H3' . 30868 1 66 . 1 . 1 14 14 A H8 H 1 8.1406 0.0000 . 1 . . . . A 136 A H8 . 30868 1 67 . 1 . 1 15 15 G H1' H 1 5.5211 0.0000 . 1 . . . . A 137 G H1' . 30868 1 68 . 1 . 1 15 15 G H2' H 1 4.4017 0.0000 . 1 . . . . A 137 G H2' . 30868 1 69 . 1 . 1 15 15 G H3' H 1 4.4260 0.0000 . 1 . . . . A 137 G H3' . 30868 1 70 . 1 . 1 15 15 G H8 H 1 7.1349 0.0000 . 1 . . . . A 137 G H8 . 30868 1 71 . 1 . 1 16 16 A H1' H 1 5.8662 0.0000 . 1 . . . . A 138 A H1' . 30868 1 72 . 1 . 1 16 16 A H2 H 1 7.3998 0.0000 . 1 . . . . A 138 A H2 . 30868 1 73 . 1 . 1 16 16 A H2' H 1 4.5102 0.0000 . 1 . . . . A 138 A H2' . 30868 1 74 . 1 . 1 16 16 A H3' H 1 4.4496 0.0000 . 1 . . . . A 138 A H3' . 30868 1 75 . 1 . 1 16 16 A H8 H 1 7.5952 0.0000 . 1 . . . . A 138 A H8 . 30868 1 76 . 1 . 1 17 17 G H1' H 1 5.5679 0.0000 . 1 . . . . A 139 G H1' . 30868 1 77 . 1 . 1 17 17 G H2' H 1 4.6286 0.0000 . 1 . . . . A 139 G H2' . 30868 1 78 . 1 . 1 17 17 G H3' H 1 4.5795 0.0000 . 1 . . . . A 139 G H3' . 30868 1 79 . 1 . 1 17 17 G H8 H 1 7.0692 0.0000 . 1 . . . . A 139 G H8 . 30868 1 80 . 1 . 1 18 18 A H1' H 1 6.0026 0.0000 . 1 . . . . A 140 A H1' . 30868 1 81 . 1 . 1 18 18 A H2 H 1 7.8633 0.0000 . 1 . . . . A 140 A H2 . 30868 1 82 . 1 . 1 18 18 A H2' H 1 4.5542 0.0000 . 1 . . . . A 140 A H2' . 30868 1 83 . 1 . 1 18 18 A H3' H 1 4.5111 0.0000 . 1 . . . . A 140 A H3' . 30868 1 84 . 1 . 1 18 18 A H8 H 1 7.7871 0.0000 . 1 . . . . A 140 A H8 . 30868 1 85 . 1 . 1 19 19 U H1' H 1 5.6334 0.0000 . 1 . . . . A 141 U H1' . 30868 1 86 . 1 . 1 19 19 U H2' H 1 4.4524 0.0000 . 1 . . . . A 141 U H2' . 30868 1 87 . 1 . 1 19 19 U H3' H 1 4.4048 0.0000 . 1 . . . . A 141 U H3' . 30868 1 88 . 1 . 1 19 19 U H5 H 1 5.3743 0.0000 . 1 . . . . A 141 U H5 . 30868 1 89 . 1 . 1 19 19 U H6 H 1 7.6451 0.0000 . 1 . . . . A 141 U H6 . 30868 1 90 . 1 . 1 20 20 C H1' H 1 5.6015 0.0000 . 1 . . . . A 142 C H1' . 30868 1 91 . 1 . 1 20 20 C H2' H 1 4.4331 0.0000 . 1 . . . . A 142 C H2' . 30868 1 92 . 1 . 1 20 20 C H3' H 1 4.4595 0.0000 . 1 . . . . A 142 C H3' . 30868 1 93 . 1 . 1 20 20 C H5 H 1 5.8245 0.0000 . 1 . . . . A 142 C H5 . 30868 1 94 . 1 . 1 20 20 C H6 H 1 7.8853 0.0000 . 1 . . . . A 142 C H6 . 30868 1 95 . 1 . 1 21 21 C H1' H 1 5.4810 0.0000 . 1 . . . . A 143 C H1' . 30868 1 96 . 1 . 1 21 21 C H2' H 1 4.3915 0.0000 . 1 . . . . A 143 C H2' . 30868 1 97 . 1 . 1 21 21 C H3' H 1 4.4340 0.0000 . 1 . . . . A 143 C H3' . 30868 1 98 . 1 . 1 21 21 C H5 H 1 5.5894 0.0000 . 1 . . . . A 143 C H5 . 30868 1 99 . 1 . 1 21 21 C H6 H 1 7.7402 0.0000 . 1 . . . . A 143 C H6 . 30868 1 100 . 1 . 1 22 22 C H1' H 1 5.4276 0.0000 . 1 . . . . A 144 C H1' . 30868 1 101 . 1 . 1 22 22 C H2' H 1 4.3790 0.0000 . 1 . . . . A 144 C H2' . 30868 1 102 . 1 . 1 22 22 C H3' H 1 4.4428 0.0000 . 1 . . . . A 144 C H3' . 30868 1 103 . 1 . 1 22 22 C H5 H 1 5.4074 0.0000 . 1 . . . . A 144 C H5 . 30868 1 104 . 1 . 1 22 22 C H6 H 1 7.6479 0.0000 . 1 . . . . A 144 C H6 . 30868 1 105 . 1 . 1 23 23 U H2' H 1 4.5101 0.0000 . 1 . . . . A 145 U H2' . 30868 1 106 . 1 . 1 23 23 U H3' H 1 4.4928 0.0000 . 1 . . . . A 145 U H3' . 30868 1 107 . 1 . 1 23 23 U H5 H 1 5.7744 0.0000 . 1 . . . . A 145 U H5 . 30868 1 108 . 1 . 1 23 23 U H6 H 1 7.7722 0.0000 . 1 . . . . A 145 U H6 . 30868 1 109 . 1 . 1 24 24 C H1' H 1 5.5262 0.0000 . 1 . . . . A 146 C H1' . 30868 1 110 . 1 . 1 24 24 C H2' H 1 4.3212 0.0000 . 1 . . . . A 146 C H2' . 30868 1 111 . 1 . 1 24 24 C H3' H 1 4.5297 0.0000 . 1 . . . . A 146 C H3' . 30868 1 112 . 1 . 1 24 24 C H5 H 1 5.7198 0.0000 . 1 . . . . A 146 C H5 . 30868 1 113 . 1 . 1 24 24 C H6 H 1 7.8271 0.0000 . 1 . . . . A 146 C H6 . 30868 1 114 . 1 . 1 25 25 A H1' H 1 6.0670 0.0000 . 1 . . . . A 147 A H1' . 30868 1 115 . 1 . 1 25 25 A H2 H 1 7.8190 0.0000 . 1 . . . . A 147 A H2 . 30868 1 116 . 1 . 1 25 25 A H2' H 1 4.6857 0.0000 . 1 . . . . A 147 A H2' . 30868 1 117 . 1 . 1 25 25 A H3' H 1 4.6254 0.0000 . 1 . . . . A 147 A H3' . 30868 1 118 . 1 . 1 25 25 A H8 H 1 8.1490 0.0000 . 1 . . . . A 147 A H8 . 30868 1 119 . 1 . 1 26 26 G H1' H 1 5.6191 0.0000 . 1 . . . . A 148 G H1' . 30868 1 120 . 1 . 1 26 26 G H2' H 1 4.4454 0.0000 . 1 . . . . A 148 G H2' . 30868 1 121 . 1 . 1 26 26 G H3' H 1 4.5153 0.0000 . 1 . . . . A 148 G H3' . 30868 1 122 . 1 . 1 26 26 G H8 H 1 7.4483 0.0000 . 1 . . . . A 148 G H8 . 30868 1 123 . 1 . 1 27 27 A H1' H 1 5.9490 0.0000 . 1 . . . . A 149 A H1' . 30868 1 124 . 1 . 1 27 27 A H2 H 1 7.7161 0.0000 . 1 . . . . A 149 A H2 . 30868 1 125 . 1 . 1 27 27 A H2' H 1 4.5389 0.0000 . 1 . . . . A 149 A H2' . 30868 1 126 . 1 . 1 27 27 A H3' H 1 4.5968 0.0000 . 1 . . . . A 149 A H3' . 30868 1 127 . 1 . 1 27 27 A H8 H 1 7.8853 0.0000 . 1 . . . . A 149 A H8 . 30868 1 128 . 1 . 1 28 28 C H1' H 1 5.3598 0.0000 . 1 . . . . A 150 C H1' . 30868 1 129 . 1 . 1 28 28 C H2' H 1 4.4383 0.0000 . 1 . . . . A 150 C H2' . 30868 1 130 . 1 . 1 28 28 C H3' H 1 4.3636 0.0000 . 1 . . . . A 150 C H3' . 30868 1 131 . 1 . 1 28 28 C H5 H 1 5.0421 0.0000 . 1 . . . . A 150 C H5 . 30868 1 132 . 1 . 1 28 28 C H6 H 1 7.2300 0.0000 . 1 . . . . A 150 C H6 . 30868 1 133 . 1 . 1 29 29 C H1' H 1 5.3961 0.0000 . 1 . . . . A 151 C H1' . 30868 1 134 . 1 . 1 29 29 C H2' H 1 4.4295 0.0000 . 1 . . . . A 151 C H2' . 30868 1 135 . 1 . 1 29 29 C H3' H 1 4.3298 0.0000 . 1 . . . . A 151 C H3' . 30868 1 136 . 1 . 1 29 29 C H5 H 1 5.6190 0.0000 . 1 . . . . A 151 C H5 . 30868 1 137 . 1 . 1 29 29 C H6 H 1 7.7168 0.0000 . 1 . . . . A 151 C H6 . 30868 1 138 . 1 . 1 30 30 C H1' H 1 5.6212 0.0000 . 1 . . . . A 152 C H1' . 30868 1 139 . 1 . 1 30 30 C H2' H 1 4.2626 0.0000 . 1 . . . . A 152 C H2' . 30868 1 140 . 1 . 1 30 30 C H3' H 1 4.3874 0.0000 . 1 . . . . A 152 C H3' . 30868 1 141 . 1 . 1 30 30 C H5 H 1 5.6917 0.0000 . 1 . . . . A 152 C H5 . 30868 1 142 . 1 . 1 30 30 C H6 H 1 7.7143 0.0000 . 1 . . . . A 152 C H6 . 30868 1 143 . 1 . 1 31 31 U H1' H 1 5.8134 0.0000 . 1 . . . . A 153 U H1' . 30868 1 144 . 1 . 1 31 31 U H2' H 1 4.5217 0.0000 . 1 . . . . A 153 U H2' . 30868 1 145 . 1 . 1 31 31 U H3' H 1 4.2262 0.0000 . 1 . . . . A 153 U H3' . 30868 1 146 . 1 . 1 31 31 U H5 H 1 5.6656 0.0000 . 1 . . . . A 153 U H5 . 30868 1 147 . 1 . 1 31 31 U H6 H 1 7.6656 0.0000 . 1 . . . . A 153 U H6 . 30868 1 148 . 1 . 1 32 32 U H1' H 1 5.8906 0.0000 . 1 . . . . A 154 U H1' . 30868 1 149 . 1 . 1 32 32 U H2' H 1 4.5661 0.0000 . 1 . . . . A 154 U H2' . 30868 1 150 . 1 . 1 32 32 U H3' H 1 4.3678 0.0000 . 1 . . . . A 154 U H3' . 30868 1 151 . 1 . 1 32 32 U H5 H 1 5.8444 0.0000 . 1 . . . . A 154 U H5 . 30868 1 152 . 1 . 1 32 32 U H6 H 1 7.7506 0.0000 . 1 . . . . A 154 U H6 . 30868 1 153 . 1 . 1 33 33 U H1' H 1 5.9013 0.0000 . 1 . . . . A 155 U H1' . 30868 1 154 . 1 . 1 33 33 U H2' H 1 4.6117 0.0000 . 1 . . . . A 155 U H2' . 30868 1 155 . 1 . 1 33 33 U H3' H 1 4.3745 0.0000 . 1 . . . . A 155 U H3' . 30868 1 156 . 1 . 1 33 33 U H5 H 1 5.8312 0.0000 . 1 . . . . A 155 U H5 . 30868 1 157 . 1 . 1 33 33 U H6 H 1 7.7574 0.0000 . 1 . . . . A 155 U H6 . 30868 1 158 . 1 . 1 34 34 U H1' H 1 5.9310 0.0000 . 1 . . . . A 156 U H1' . 30868 1 159 . 1 . 1 34 34 U H2' H 1 4.6723 0.0000 . 1 . . . . A 156 U H2' . 30868 1 160 . 1 . 1 34 34 U H3' H 1 4.4085 0.0000 . 1 . . . . A 156 U H3' . 30868 1 161 . 1 . 1 34 34 U H5 H 1 5.8677 0.0000 . 1 . . . . A 156 U H5 . 30868 1 162 . 1 . 1 34 34 U H6 H 1 7.7986 0.0000 . 1 . . . . A 156 U H6 . 30868 1 163 . 1 . 1 35 35 A H1' H 1 6.1169 0.0000 . 1 . . . . A 157 A H1' . 30868 1 164 . 1 . 1 35 35 A H2 H 1 8.0551 0.0000 . 1 . . . . A 157 A H2 . 30868 1 165 . 1 . 1 35 35 A H2' H 1 4.8951 0.0000 . 1 . . . . A 157 A H2' . 30868 1 166 . 1 . 1 35 35 A H3' H 1 4.6116 0.0000 . 1 . . . . A 157 A H3' . 30868 1 167 . 1 . 1 35 35 A H8 H 1 8.4253 0.0000 . 1 . . . . A 157 A H8 . 30868 1 168 . 1 . 1 36 36 G H1' H 1 5.4611 0.0000 . 1 . . . . A 158 G H1' . 30868 1 169 . 1 . 1 36 36 G H2' H 1 4.5544 0.0000 . 1 . . . . A 158 G H2' . 30868 1 170 . 1 . 1 36 36 G H3' H 1 4.5021 0.0000 . 1 . . . . A 158 G H3' . 30868 1 171 . 1 . 1 36 36 G H8 H 1 7.3732 0.0000 . 1 . . . . A 158 G H8 . 30868 1 172 . 1 . 1 37 37 U H1' H 1 5.5965 0.0000 . 1 . . . . A 159 U H1' . 30868 1 173 . 1 . 1 37 37 U H2' H 1 4.5030 0.0000 . 1 . . . . A 159 U H2' . 30868 1 174 . 1 . 1 37 37 U H3' H 1 4.4679 0.0000 . 1 . . . . A 159 U H3' . 30868 1 175 . 1 . 1 37 37 U H5 H 1 5.1113 0.0000 . 1 . . . . A 159 U H5 . 30868 1 176 . 1 . 1 37 37 U H6 H 1 7.7553 0.0000 . 1 . . . . A 159 U H6 . 30868 1 177 . 1 . 1 38 38 C H1' H 1 5.5057 0.0000 . 1 . . . . A 160 C H1' . 30868 1 178 . 1 . 1 38 38 C H2' H 1 4.4588 0.0000 . 1 . . . . A 160 C H2' . 30868 1 179 . 1 . 1 38 38 C H3' H 1 4.4277 0.0000 . 1 . . . . A 160 C H3' . 30868 1 180 . 1 . 1 38 38 C H5 H 1 5.5998 0.0000 . 1 . . . . A 160 C H5 . 30868 1 181 . 1 . 1 38 38 C H6 H 1 7.7185 0.0000 . 1 . . . . A 160 C H6 . 30868 1 182 . 1 . 1 39 39 A H1' H 1 5.8951 0.0000 . 1 . . . . A 161 A H1' . 30868 1 183 . 1 . 1 39 39 A H2 H 1 7.5171 0.0000 . 1 . . . . A 161 A H2 . 30868 1 184 . 1 . 1 39 39 A H2' H 1 4.5912 0.0000 . 1 . . . . A 161 A H2' . 30868 1 185 . 1 . 1 39 39 A H3' H 1 4.4401 0.0000 . 1 . . . . A 161 A H3' . 30868 1 186 . 1 . 1 39 39 A H8 H 1 8.0602 0.0000 . 1 . . . . A 161 A H8 . 30868 1 187 . 1 . 1 40 40 G H1' H 1 5.3536 0.0000 . 1 . . . . A 162 G H1' . 30868 1 188 . 1 . 1 40 40 G H2' H 1 4.6019 0.0000 . 1 . . . . A 162 G H2' . 30868 1 189 . 1 . 1 40 40 G H3' H 1 4.3987 0.0000 . 1 . . . . A 162 G H3' . 30868 1 190 . 1 . 1 40 40 G H8 H 1 7.1501 0.0000 . 1 . . . . A 162 G H8 . 30868 1 191 . 1 . 1 41 41 U H1' H 1 5.4032 0.0000 . 1 . . . . A 163 U H1' . 30868 1 192 . 1 . 1 41 41 U H2' H 1 4.4843 0.0000 . 1 . . . . A 163 U H2' . 30868 1 193 . 1 . 1 41 41 U H3' H 1 4.4490 0.0000 . 1 . . . . A 163 U H3' . 30868 1 194 . 1 . 1 41 41 U H5 H 1 5.2078 0.0000 . 1 . . . . A 163 U H5 . 30868 1 195 . 1 . 1 41 41 U H6 H 1 7.4607 0.0000 . 1 . . . . A 163 U H6 . 30868 1 196 . 1 . 1 42 42 G H1' H 1 5.8623 0.0000 . 1 . . . . A 164 G H1' . 30868 1 197 . 1 . 1 42 42 G H2' H 1 4.7477 0.0000 . 1 . . . . A 164 G H2' . 30868 1 198 . 1 . 1 42 42 G H3' H 1 4.6200 0.0000 . 1 . . . . A 164 G H3' . 30868 1 199 . 1 . 1 42 42 G H8 H 1 7.8970 0.0000 . 1 . . . . A 164 G H8 . 30868 1 200 . 1 . 1 43 43 U H1' H 1 5.4562 0.0000 . 1 . . . . A 165 U H1' . 30868 1 201 . 1 . 1 43 43 U H2' H 1 4.5203 0.0000 . 1 . . . . A 165 U H2' . 30868 1 202 . 1 . 1 43 43 U H3' H 1 4.4724 0.0000 . 1 . . . . A 165 U H3' . 30868 1 203 . 1 . 1 43 43 U H5 H 1 5.5112 0.0000 . 1 . . . . A 165 U H5 . 30868 1 204 . 1 . 1 43 43 U H6 H 1 7.7624 0.0000 . 1 . . . . A 165 U H6 . 30868 1 205 . 1 . 1 44 44 G H1' H 1 5.7072 0.0000 . 1 . . . . A 166 G H1' . 30868 1 206 . 1 . 1 44 44 G H2' H 1 4.8077 0.0000 . 1 . . . . A 166 G H2' . 30868 1 207 . 1 . 1 44 44 G H3' H 1 4.4462 0.0000 . 1 . . . . A 166 G H3' . 30868 1 208 . 1 . 1 44 44 G H8 H 1 7.4678 0.0000 . 1 . . . . A 166 G H8 . 30868 1 209 . 1 . 1 45 45 G H1' H 1 5.7773 0.0000 . 1 . . . . A 167 G H1' . 30868 1 210 . 1 . 1 45 45 G H2' H 1 4.4279 0.0000 . 1 . . . . A 167 G H2' . 30868 1 211 . 1 . 1 45 45 G H3' H 1 4.5109 0.0000 . 1 . . . . A 167 G H3' . 30868 1 212 . 1 . 1 45 45 G H8 H 1 7.3064 0.0000 . 1 . . . . A 167 G H8 . 30868 1 213 . 1 . 1 46 46 A H1' H 1 5.8348 0.0000 . 1 . . . . A 168 A H1' . 30868 1 214 . 1 . 1 46 46 A H2 H 1 7.4811 0.0000 . 1 . . . . A 168 A H2 . 30868 1 215 . 1 . 1 46 46 A H2' H 1 4.5287 0.0000 . 1 . . . . A 168 A H2' . 30868 1 216 . 1 . 1 46 46 A H3' H 1 4.4815 0.0000 . 1 . . . . A 168 A H3' . 30868 1 217 . 1 . 1 46 46 A H8 H 1 7.7025 0.0000 . 1 . . . . A 168 A H8 . 30868 1 218 . 1 . 1 47 47 A H1' H 1 5.5365 0.0000 . 1 . . . . A 169 A H1' . 30868 1 219 . 1 . 1 47 47 A H2 H 1 7.5481 0.0000 . 1 . . . . A 169 A H2 . 30868 1 220 . 1 . 1 47 47 A H2' H 1 4.4559 0.0000 . 1 . . . . A 169 A H2' . 30868 1 221 . 1 . 1 47 47 A H3' H 1 4.5095 0.0000 . 1 . . . . A 169 A H3' . 30868 1 222 . 1 . 1 47 47 A H8 H 1 7.7838 0.0000 . 1 . . . . A 169 A H8 . 30868 1 223 . 1 . 1 48 48 A H1' H 1 5.7639 0.0000 . 1 . . . . A 170 A H1' . 30868 1 224 . 1 . 1 48 48 A H2 H 1 7.8010 0.0000 . 1 . . . . A 170 A H2 . 30868 1 225 . 1 . 1 48 48 A H2' H 1 4.6511 0.0000 . 1 . . . . A 170 A H2' . 30868 1 226 . 1 . 1 48 48 A H3' H 1 4.4758 0.0000 . 1 . . . . A 170 A H3' . 30868 1 227 . 1 . 1 48 48 A H8 H 1 8.0328 0.0000 . 1 . . . . A 170 A H8 . 30868 1 228 . 1 . 1 49 49 A H1' H 1 5.8009 0.0000 . 1 . . . . A 171 A H1' . 30868 1 229 . 1 . 1 49 49 A H2 H 1 7.9044 0.0000 . 1 . . . . A 171 A H2 . 30868 1 230 . 1 . 1 49 49 A H2' H 1 4.6091 0.0000 . 1 . . . . A 171 A H2' . 30868 1 231 . 1 . 1 49 49 A H3' H 1 4.5179 0.0000 . 1 . . . . A 171 A H3' . 30868 1 232 . 1 . 1 49 49 A H8 H 1 8.1576 0.0000 . 1 . . . . A 171 A H8 . 30868 1 233 . 1 . 1 50 50 U H1' H 1 5.6397 0.0000 . 1 . . . . A 172 U H1' . 30868 1 234 . 1 . 1 50 50 U H2' H 1 4.5284 0.0000 . 1 . . . . A 172 U H2' . 30868 1 235 . 1 . 1 50 50 U H3' H 1 4.4855 0.0000 . 1 . . . . A 172 U H3' . 30868 1 236 . 1 . 1 50 50 U H5 H 1 5.3498 0.0000 . 1 . . . . A 172 U H5 . 30868 1 237 . 1 . 1 50 50 U H6 H 1 7.7764 0.0000 . 1 . . . . A 172 U H6 . 30868 1 238 . 1 . 1 51 51 C H1' H 1 5.6006 0.0000 . 1 . . . . A 173 C H1' . 30868 1 239 . 1 . 1 51 51 C H2' H 1 4.3868 0.0000 . 1 . . . . A 173 C H2' . 30868 1 240 . 1 . 1 51 51 C H3' H 1 4.4819 0.0000 . 1 . . . . A 173 C H3' . 30868 1 241 . 1 . 1 51 51 C H5 H 1 5.7239 0.0000 . 1 . . . . A 173 C H5 . 30868 1 242 . 1 . 1 51 51 C H6 H 1 7.8842 0.0000 . 1 . . . . A 173 C H6 . 30868 1 243 . 1 . 1 52 52 U H1' H 1 5.5042 0.0000 . 1 . . . . A 174 U H1' . 30868 1 244 . 1 . 1 52 52 U H2' H 1 4.4619 0.0000 . 1 . . . . A 174 U H2' . 30868 1 245 . 1 . 1 52 52 U H3' H 1 4.5151 0.0000 . 1 . . . . A 174 U H3' . 30868 1 246 . 1 . 1 52 52 U H5 H 1 5.4157 0.0000 . 1 . . . . A 174 U H5 . 30868 1 247 . 1 . 1 52 52 U H6 H 1 7.9016 0.0000 . 1 . . . . A 174 U H6 . 30868 1 248 . 1 . 1 53 53 C H1' H 1 5.5106 0.0000 . 1 . . . . A 175 C H1' . 30868 1 249 . 1 . 1 53 53 C H2' H 1 4.3052 0.0000 . 1 . . . . A 175 C H2' . 30868 1 250 . 1 . 1 53 53 C H3' H 1 4.4466 0.0000 . 1 . . . . A 175 C H3' . 30868 1 251 . 1 . 1 53 53 C H5 H 1 5.6706 0.0000 . 1 . . . . A 175 C H5 . 30868 1 252 . 1 . 1 53 53 C H6 H 1 7.8153 0.0000 . 1 . . . . A 175 C H6 . 30868 1 253 . 1 . 1 54 54 U H1' H 1 5.4000 0.0000 . 1 . . . . A 176 U H1' . 30868 1 254 . 1 . 1 54 54 U H2' H 1 4.4725 0.0000 . 1 . . . . A 176 U H2' . 30868 1 255 . 1 . 1 54 54 U H3' H 1 4.5520 0.0000 . 1 . . . . A 176 U H3' . 30868 1 256 . 1 . 1 54 54 U H5 H 1 5.4008 0.0000 . 1 . . . . A 176 U H5 . 30868 1 257 . 1 . 1 54 54 U H6 H 1 7.7918 0.0000 . 1 . . . . A 176 U H6 . 30868 1 258 . 1 . 1 55 55 A H1' H 1 5.9040 0.0000 . 1 . . . . A 177 A H1' . 30868 1 259 . 1 . 1 55 55 A H2 H 1 7.5288 0.0000 . 1 . . . . A 177 A H2 . 30868 1 260 . 1 . 1 55 55 A H8 H 1 8.0624 0.0000 . 1 . . . . A 177 A H8 . 30868 1 261 . 1 . 1 56 56 G H1' H 1 5.8767 0.0000 . 1 . . . . A 178 G H1' . 30868 1 262 . 1 . 1 56 56 G H2' H 1 4.6872 0.0000 . 1 . . . . A 178 G H2' . 30868 1 263 . 1 . 1 56 56 G H3' H 1 4.5887 0.0000 . 1 . . . . A 178 G H3' . 30868 1 264 . 1 . 1 56 56 G H8 H 1 8.1829 0.0000 . 1 . . . . A 178 G H8 . 30868 1 265 . 1 . 1 57 57 C H1' H 1 5.5999 0.0000 . 1 . . . . A 179 C H1' . 30868 1 266 . 1 . 1 57 57 C H2' H 1 4.4727 0.0000 . 1 . . . . A 179 C H2' . 30868 1 267 . 1 . 1 57 57 C H3' H 1 4.4516 0.0000 . 1 . . . . A 179 C H3' . 30868 1 268 . 1 . 1 57 57 C H5 H 1 5.3703 0.0000 . 1 . . . . A 179 C H5 . 30868 1 269 . 1 . 1 57 57 C H6 H 1 7.5321 0.0000 . 1 . . . . A 179 C H6 . 30868 1 270 . 1 . 1 58 58 A H1' H 1 5.8697 0.0000 . 1 . . . . A 180 A H1' . 30868 1 271 . 1 . 1 58 58 A H2' H 1 4.4485 0.0000 . 1 . . . . A 180 A H2' . 30868 1 272 . 1 . 1 58 58 A H3' H 1 4.5246 0.0000 . 1 . . . . A 180 A H3' . 30868 1 273 . 1 . 1 58 58 A H8 H 1 8.1289 0.0000 . 1 . . . . A 180 A H8 . 30868 1 274 . 1 . 1 59 59 G H1' H 1 5.6233 0.0000 . 1 . . . . A 181 G H1' . 30868 1 275 . 1 . 1 59 59 G H8 H 1 7.7323 0.0000 . 1 . . . . A 181 G H8 . 30868 1 276 . 1 . 1 60 60 U H1' H 1 5.6607 0.0000 . 1 . . . . A 182 U H1' . 30868 1 277 . 1 . 1 60 60 U H2' H 1 4.2824 0.0000 . 1 . . . . A 182 U H2' . 30868 1 278 . 1 . 1 60 60 U H3' H 1 4.1617 0.0000 . 1 . . . . A 182 U H3' . 30868 1 279 . 1 . 1 60 60 U H5 H 1 5.6854 0.0000 . 1 . . . . A 182 U H5 . 30868 1 280 . 1 . 1 60 60 U H6 H 1 7.6207 0.0000 . 1 . . . . A 182 U H6 . 30868 1 281 . 1 . 1 61 61 G H1' H 1 5.7450 0.0000 . 1 . . . . A 183 G H1' . 30868 1 282 . 1 . 1 61 61 G H2' H 1 4.7162 0.0000 . 1 . . . . A 183 G H2' . 30868 1 283 . 1 . 1 61 61 G H3' H 1 4.7733 0.0000 . 1 . . . . A 183 G H3' . 30868 1 284 . 1 . 1 61 61 G H8 H 1 7.8869 0.0000 . 1 . . . . A 183 G H8 . 30868 1 285 . 1 . 1 62 62 G H1' H 1 5.3996 0.0000 . 1 . . . . A 184 G H1' . 30868 1 286 . 1 . 1 62 62 G H2' H 1 4.4340 0.0000 . 1 . . . . A 184 G H2' . 30868 1 287 . 1 . 1 62 62 G H3' H 1 4.5049 0.0000 . 1 . . . . A 184 G H3' . 30868 1 288 . 1 . 1 62 62 G H8 H 1 7.8458 0.0000 . 1 . . . . A 184 G H8 . 30868 1 289 . 1 . 1 63 63 C H1' H 1 5.8331 0.0000 . 1 . . . . A 185 C H1' . 30868 1 290 . 1 . 1 63 63 C H2' H 1 4.1549 0.0000 . 1 . . . . A 185 C H2' . 30868 1 291 . 1 . 1 63 63 C H3' H 1 4.2157 0.0000 . 1 . . . . A 185 C H3' . 30868 1 292 . 1 . 1 63 63 C H5 H 1 5.8988 0.0000 . 1 . . . . A 185 C H5 . 30868 1 293 . 1 . 1 63 63 C H6 H 1 7.8134 0.0000 . 1 . . . . A 185 C H6 . 30868 1 294 . 1 . 1 65 65 C H1' H 1 5.5434 0.0000 . 1 . . . . A 187 C H1' . 30868 1 295 . 1 . 1 65 65 C H2' H 1 4.5322 0.0000 . 1 . . . . A 187 C H2' . 30868 1 296 . 1 . 1 65 65 C H3' H 1 4.4553 0.0000 . 1 . . . . A 187 C H3' . 30868 1 297 . 1 . 1 65 65 C H5 H 1 5.4119 0.0000 . 1 . . . . A 187 C H5 . 30868 1 298 . 1 . 1 65 65 C H6 H 1 7.6775 0.0000 . 1 . . . . A 187 C H6 . 30868 1 299 . 1 . 1 66 66 C H1' H 1 5.4332 0.0000 . 1 . . . . A 188 C H1' . 30868 1 300 . 1 . 1 66 66 C H2' H 1 4.3995 0.0000 . 1 . . . . A 188 C H2' . 30868 1 301 . 1 . 1 66 66 C H3' H 1 4.3421 0.0000 . 1 . . . . A 188 C H3' . 30868 1 302 . 1 . 1 66 66 C H5 H 1 5.4735 0.0000 . 1 . . . . A 188 C H5 . 30868 1 303 . 1 . 1 66 66 C H6 H 1 7.8209 0.0000 . 1 . . . . A 188 C H6 . 30868 1 304 . 1 . 1 67 67 C H1' H 1 5.4641 0.0000 . 1 . . . . A 189 C H1' . 30868 1 305 . 1 . 1 67 67 C H2' H 1 4.5105 0.0000 . 1 . . . . A 189 C H2' . 30868 1 306 . 1 . 1 67 67 C H3' H 1 4.3152 0.0000 . 1 . . . . A 189 C H3' . 30868 1 307 . 1 . 1 67 67 C H5 H 1 5.3231 0.0000 . 1 . . . . A 189 C H5 . 30868 1 308 . 1 . 1 67 67 C H6 H 1 7.5228 0.0000 . 1 . . . . A 189 C H6 . 30868 1 309 . 1 . 1 68 68 G H1' H 1 5.5778 0.0000 . 1 . . . . A 190 G H1' . 30868 1 310 . 1 . 1 68 68 G H2' H 1 4.4138 0.0000 . 1 . . . . A 190 G H2' . 30868 1 311 . 1 . 1 68 68 G H3' H 1 4.5945 0.0000 . 1 . . . . A 190 G H3' . 30868 1 312 . 1 . 1 68 68 G H8 H 1 7.6157 0.0000 . 1 . . . . A 190 G H8 . 30868 1 313 . 1 . 1 69 69 A H1' H 1 5.7109 0.0000 . 1 . . . . A 191 A H1' . 30868 1 314 . 1 . 1 69 69 A H2' H 1 4.7259 0.0000 . 1 . . . . A 191 A H2' . 30868 1 315 . 1 . 1 69 69 A H3' H 1 4.4307 0.0000 . 1 . . . . A 191 A H3' . 30868 1 316 . 1 . 1 69 69 A H8 H 1 7.9973 0.0000 . 1 . . . . A 191 A H8 . 30868 1 317 . 1 . 1 70 70 A H1' H 1 5.8797 0.0000 . 1 . . . . A 192 A H1' . 30868 1 318 . 1 . 1 70 70 A H2 H 1 8.0358 0.0000 . 1 . . . . A 192 A H2 . 30868 1 319 . 1 . 1 70 70 A H8 H 1 8.1514 0.0000 . 1 . . . . A 192 A H8 . 30868 1 320 . 1 . 1 71 71 C H1' H 1 5.7879 0.0000 . 1 . . . . A 193 C H1' . 30868 1 321 . 1 . 1 71 71 C H2' H 1 4.3137 0.0000 . 1 . . . . A 193 C H2' . 30868 1 322 . 1 . 1 71 71 C H3' H 1 4.6151 0.0000 . 1 . . . . A 193 C H3' . 30868 1 323 . 1 . 1 71 71 C H5 H 1 5.7916 0.0000 . 1 . . . . A 193 C H5 . 30868 1 324 . 1 . 1 71 71 C H6 H 1 7.6388 0.0000 . 1 . . . . A 193 C H6 . 30868 1 325 . 1 . 1 72 72 A H1' H 1 6.0411 0.0000 . 1 . . . . A 194 A H1' . 30868 1 326 . 1 . 1 72 72 A H2 H 1 8.1264 0.0000 . 1 . . . . A 194 A H2 . 30868 1 327 . 1 . 1 72 72 A H2' H 1 4.8218 0.0000 . 1 . . . . A 194 A H2' . 30868 1 328 . 1 . 1 72 72 A H3' H 1 4.6029 0.0000 . 1 . . . . A 194 A H3' . 30868 1 329 . 1 . 1 72 72 A H8 H 1 8.1778 0.0000 . 1 . . . . A 194 A H8 . 30868 1 330 . 1 . 1 73 73 G H1' H 1 4.9483 0.0000 . 1 . . . . A 195 G H1' . 30868 1 331 . 1 . 1 73 73 G H2' H 1 4.3085 0.0000 . 1 . . . . A 195 G H2' . 30868 1 332 . 1 . 1 73 73 G H3' H 1 4.3422 0.0000 . 1 . . . . A 195 G H3' . 30868 1 333 . 1 . 1 73 73 G H8 H 1 7.7370 0.0000 . 1 . . . . A 195 G H8 . 30868 1 334 . 1 . 1 74 74 G H1' H 1 5.7628 0.0000 . 1 . . . . A 196 G H1' . 30868 1 335 . 1 . 1 74 74 G H2' H 1 4.6167 0.0000 . 1 . . . . A 196 G H2' . 30868 1 336 . 1 . 1 74 74 G H3' H 1 4.4189 0.0000 . 1 . . . . A 196 G H3' . 30868 1 337 . 1 . 1 74 74 G H8 H 1 7.1897 0.0000 . 1 . . . . A 196 G H8 . 30868 1 338 . 1 . 1 75 75 G H1' H 1 5.7174 0.0000 . 1 . . . . A 197 G H1' . 30868 1 339 . 1 . 1 75 75 G H2' H 1 4.6349 0.0000 . 1 . . . . A 197 G H2' . 30868 1 340 . 1 . 1 75 75 G H3' H 1 4.4681 0.0000 . 1 . . . . A 197 G H3' . 30868 1 341 . 1 . 1 75 75 G H8 H 1 7.1677 0.0000 . 1 . . . . A 197 G H8 . 30868 1 342 . 1 . 1 76 76 A H1' H 1 5.9965 0.0000 . 1 . . . . A 198 A H1' . 30868 1 343 . 1 . 1 76 76 A H2 H 1 8.0237 0.0000 . 1 . . . . A 198 A H2 . 30868 1 344 . 1 . 1 76 76 A H2' H 1 4.4449 0.0000 . 1 . . . . A 198 A H2' . 30868 1 345 . 1 . 1 76 76 A H3' H 1 4.5397 0.0000 . 1 . . . . A 198 A H3' . 30868 1 346 . 1 . 1 76 76 A H8 H 1 7.8339 0.0000 . 1 . . . . A 198 A H8 . 30868 1 347 . 1 . 1 77 77 C H1' H 1 5.5006 0.0000 . 1 . . . . A 199 C H1' . 30868 1 348 . 1 . 1 77 77 C H2' H 1 4.5530 0.0000 . 1 . . . . A 199 C H2' . 30868 1 349 . 1 . 1 77 77 C H3' H 1 4.3359 0.0000 . 1 . . . . A 199 C H3' . 30868 1 350 . 1 . 1 77 77 C H5 H 1 5.3961 0.0000 . 1 . . . . A 199 C H5 . 30868 1 351 . 1 . 1 77 77 C H6 H 1 7.4258 0.0000 . 1 . . . . A 199 C H6 . 30868 1 352 . 1 . 1 78 78 U H1' H 1 5.7469 0.0000 . 1 . . . . A 200 U H1' . 30868 1 353 . 1 . 1 78 78 U H2' H 1 4.1740 0.0000 . 1 . . . . A 200 U H2' . 30868 1 354 . 1 . 1 78 78 U H3' H 1 4.4569 0.0000 . 1 . . . . A 200 U H3' . 30868 1 355 . 1 . 1 78 78 U H5 H 1 5.6023 0.0000 . 1 . . . . A 200 U H5 . 30868 1 356 . 1 . 1 78 78 U H6 H 1 7.6826 0.0000 . 1 . . . . A 200 U H6 . 30868 1 357 . 1 . 1 79 79 U H1' H 1 5.6310 0.0000 . 1 . . . . A 201 U H1' . 30868 1 358 . 1 . 1 79 79 U H2' H 1 4.6087 0.0000 . 1 . . . . A 201 U H2' . 30868 1 359 . 1 . 1 79 79 U H3' H 1 4.4599 0.0000 . 1 . . . . A 201 U H3' . 30868 1 360 . 1 . 1 79 79 U H5 H 1 5.5459 0.0000 . 1 . . . . A 201 U H5 . 30868 1 361 . 1 . 1 79 79 U H6 H 1 7.8542 0.0000 . 1 . . . . A 201 U H6 . 30868 1 362 . 1 . 1 80 80 G H1' H 1 5.5546 0.0000 . 1 . . . . A 202 G H1' . 30868 1 363 . 1 . 1 80 80 G H2' H 1 4.7352 0.0000 . 1 . . . . A 202 G H2' . 30868 1 364 . 1 . 1 80 80 G H3' H 1 4.6202 0.0000 . 1 . . . . A 202 G H3' . 30868 1 365 . 1 . 1 80 80 G H8 H 1 7.7677 0.0000 . 1 . . . . A 202 G H8 . 30868 1 366 . 1 . 1 81 81 A H1' H 1 5.8423 0.0000 . 1 . . . . A 203 A H1' . 30868 1 367 . 1 . 1 81 81 A H2 H 1 7.7994 0.0000 . 1 . . . . A 203 A H2 . 30868 1 368 . 1 . 1 81 81 A H2' H 1 4.7519 0.0000 . 1 . . . . A 203 A H2' . 30868 1 369 . 1 . 1 81 81 A H3' H 1 4.6638 0.0000 . 1 . . . . A 203 A H3' . 30868 1 370 . 1 . 1 81 81 A H8 H 1 8.1446 0.0000 . 1 . . . . A 203 A H8 . 30868 1 371 . 1 . 1 82 82 A H1' H 1 5.6995 0.0000 . 1 . . . . A 204 A H1' . 30868 1 372 . 1 . 1 82 82 A H2 H 1 7.7775 0.0000 . 1 . . . . A 204 A H2 . 30868 1 373 . 1 . 1 82 82 A H2' H 1 4.7015 0.0000 . 1 . . . . A 204 A H2' . 30868 1 374 . 1 . 1 82 82 A H3' H 1 4.5869 0.0000 . 1 . . . . A 204 A H3' . 30868 1 375 . 1 . 1 82 82 A H8 H 1 8.0743 0.0000 . 1 . . . . A 204 A H8 . 30868 1 376 . 1 . 1 83 83 A H1' H 1 5.8914 0.0000 . 1 . . . . A 205 A H1' . 30868 1 377 . 1 . 1 83 83 A H2 H 1 7.9981 0.0000 . 1 . . . . A 205 A H2 . 30868 1 378 . 1 . 1 83 83 A H2' H 1 4.6888 0.0000 . 1 . . . . A 205 A H2' . 30868 1 379 . 1 . 1 83 83 A H3' H 1 4.5477 0.0000 . 1 . . . . A 205 A H3' . 30868 1 380 . 1 . 1 83 83 A H8 H 1 8.1010 0.0000 . 1 . . . . A 205 A H8 . 30868 1 381 . 1 . 1 84 84 G H1' H 1 5.2944 0.0000 . 1 . . . . A 206 G H1' . 30868 1 382 . 1 . 1 84 84 G H2' H 1 4.4974 0.0000 . 1 . . . . A 206 G H2' . 30868 1 383 . 1 . 1 84 84 G H3' H 1 4.4386 0.0000 . 1 . . . . A 206 G H3' . 30868 1 384 . 1 . 1 84 84 G H8 H 1 7.6981 0.0000 . 1 . . . . A 206 G H8 . 30868 1 385 . 1 . 1 85 85 C H1' H 1 5.5728 0.0000 . 1 . . . . A 207 C H1' . 30868 1 386 . 1 . 1 85 85 C H2' H 1 4.3248 0.0000 . 1 . . . . A 207 C H2' . 30868 1 387 . 1 . 1 85 85 C H3' H 1 4.3984 0.0000 . 1 . . . . A 207 C H3' . 30868 1 388 . 1 . 1 85 85 C H5 H 1 5.3222 0.0000 . 1 . . . . A 207 C H5 . 30868 1 389 . 1 . 1 85 85 C H6 H 1 7.4839 0.0000 . 1 . . . . A 207 C H6 . 30868 1 390 . 1 . 1 86 86 G H1' H 1 5.6279 0.0000 . 1 . . . . A 208 G H1' . 30868 1 391 . 1 . 1 86 86 G H2' H 1 4.4742 0.0000 . 1 . . . . A 208 G H2' . 30868 1 392 . 1 . 1 86 86 G H3' H 1 4.5597 0.0000 . 1 . . . . A 208 G H3' . 30868 1 393 . 1 . 1 86 86 G H8 H 1 7.5841 0.0000 . 1 . . . . A 208 G H8 . 30868 1 394 . 1 . 1 87 87 A H1' H 1 5.6062 0.0000 . 1 . . . . A 209 A H1' . 30868 1 395 . 1 . 1 87 87 A H2 H 1 7.7126 0.0000 . 1 . . . . A 209 A H2 . 30868 1 396 . 1 . 1 87 87 A H2' H 1 4.4753 0.0000 . 1 . . . . A 209 A H2' . 30868 1 397 . 1 . 1 87 87 A H3' H 1 4.5843 0.0000 . 1 . . . . A 209 A H3' . 30868 1 398 . 1 . 1 87 87 A H8 H 1 7.9339 0.0000 . 1 . . . . A 209 A H8 . 30868 1 399 . 1 . 1 88 88 A H1' H 1 5.6471 0.0000 . 1 . . . . A 210 A H1' . 30868 1 400 . 1 . 1 88 88 A H2 H 1 7.7643 0.0000 . 1 . . . . A 210 A H2 . 30868 1 401 . 1 . 1 88 88 A H2' H 1 4.4369 0.0000 . 1 . . . . A 210 A H2' . 30868 1 402 . 1 . 1 88 88 A H3' H 1 4.6022 0.0000 . 1 . . . . A 210 A H3' . 30868 1 403 . 1 . 1 88 88 A H8 H 1 7.9292 0.0000 . 1 . . . . A 210 A H8 . 30868 1 404 . 1 . 1 89 89 A H1' H 1 5.7272 0.0000 . 1 . . . . A 211 A H1' . 30868 1 405 . 1 . 1 89 89 A H2 H 1 7.8139 0.0000 . 1 . . . . A 211 A H2 . 30868 1 406 . 1 . 1 89 89 A H2' H 1 4.6462 0.0000 . 1 . . . . A 211 A H2' . 30868 1 407 . 1 . 1 89 89 A H3' H 1 4.4761 0.0000 . 1 . . . . A 211 A H3' . 30868 1 408 . 1 . 1 89 89 A H8 H 1 7.9966 0.0000 . 1 . . . . A 211 A H8 . 30868 1 409 . 1 . 1 90 90 G H1' H 1 5.5495 0.0000 . 1 . . . . A 212 G H1' . 30868 1 410 . 1 . 1 90 90 G H2' H 1 4.5690 0.0000 . 1 . . . . A 212 G H2' . 30868 1 411 . 1 . 1 90 90 G H3' H 1 4.5969 0.0000 . 1 . . . . A 212 G H3' . 30868 1 412 . 1 . 1 90 90 G H8 H 1 7.6666 0.0000 . 1 . . . . A 212 G H8 . 30868 1 413 . 1 . 1 91 91 U H1' H 1 5.6665 0.0000 . 1 . . . . A 213 U H1' . 30868 1 414 . 1 . 1 91 91 U H2' H 1 4.5657 0.0000 . 1 . . . . A 213 U H2' . 30868 1 415 . 1 . 1 91 91 U H3' H 1 4.5016 0.0000 . 1 . . . . A 213 U H3' . 30868 1 416 . 1 . 1 91 91 U H5 H 1 5.4888 0.0000 . 1 . . . . A 213 U H5 . 30868 1 417 . 1 . 1 91 91 U H6 H 1 7.5725 0.0000 . 1 . . . . A 213 U H6 . 30868 1 418 . 1 . 1 92 92 A H1' H 1 5.7788 0.0000 . 1 . . . . A 214 A H1' . 30868 1 419 . 1 . 1 92 92 A H2 H 1 7.5318 0.0000 . 1 . . . . A 214 A H2 . 30868 1 420 . 1 . 1 92 92 A H2' H 1 4.4093 0.0000 . 1 . . . . A 214 A H2' . 30868 1 421 . 1 . 1 92 92 A H3' H 1 4.5627 0.0000 . 1 . . . . A 214 A H3' . 30868 1 422 . 1 . 1 92 92 A H8 H 1 8.1091 0.0000 . 1 . . . . A 214 A H8 . 30868 1 423 . 1 . 1 93 93 A H1' H 1 5.6243 0.0000 . 1 . . . . A 215 A H1' . 30868 1 424 . 1 . 1 93 93 A H2 H 1 7.6703 0.0000 . 1 . . . . A 215 A H2 . 30868 1 425 . 1 . 1 93 93 A H2' H 1 4.3653 0.0000 . 1 . . . . A 215 A H2' . 30868 1 426 . 1 . 1 93 93 A H3' H 1 4.5218 0.0000 . 1 . . . . A 215 A H3' . 30868 1 427 . 1 . 1 93 93 A H8 H 1 7.9992 0.0000 . 1 . . . . A 215 A H8 . 30868 1 428 . 1 . 1 94 94 A H1' H 1 5.9571 0.0000 . 1 . . . . A 216 A H1' . 30868 1 429 . 1 . 1 94 94 A H2 H 1 8.0289 0.0000 . 1 . . . . A 216 A H2 . 30868 1 430 . 1 . 1 94 94 A H2' H 1 4.7819 0.0000 . 1 . . . . A 216 A H2' . 30868 1 431 . 1 . 1 94 94 A H3' H 1 4.7148 0.0000 . 1 . . . . A 216 A H3' . 30868 1 432 . 1 . 1 94 94 A H8 H 1 8.2140 0.0000 . 1 . . . . A 216 A H8 . 30868 1 433 . 1 . 1 95 95 G H1' H 1 5.5348 0.0000 . 1 . . . . A 217 G H1' . 30868 1 434 . 1 . 1 95 95 G H2' H 1 4.3561 0.0000 . 1 . . . . A 217 G H2' . 30868 1 435 . 1 . 1 95 95 G H3' H 1 4.5046 0.0000 . 1 . . . . A 217 G H3' . 30868 1 436 . 1 . 1 95 95 G H8 H 1 7.8697 0.0000 . 1 . . . . A 217 G H8 . 30868 1 437 . 1 . 1 96 96 C H1' H 1 5.4952 0.0000 . 1 . . . . A 218 C H1' . 30868 1 438 . 1 . 1 96 96 C H2' H 1 4.3293 0.0000 . 1 . . . . A 218 C H2' . 30868 1 439 . 1 . 1 96 96 C H3' H 1 4.4503 0.0000 . 1 . . . . A 218 C H3' . 30868 1 440 . 1 . 1 96 96 C H5 H 1 5.3921 0.0000 . 1 . . . . A 218 C H5 . 30868 1 441 . 1 . 1 96 96 C H6 H 1 7.6446 0.0000 . 1 . . . . A 218 C H6 . 30868 1 442 . 1 . 1 97 97 C H1' H 1 5.4857 0.0000 . 1 . . . . A 219 C H1' . 30868 1 443 . 1 . 1 97 97 C H2' H 1 4.5456 0.0000 . 1 . . . . A 219 C H2' . 30868 1 444 . 1 . 1 97 97 C H3' H 1 4.3107 0.0000 . 1 . . . . A 219 C H3' . 30868 1 445 . 1 . 1 97 97 C H5 H 1 5.4756 0.0000 . 1 . . . . A 219 C H5 . 30868 1 446 . 1 . 1 97 97 C H6 H 1 7.7246 0.0000 . 1 . . . . A 219 C H6 . 30868 1 447 . 1 . 1 98 98 A H1' H 1 5.9096 0.0000 . 1 . . . . A 220 A H1' . 30868 1 448 . 1 . 1 98 98 A H2 H 1 6.9051 0.0000 . 1 . . . . A 220 A H2 . 30868 1 449 . 1 . 1 98 98 A H2' H 1 4.6984 0.0000 . 1 . . . . A 220 A H2' . 30868 1 450 . 1 . 1 98 98 A H3' H 1 4.5496 0.0000 . 1 . . . . A 220 A H3' . 30868 1 451 . 1 . 1 98 98 A H8 H 1 7.9406 0.0000 . 1 . . . . A 220 A H8 . 30868 1 452 . 1 . 1 99 99 G H1' H 1 5.5433 0.0000 . 1 . . . . A 221 G H1' . 30868 1 453 . 1 . 1 99 99 G H2' H 1 4.5078 0.0000 . 1 . . . . A 221 G H2' . 30868 1 454 . 1 . 1 99 99 G H3' H 1 4.4535 0.0000 . 1 . . . . A 221 G H3' . 30868 1 455 . 1 . 1 99 99 G H8 H 1 7.0816 0.0000 . 1 . . . . A 221 G H8 . 30868 1 456 . 1 . 1 100 100 A H1' H 1 5.9074 0.0000 . 1 . . . . A 222 A H1' . 30868 1 457 . 1 . 1 100 100 A H2 H 1 7.3996 0.0000 . 1 . . . . A 222 A H2 . 30868 1 458 . 1 . 1 100 100 A H2' H 1 4.7090 0.0000 . 1 . . . . A 222 A H2' . 30868 1 459 . 1 . 1 100 100 A H3' H 1 4.6215 0.0000 . 1 . . . . A 222 A H3' . 30868 1 460 . 1 . 1 100 100 A H8 H 1 7.6269 0.0000 . 1 . . . . A 222 A H8 . 30868 1 461 . 1 . 1 101 101 G H1' H 1 5.6466 0.0000 . 1 . . . . A 223 G H1' . 30868 1 462 . 1 . 1 101 101 G H2' H 1 4.4637 0.0000 . 1 . . . . A 223 G H2' . 30868 1 463 . 1 . 1 101 101 G H3' H 1 4.3972 0.0000 . 1 . . . . A 223 G H3' . 30868 1 464 . 1 . 1 101 101 G H8 H 1 7.1817 0.0000 . 1 . . . . A 223 G H8 . 30868 1 465 . 1 . 1 102 102 C H1' H 1 5.5206 0.0000 . 1 . . . . A 224 C H1' . 30868 1 466 . 1 . 1 102 102 C H2' H 1 4.4043 0.0000 . 1 . . . . A 224 C H2' . 30868 1 467 . 1 . 1 102 102 C H3' H 1 4.3608 0.0000 . 1 . . . . A 224 C H3' . 30868 1 468 . 1 . 1 102 102 C H5 H 1 5.1435 0.0000 . 1 . . . . A 224 C H5 . 30868 1 469 . 1 . 1 102 102 C H6 H 1 7.5904 0.0000 . 1 . . . . A 224 C H6 . 30868 1 470 . 1 . 1 103 103 C H1' H 1 5.7456 0.0000 . 1 . . . . A 225 C H1' . 30868 1 471 . 1 . 1 103 103 C H2' H 1 4.0356 0.0000 . 1 . . . . A 225 C H2' . 30868 1 472 . 1 . 1 103 103 C H3' H 1 4.1400 0.0000 . 1 . . . . A 225 C H3' . 30868 1 473 . 1 . 1 103 103 C H5 H 1 5.4205 0.0000 . 1 . . . . A 225 C H5 . 30868 1 474 . 1 . 1 103 103 C H6 H 1 7.6019 0.0000 . 1 . . . . A 225 C H6 . 30868 1 stop_ save_