data_25534
#######################
# Entry information #
#######################
save_entry_information
_Saveframe_category entry_information
_Entry_title
;
RNA structure determination by solid-state NMR spectroscopy
;
_BMRB_accession_number 25534
_BMRB_flat_file_name bmr25534.str
_Entry_type original
_Submission_date 2015-03-12
_Accession_date 2015-03-12
_Entry_origination author
_NMR_STAR_version 2.1.1
_Experimental_method NMR
_Details .
loop_
_Author_ordinal
_Author_family_name
_Author_given_name
_Author_middle_initials
_Author_family_title
1 Marchanka Alexander . .
2 Simon Bernd . .
3 Althoff-Ospelt Gerhard . .
4 Carlomagno Teresa . .
stop_
loop_
_Saveframe_category_type
_Saveframe_category_type_count
assigned_chemical_shifts 1
stop_
loop_
_Data_type
_Data_type_count
"13C chemical shifts" 173
"15N chemical shifts" 49
"31P chemical shifts" 9
stop_
loop_
_Revision_date
_Revision_keyword
_Revision_author
_Revision_detail
2016-08-29 update BMRB 'update entry citation'
2015-05-08 original author 'original release'
stop_
_Original_release_date 2015-05-08
save_
#############################
# Citation for this entry #
#############################
save_citations
_Saveframe_category entry_citation
_Citation_full .
_Citation_title
;
RNA structure determination by solid-state NMR spectroscopy
;
_Citation_status published
_Citation_type journal
_CAS_abstract_code .
_MEDLINE_UI_code .
_PubMed_ID 25960310
loop_
_Author_ordinal
_Author_family_name
_Author_given_name
_Author_middle_initials
_Author_family_title
1 Marchanka Alexander . .
2 Simon Bernd . .
3 Althoff-Ospelt Gerhard . .
4 Carlomagno Teresa . .
stop_
_Journal_abbreviation 'Nat. Commun.'
_Journal_volume 6
_Journal_issue .
_Journal_CSD .
_Book_chapter_title .
_Book_volume .
_Book_series .
_Book_ISBN .
_Conference_state_province .
_Conference_abstract_number .
_Page_first 7024
_Page_last 7024
_Year 2015
_Details .
save_
##################################
# Molecular system description #
##################################
save_assembly
_Saveframe_category molecular_system
_Mol_system_name "26mer Box C/D RNA (5'-R(P*CP*UP*GP*AP*GP*CP*UP*CP*GP*AP*AP*AP*GP*AP*GP*CP*AP*AP*UP*GP*AP*UP*G)-3')"
_Enzyme_commission_number .
loop_
_Mol_system_component_name
_Mol_label
entity $entity
stop_
_System_molecular_weight .
_System_physical_state native
_System_oligomer_state ?
_System_paramagnetic no
_System_thiol_state .
_Database_query_date .
_Details .
save_
########################
# Monomeric polymers #
########################
save_entity
_Saveframe_category monomeric_polymer
_Mol_type polymer
_Mol_polymer_class RNA
_Name_common '26mer Box C/D RNA'
_Molecular_mass 7450.573
_Mol_thiol_state 'not present'
_Details .
##############################
# Polymer residue sequence #
##############################
_Residue_count 26
_Mol_residue_sequence
;
GCUGAGCUCGAAAGAGCAAU
GAUGUC
;
loop_
_Residue_seq_code
_Residue_label
1 G 2 C 3 U 4 G 5 A
6 G 7 C 8 U 9 C 10 G
11 A 12 A 13 A 14 G 15 A
16 G 17 C 18 A 19 A 20 U
21 G 22 A 23 U 24 G 25 U
26 C
stop_
_Sequence_homology_query_date .
_Sequence_homology_query_revised_last_date .
save_
####################
# Natural source #
####################
save_natural_source
_Saveframe_category natural_source
loop_
_Mol_label
_Organism_name_common
_NCBI_taxonomy_ID
_Superkingdom
_Kingdom
_Genus
_Species
$entity 'E. coli' 562 Bacteria . Escherichia coli
stop_
save_
#########################
# Experimental source #
#########################
save_experimental_source
_Saveframe_category experimental_source
loop_
_Mol_label
_Production_method
_Host_organism_name_common
_Genus
_Species
_Strain
_Vector_name
$entity 'enzymatic semisynthesis' . . . . .
stop_
save_
#####################################
# Sample contents and methodology #
#####################################
########################
# Sample description #
########################
save_sample_1
_Saveframe_category sample
_Sample_type microcrystalline
_Details .
loop_
_Mol_label
_Concentration_value
_Concentration_value_units
_Isotopic_labeling
$entity 20 mg/mL 'nucleotide-type-selective [U-99% 13C; U-99% 15N]'
H2O 100 % 'natural abundance'
stop_
save_
############################
# Computer software used #
############################
save_CNS
_Saveframe_category software
_Name CNS
_Version 1.2
loop_
_Task
'data analysis'
stop_
_Details .
save_
#########################
# Experimental detail #
#########################
##################################
# NMR Spectrometer definitions #
##################################
save_spectrometer_1
_Saveframe_category NMR_spectrometer
_Manufacturer Bruker
_Model Avance
_Field_strength 700
_Details .
save_
save_spectrometer_2
_Saveframe_category NMR_spectrometer
_Manufacturer Bruker
_Model Avance
_Field_strength 600
_Details .
save_
#############################
# NMR applied experiments #
#############################
save_(13C,15N-TEDOR)-13C,13C_PDSD_1
_Saveframe_category NMR_applied_experiment
_Experiment_name '(13C,15N-TEDOR)-13C,13C PDSD'
_Sample_label $sample_1
save_
save_13C-31P_TEDOR_2
_Saveframe_category NMR_applied_experiment
_Experiment_name '13C-31P TEDOR'
_Sample_label $sample_1
save_
save_CHHC_3
_Saveframe_category NMR_applied_experiment
_Experiment_name CHHC
_Sample_label $sample_1
save_
save_NHHC_4
_Saveframe_category NMR_applied_experiment
_Experiment_name NHHC
_Sample_label $sample_1
save_
save_CN-TEDOR_5
_Saveframe_category NMR_applied_experiment
_Experiment_name CN-TEDOR
_Sample_label $sample_1
save_
#######################
# Sample conditions #
#######################
save_sample_conditions_1
_Saveframe_category sample_conditions
_Details .
loop_
_Variable_type
_Variable_value
_Variable_value_error
_Variable_value_units
pH 7.5 . pH
temperature 260 . K
stop_
save_
####################
# NMR parameters #
####################
##############################
# Assigned chemical shifts #
##############################
################################
# Chemical shift referencing #
################################
save_chemical_shift_reference_1
_Saveframe_category chemical_shift_reference
_Details .
loop_
_Mol_common_name
_Atom_type
_Atom_isotope_number
_Atom_group
_Chem_shift_units
_Chem_shift_value
_Reference_method
_Reference_type
_External_reference_sample_geometry
_External_reference_location
_External_reference_axis
_Indirect_shift_ratio
adamantane C 13 'methyl carbons' ppm 38.48 external direct . . . 1
adamantane N 15 'methyl carbons' ppm 38.48 na indirect . . . 0.402980
adamantane P 31 'methyl carbons' ppm 38.48 na indirect . . . 1.609894
stop_
save_
###################################
# Assigned chemical shift lists #
###################################
###################################################################
# Chemical Shift Ambiguity Index Value Definitions #
# #
# The values other than 1 are used for those atoms with different #
# chemical shifts that cannot be assigned to stereospecific atoms #
# or to specific residues or chains. #
# #
# Index Value Definition #
# #
# 1 Unique (including isolated methyl protons, #
# geminal atoms, and geminal methyl #
# groups with identical chemical shifts) #
# (e.g. ILE HD11, HD12, HD13 protons) #
# 2 Ambiguity of geminal atoms or geminal methyl #
# proton groups (e.g. ASP HB2 and HB3 #
# protons, LEU CD1 and CD2 carbons, or #
# LEU HD11, HD12, HD13 and HD21, HD22, #
# HD23 methyl protons) #
# 3 Aromatic atoms on opposite sides of #
# symmetrical rings (e.g. TYR HE1 and HE2 #
# protons) #
# 4 Intraresidue ambiguities (e.g. LYS HG and #
# HD protons or TRP HZ2 and HZ3 protons) #
# 5 Interresidue ambiguities (LYS 12 vs. LYS 27) #
# 6 Intermolecular ambiguities (e.g. ASP 31 CA #
# in monomer 1 and ASP 31 CA in monomer 2 #
# of an asymmetrical homodimer, duplex #
# DNA assignments, or other assignments #
# that may apply to atoms in one or more #
# molecule in the molecular assembly) #
# 9 Ambiguous, specific ambiguity not defined #
# #
###################################################################
save_assigned_chem_shift_list_1
_Saveframe_category assigned_chemical_shifts
_Details .
loop_
_Experiment_label
'(13C,15N-TEDOR)-13C,13C PDSD'
'13C-31P TEDOR'
stop_
loop_
_Sample_label
$sample_1
stop_
_Sample_conditions_label $sample_conditions_1
_Chem_shift_reference_set_label $chemical_shift_reference_1
_Mol_system_component_name entity
_Text_data_format .
_Text_data .
loop_
_Atom_shift_assign_ID
_Residue_author_seq_code
_Residue_seq_code
_Residue_label
_Atom_name
_Atom_type
_Chem_shift_value
_Chem_shift_value_error
_Chem_shift_ambiguity_code
1 2 2 C C2 C 158.1 0 1
2 3 3 U C1' C 93.7 0 1
3 3 3 U C2 C 154.1 0 1
4 3 3 U C2' C 75.6 0 1
5 3 3 U C3' C 71.9 0 1
6 3 3 U C4 C 165.7 0 1
7 3 3 U C4' C 82.9 0 1
8 3 3 U C5 C 104.7 0 1
9 3 3 U C5' C 64.0 0 1
10 3 3 U C6 C 139.3 0 1
11 3 3 U N1 N 145.5 0 1
12 3 3 U N3 N 157.1 0 1
13 4 4 G C1' C 90.1 0 1
14 4 4 G C2 C 156.6 0 1
15 4 4 G C2' C 76.0 0 1
16 4 4 G C3' C 79.6 0 1
17 4 4 G C4 C 155.3 0 1
18 4 4 G C4' C 88.3 0 1
19 4 4 G C5 C 116.7 0 1
20 4 4 G C5' C 67.8 0 1
21 4 4 G C6 C 160.3 0 1
22 4 4 G C8 C 139.0 0 1
23 4 4 G N1 N 145.0 0 1
24 4 4 G N2 N 81.4 0 1
25 4 4 G N9 N 167.0 0 1
26 4 4 G P P -3.8 0 1
27 5 5 A C1' C 88.1 0 1
28 5 5 A C2 C 156.0 0 1
29 5 5 A C2' C 78.4 0 1
30 5 5 A C3' C 80.0 0 1
31 5 5 A C4 C 150.9 0 1
32 5 5 A C4' C 83.4 0 1
33 5 5 A C5 C 118.8 0 1
34 5 5 A C5' C 70.3 0 1
35 5 5 A C6 C 156.6 0 1
36 5 5 A C8 C 139.8 0 1
37 5 5 A N6 N 81.4 0 1
38 5 5 A N9 N 166.9 0 1
39 5 5 A P P -0.7 0 1
40 6 6 G C1' C 92.6 0 1
41 6 6 G C2 C 158.2 0 1
42 6 6 G C2' C 75.8 0 1
43 6 6 G C3' C 77.3 0 1
44 6 6 G C4 C 152.2 0 1
45 6 6 G C4' C 83.4 0 1
46 6 6 G C5 C 119.5 0 1
47 6 6 G C5' C 70.9 0 1
48 6 6 G C6 C 157.9 0 1
49 6 6 G C8 C 139.0 0 1
50 6 6 G N1 N 148.9 0 1
51 6 6 G N2 N 75.8 0 1
52 6 6 G N9 N 171.1 0 1
53 6 6 G P P -3.8 0 1
54 7 7 C C1' C 93.9 0 1
55 7 7 C C2 C 159.3 0 1
56 7 7 C C2' C 75.4 0 1
57 7 7 C C3' C 72.1 0 1
58 7 7 C C4 C 168.1 0 1
59 7 7 C C4' C 82.0 0 1
60 7 7 C C5 C 97.1 0 1
61 7 7 C C5' C 64.3 0 1
62 7 7 C C6 C 142.2 0 1
63 7 7 C N1 N 152.2 0 1
64 7 7 C N3 N 196.3 0 1
65 7 7 C N4 N 100.1 0 1
66 8 8 U C1' C 93.7 0 1
67 8 8 U C2 C 152.8 0 1
68 8 8 U C2' C 75.5 0 1
69 8 8 U C3' C 72.1 0 1
70 8 8 U C4 C 169.4 0 1
71 8 8 U C4' C 82.1 0 1
72 8 8 U C5 C 103.2 0 1
73 8 8 U C5' C 64.3 0 1
74 8 8 U C6 C 142.3 0 1
75 8 8 U N1 N 145.5 0 1
76 8 8 U N3 N 163.6 0 1
77 9 9 C C1' C 93.2 0 1
78 9 9 C C2 C 158.2 0 1
79 9 9 C C2' C 75.9 0 1
80 9 9 C C3' C 71.4 0 1
81 9 9 C C4 C 168.1 0 1
82 9 9 C C4' C 81.2 0 1
83 9 9 C C5 C 98.2 0 1
84 9 9 C C5' C 64.2 0 1
85 9 9 C C6 C 140.2 0 1
86 9 9 C N1 N 151.7 0 1
87 9 9 C N3 N 197.7 0 1
88 9 9 C N4 N 99.1 0 1
89 10 10 G C1' C 94.0 0 1
90 10 10 G C2' C 75.7 0 1
91 10 10 G C3' C 71.5 0 1
92 10 10 G C4 C 155.5 0 1
93 10 10 G C4' C 81.8 0 1
94 10 10 G C5' C 64.4 0 1
95 10 10 G C6 C 161.7 0 1
96 10 10 G C8 C 136.3 0 1
97 10 10 G N1 N 146.2 0 1
98 10 10 G N2 N 75.5 0 1
99 10 10 G N9 N 171.3 0 1
100 14 14 G C1' C 92.6 0 1
101 14 14 G C2 C 157.5 0 1
102 14 14 G C2' C 74.6 0 1
103 14 14 G C4 C 151.9 0 1
104 14 14 G C5 C 119.2 0 1
105 14 14 G C5' C 69.5 0 1
106 14 14 G C8 C 137.4 0 1
107 14 14 G N1 N 148.2 0 1
108 14 14 G N2 N 75.4 0 1
109 14 14 G N9 N 170.1 0 1
110 15 15 A C1' C 92.9 0 1
111 15 15 A C2 C 153.0 0 1
112 15 15 A C2' C 75.5 0 1
113 15 15 A C3' C 72.3 0 1
114 15 15 A C4 C 148.6 0 1
115 15 15 A C4' C 81.8 0 1
116 15 15 A C5 C 120.6 0 1
117 15 15 A C5' C 65.2 0 1
118 15 15 A C6 C 157.6 0 1
119 15 15 A C8 C 139.5 0 1
120 15 15 A N1 N 222.1 0 1
121 15 15 A N9 N 171.5 0 1
122 16 16 G C1' C 92.5 0 1
123 16 16 G C2 C 157.0 0 1
124 16 16 G C2' C 75.8 0 1
125 16 16 G C3' C 72.0 0 1
126 16 16 G C4 C 151.6 0 1
127 16 16 G C4' C 81.7 0 1
128 16 16 G C5 C 119.0 0 1
129 16 16 G C5' C 64.3 0 1
130 16 16 G C6 C 160.9 0 1
131 16 16 G C8 C 135.6 0 1
132 16 16 G N1 N 148.0 0 1
133 16 16 G N2 N 74.6 0 1
134 16 16 G N9 N 170.9 0 1
135 17 17 C C1' C 93.6 0 1
136 17 17 C C2 C 158.5 0 1
137 17 17 C C2' C 75.7 0 1
138 17 17 C C3' C 71.7 0 1
139 17 17 C C4 C 167.6 0 1
140 17 17 C C4' C 81.6 0 1
141 17 17 C C5 C 97.9 0 1
142 17 17 C C5' C 64.1 0 1
143 17 17 C C6 C 139.0 0 1
144 17 17 C N1 N 150.5 0 1
145 17 17 C N3 N 195.9 0 1
146 17 17 C N4 N 99.0 0 1
147 18 18 A C1' C 94.1 0 1
148 18 18 A C2 C 156.0 0 1
149 18 18 A C2' C 76.6 0 1
150 18 18 A C3' C 72.5 0 1
151 18 18 A C4 C 150.6 0 1
152 18 18 A C4' C 81.6 0 1
153 18 18 A C5 C 121.6 0 1
154 18 18 A C5' C 64.6 0 1
155 18 18 A C6 C 157.7 0 1
156 18 18 A C8 C 138.6 0 1
157 18 18 A N6 N 80.7 0 1
158 18 18 A N7 N 230.9 0 1
159 18 18 A N9 N 173.2 0 1
160 18 18 A P P -4.2 0 1
161 19 19 A C1' C 89.7 0 1
162 19 19 A C2 C 154.5 0 1
163 19 19 A C2' C 72.2 0 1
164 19 19 A C3' C 78.5 0 1
165 19 19 A C4 C 150.5 0 1
166 19 19 A C4' C 85.1 0 1
167 19 19 A C5 C 121.8 0 1
168 19 19 A C5' C 67.4 0 1
169 19 19 A C6 C 156.4 0 1
170 19 19 A C8 C 145.8 0 1
171 19 19 A N6 N 76.3 0 1
172 19 19 A N7 N 228.2 0 1
173 19 19 A N9 N 164.7 0 1
174 19 19 A P P -1.8 0 1
175 20 20 U C1' C 89.4 0 1
176 20 20 U C2 C 154.2 0 1
177 20 20 U C2' C 75.4 0 1
178 20 20 U C3' C 80.5 0 1
179 20 20 U C4 C 167.9 0 1
180 20 20 U C4' C 84.2 0 1
181 20 20 U C5 C 105.7 0 1
182 20 20 U C5' C 69.5 0 1
183 20 20 U C6 C 146.8 0 1
184 20 20 U N1 N 147.4 0 1
185 20 20 U N3 N 158.5 0 1
186 20 20 U P P -5.3 0 1
187 21 21 G C1' C 87.5 0 1
188 21 21 G C2' C 77.5 0 1
189 21 21 G C3' C 80.0 0 1
190 21 21 G C4 C 155.7 0 1
191 21 21 G C4' C 87.5 0 1
192 21 21 G C5 C 117.6 0 1
193 21 21 G C5' C 68.3 0 1
194 21 21 G C6 C 160.3 0 1
195 21 21 G C8 C 139.1 0 1
196 21 21 G N1 N 145.6 0 1
197 21 21 G N2 N 81.0 0 1
198 21 21 G N9 N 168.8 0 1
199 21 21 G P P -6.0 0 1
200 22 22 A C1' C 92.4 0 1
201 22 22 A C2 C 156.0 0 1
202 22 22 A C2' C 75.7 0 1
203 22 22 A C3' C 72.4 0 1
204 22 22 A C4 C 147.5 0 1
205 22 22 A C4' C 82.9 0 1
206 22 22 A C5 C 120.8 0 1
207 22 22 A C5' C 65.8 0 1
208 22 22 A C6 C 157.1 0 1
209 22 22 A C8 C 140.0 0 1
210 22 22 A N6 N 81.2 0 1
211 22 22 A N9 N 170.2 0 1
212 22 22 A P P -0.1 0 1
213 23 23 U C1' C 93.0 0 1
214 23 23 U C2 C 151.0 0 1
215 23 23 U C2' C 74.6 0 1
216 23 23 U C3' C 72.1 0 1
217 23 23 U C4 C 167.6 0 1
218 23 23 U C4' C 82.3 0 1
219 23 23 U C5 C 103.8 0 1
220 23 23 U C5' C 63.1 0 1
221 23 23 U C6 C 140.0 0 1
222 23 23 U N1 N 144.7 0 1
223 23 23 U N3 N 155.7 0 1
224 23 23 U P P -4.2 0 1
225 24 24 G C1' C 92.6 0 1
226 24 24 G C2 C 157.4 0 1
227 24 24 G C4 C 152.9 0 1
228 24 24 G C5 C 118.1 0 1
229 24 24 G C8 C 136.2 0 1
230 24 24 G N2 N 76.5 0 1
231 24 24 G N9 N 172.4 0 1
stop_
save_