warning: failed to read freetag - '
_struct_conn\.details'
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR7403
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Theimer, C.; Jady, B.; Chim, N.; Richard, P.; Breece, K.; Kiss, T.; Feigon, J.. "Structural and functional characterization of human telomerase RNA processing and cajal body localization signals" Mol. Cell 27, 869-881 (2007).
PubMed: 17889661
Assembly members:
Human_telomerase_RNA_CR7_terminal_hairpin_loop, polymer, 24 residues, Formula weight is not available
Natural source: Common Name: human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
Human_telomerase_RNA_CR7_terminal_hairpin_loop: GGAGUGCCUGAGCUGUGGCA
CUCC
| Data type | Count |
| 13C chemical shifts | 191 |
| 15N chemical shifts | 54 |
| 1H chemical shifts | 178 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | Human telomerase RNA CR7 terminal hairpin loop | 1 |
Entity 1, Human telomerase RNA CR7 terminal hairpin loop 24 residues - Formula weight is not available
| 1 | G | G | A | G | U | G | C | C | U | G | ||||
| 2 | A | G | C | U | G | U | G | G | C | A | ||||
| 3 | C | U | C | C |
sample_1: telomerase_RNA_CR7 1 mM; sodium phosphate 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%
sample_2: telomerase_RNA_CR7, [U-13C; U-15N], 1 mM; sodium phosphate 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%
sample_conditions_1: ionic strength: 200 mM; pH: 6.3; pressure: 1 atm; temperature: 283 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D NOESY (11echo and watergate) | sample_1 | isotropic | sample_conditions_1 |
| 2D NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D TOCSY | sample_1 | isotropic | sample_conditions_1 |
| Natural abundance 2D 13C HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 15N-HMQC | sample_2 | isotropic | sample_conditions_1 |
| 2D 15N-CPMG-NOESY | sample_2 | isotropic | sample_conditions_1 |
| 2D JNN-HNN-COSY | sample_2 | isotropic | sample_conditions_1 |
| 2D 13C-HSQC | sample_2 | isotropic | sample_conditions_1 |
| 2D HCCH-COCSY | sample_2 | isotropic | sample_conditions_1 |
| 3D HCCH-TOCSY | sample_2 | isotropic | sample_conditions_1 |
| 2D 31P spin echo difference HCCH/HSQC/HMQC | sample_2 | isotropic | sample_conditions_1 |
| 2D CT-CE-HSQC | sample_2 | isotropic | sample_conditions_1 |
xwinnmr v2.6, Bruker - collection
xwinnmr v2.6, Bruker - processing
AURELIA v3.108, Brunger - data analysis
X-PLOR v3.851, NIH - structure solution
X-PLOR v3.851, NIH - refinement