Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR53784
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Sahayasheela, Vinodh. "Mitochondrial-generated G-quadruplex forming lncRNAs Regulate Heme Homeostasis
" iscience ., .-..
Assembly members:
entity_1, polymer, 21 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGUUAGGGUUAGGGUUAGG
G
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | lncND5-rG4-1 | 1 |
| 2 | lncND5-rG4-3 | 1 |
Entity 1, lncND5-rG4-1 21 residues - Formula weight is not available
| 1 | G | G | G | U | U | A | G | G | G | U | ||||
| 2 | U | A | G | G | G | U | U | A | G | G | ||||
| 3 | G |
sample_1: lncND5-rG4-1 RNA G-quadruplex 200 uM; lncND5-rG4-3 RNA G-quadruplex 200 uM; potassium phosphate buffer 20 mM; KCl 100 mM
sample_conditions_1: ionic strength: 0.1 M; pH: 6.5; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 1D 1H | sample_1 | isotropic | sample_conditions_1 |
Bruker TopSpin - format conversion, peak picking