Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR53703
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Finol, Esteban; Damberger, Fred; Krepl, Miroslav; Flugel, Timo; Dietrich, Priscilla; Michaels, Thomas; Vogeli, Beat; Sponer, Jiri; Allain, Frederic H-T. "Newton's cradle-like allosteric mechanism explains regulatory RsmE RNA binding
" Nat. Commun. ., .-. (2026).
PubMed: 42020417
Assembly members:
entity_1, polymer, 70 residues, 7937.068 Da.
entity_2, polymer, 22 residues, Formula weight is not available
Natural source: Common Name: Pseudomonas protegens Taxonomy ID: 380021 Superkingdom: Bacteria Kingdom: not available Genus/species: Pseudomonas protegens
Experimental source: Production method: recombinant technology Host organism: Escherichia coli Vector: pET28b-64WRsmE
Entity Sequences (FASTA):
entity_1: MLILTRKVGESINIGDDITI
TILGVSGQQVRIGINAPKDV
AVHREEIYQRIQAGLTAPDK
RETWHHHHHH
entity_2: GGGCCAUCAAGGACGAUGGU
CC
| Data type | Count |
| 13C chemical shifts | 520 |
| 15N chemical shifts | 133 |
| 1H chemical shifts | 873 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RsmE, chain 1 | 1 |
| 2 | RsmE, chain 2 | 1 |
| 3 | SL2 | 2 |
Entity 1, RsmE, chain 1 70 residues - 7937.068 Da.
The C-terminal native P64 has been mutated to W64 to enhance absorbance for easier quantification of protein concentration, and it is followed by 6 Histidines (H65-H70) for protein purification.
| 1 | MET | LEU | ILE | LEU | THR | ARG | LYS | VAL | GLY | GLU | |
| 2 | SER | ILE | ASN | ILE | GLY | ASP | ASP | ILE | THR | ILE | |
| 3 | THR | ILE | LEU | GLY | VAL | SER | GLY | GLN | GLN | VAL | |
| 4 | ARG | ILE | GLY | ILE | ASN | ALA | PRO | LYS | ASP | VAL | |
| 5 | ALA | VAL | HIS | ARG | GLU | GLU | ILE | TYR | GLN | ARG | |
| 6 | ILE | GLN | ALA | GLY | LEU | THR | ALA | PRO | ASP | LYS | |
| 7 | ARG | GLU | THR | TRP | HIS | HIS | HIS | HIS | HIS | HIS |
Entity 2, SL2 22 residues - Formula weight is not available
Nucleotides G17 and C38 form the first base-pair of the stem region which extends up to and includes C24-G31. The loop consists of A25-C30.
| 1 | G | G | G | C | C | A | U | C | A | A | ||||
| 2 | G | G | A | C | G | A | U | G | G | U | ||||
| 3 | C | C |
sample_1: RsmE, [U-99% 13C; U-99% 15N], 0.45 ± 0.05 mM; NaCl 30 ± 0.05 mM; Potassium phosphate, pH 7.2 50 ± 0.05 mM; SL2 0.24 ± 0.05 mM
sample_2: RsmE, [U-99% 13C; U-99% 15N], 0.45 ± 0.05 mM; NaCl 30 ± 0.05 mM; Potassium phosphate, pH 7.2 50 ± 0.05 mM; SL2 0.22 ± 0.05 mM
sample_conditions_1: ionic strength: 0.1 M; pH: 7.2; pressure: 1 atm; temperature: 313 K
sample_conditions_2: ionic strength: 0.1 M; pH: 7.2; pressure: 1 atm; temperature: 313 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aliphatic | sample_1 | isotropic | sample_conditions_2 |
| 3D HCCH-TOCSY | sample_1 | isotropic | sample_conditions_2 |
| 3D 15N-separated NOESY | sample_1 | isotropic | sample_conditions_1 |
| 3D 1H-13C NOESY aliphatic | sample_1 | isotropic | sample_conditions_1 |
| 3D HN(CO)CA | sample_1 | isotropic | sample_conditions_1 |
| 3D HNCACB | sample_1 | isotropic | sample_conditions_1 |
| 3D HNCO | sample_1 | isotropic | sample_conditions_1 |
| 3D HNCACO | sample_1 | isotropic | sample_conditions_1 |
| 3D HNCA | sample_1 | isotropic | sample_conditions_1 |
NMRFAM-SPARKY v3.133 - chemical shift assignment
Download HSQC peak lists in one of the following formats:
CSV: Backbone
or all simulated peaks
SPARKY: Backbone
or all simulated peaks