Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR53498
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Nishimura, Yuhei; Tokunaga, Yuji; Kofuku, Yutaka; Shiraishi, Yutaro; Imai, Shunsuke; Gong, Jing; Ohara, Kazuhiro; Okude, Junya; Ueda, Takumi; Torizawa, Takuya; Shimada, Ichio; Takeuchi, Koh. "Pre-miR-21 Conformational Equilibrium Modulates the Efficacy of the Maturation Inhibitor L50
" ACS Chem. Biol. ., .-. (2026).
PubMed: 42467802
Assembly members:
entity_1, polymer, 14 residues, Formula weight is not available
entity_2, polymer, 43 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: RVRTRGKRRIRRXP
entity_2: GGGACUGAUGUUGACUGUUG
AAUCUCAUGGCAACACCAGU
CCC
| Data type | Count |
| 13C chemical shifts | 21 |
| 1H chemical shifts | 42 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | L50 | 1 |
| 2 | pre-miR-21_39 | 2 |
Entity 1, L50 14 residues - Formula weight is not available
Residues 13 is D-Pro.
| 1 | ARG | VAL | ARG | THR | ARG | GLY | LYS | ARG | ARG | ILE | ||||
| 2 | ARG | ARG | DPR | PRO |
Entity 2, pre-miR-21_39 43 residues - Formula weight is not available
| 1 | G | G | G | A | C | U | G | A | U | G | ||||
| 2 | U | U | G | A | C | U | G | U | U | G | ||||
| 3 | A | A | U | C | U | C | A | U | G | G | ||||
| 4 | C | A | A | C | A | C | C | A | G | U | ||||
| 5 | C | C | C |
sample_1: L50 400 uM; pre-miR-21_39, [U-13C; U-15N]-Ade, 600 uM; D2O 99.96%; TRIS, [U-99% 2H], 20 mM; Malonic Acid, [U-99% 2H], 20 mM; EDTA 0.01 mM
sample_conditions_1: ionic strength: 0.02 M; pH: 7.2; pressure: 1 atm; temperature: 310 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
NMRFAM-SPARKY - chemical shift assignment, chemical shift calculation, data analysis
TOPSPIN - collection, processing