Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR53443
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Yang, Yuan; Murrali, Maria; Galvan, Sabrina; Wang, Yaqiang; Stephen, Christine; Ajjampore, Neha; Wang, Xiaoyu; Feigon, Juli. "HEXIM1 inter-monomer autoinhibition governs 7SK RNA binding specificity and P-TEFb inactivation" Nat. Commun. ., .-. (2026).
PubMed: 41540012
Assembly members:
entity_1, polymer, 31 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GGCCAUUGAUCGCCUUCGGG
CUGAUCUGGCC
| Data type | Count |
| 13C chemical shifts | 54 |
| 1H chemical shifts | 113 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | 7SK SL1-dI | 1 |
Entity 1, 7SK SL1-dI 31 residues - Formula weight is not available
| 1 | G | G | C | C | A | U | U | G | A | U | ||||
| 2 | C | G | C | C | U | U | C | G | G | G | ||||
| 3 | C | U | G | A | U | C | U | G | G | C | ||||
| 4 | C |
sample_1: sodium phosphate 50 mM; sodium azide 0.02 % w/v; D2O 5 % v/v; potassium chloride 150 mM; 7SK SL1-dI RNA 1.2 mM
sample_2: sodium phosphate 50 mM; sodium azide 0.02 % w/v; D2O 100 % v/v; potassium chloride 150 mM; 7SK SL1-dI RNA 1.2 mM
sample_conditions_1: ionic strength: 200 mM; pH: 6.2; pressure: 1 atm; temperature: 283.15 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aromatic | sample_2 | isotropic | sample_conditions_1 |
TOPSPIN - collection
NMRPipe - processing
NMRFAM-SPARKY - chemical shift assignment