Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR53442
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Yang, Yuan; Murrali, Maria; Galvan, Sabrina; Wang, Yaqiang; Stephen, Christine; Ajjampore, Neha; Wang, Xiaoyu; Feigon, Juli. "HEXIM1 inter-monomer autoinhibition governs 7SK RNA binding specificity and P-TEFb inactivation" Nat. Comm. ., .-. (2025).
Assembly members:
entity_1, polymer, 113 residues, Formula weight is not available
entity_2, polymer, 28 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: recombinant technology Host organism: Escherichia coli Vector: pETDuet-1
Entity Sequences (FASTA):
entity_1: GGQQQRQLGKKKHRRRPSKK
KRHWKPYYKLTWEEKKKFDE
KQSLRASRIRAEMFAKGQPV
APYNTTQFLMDDHDQEEPDL
KTGLYSKRAAAKSDDTSDDD
FMEEGGEEDGGSD
entity_2: GGCCAUUGAUCGCUUCGGCG
AUCUGGCC
| Data type | Count |
| 13C chemical shifts | 229 |
| 15N chemical shifts | 108 |
| 1H chemical shifts | 109 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | BR-L-AR | 1 |
| 2 | 7SK SL1-dI-deltaU | 2 |
Entity 1, BR-L-AR 113 residues - Formula weight is not available
Amino acids 142 through 253 from human Hexim1. A non-native glycine remains at the N-terminus of the final BR-L-AR after TEV protease cleavage.
| 1 | GLY | GLY | GLN | GLN | GLN | ARG | GLN | LEU | GLY | LYS | ||||
| 2 | LYS | LYS | HIS | ARG | ARG | ARG | PRO | SER | LYS | LYS | ||||
| 3 | LYS | ARG | HIS | TRP | LYS | PRO | TYR | TYR | LYS | LEU | ||||
| 4 | THR | TRP | GLU | GLU | LYS | LYS | LYS | PHE | ASP | GLU | ||||
| 5 | LYS | GLN | SER | LEU | ARG | ALA | SER | ARG | ILE | ARG | ||||
| 6 | ALA | GLU | MET | PHE | ALA | LYS | GLY | GLN | PRO | VAL | ||||
| 7 | ALA | PRO | TYR | ASN | THR | THR | GLN | PHE | LEU | MET | ||||
| 8 | ASP | ASP | HIS | ASP | GLN | GLU | GLU | PRO | ASP | LEU | ||||
| 9 | LYS | THR | GLY | LEU | TYR | SER | LYS | ARG | ALA | ALA | ||||
| 10 | ALA | LYS | SER | ASP | ASP | THR | SER | ASP | ASP | ASP | ||||
| 11 | PHE | MET | GLU | GLU | GLY | GLY | GLU | GLU | ASP | GLY | ||||
| 12 | GLY | SER | ASP |
Entity 2, 7SK SL1-dI-deltaU 28 residues - Formula weight is not available
| 1 | G | G | C | C | A | U | U | G | A | U | ||||
| 2 | C | G | C | U | U | C | G | G | C | G | ||||
| 3 | A | U | C | U | G | G | C | C |
sample_1: Hexim1 BR-L-AR, [U-98% 13C; U-98% 15N], 0.22 mM; sodium phosphate 50 mM; sodium azide 0.02 % w/v; D2O 5 % v/v; potassium chloride 150 mM; 7SK SL1-dI-deltaU RNA 0.25 mM
sample_conditions_1: ionic strength: 200 mM; pH: 6.2; pressure: 1 atm; temperature: 298.15 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 3D CBCA(CO)NH | sample_1 | isotropic | sample_conditions_1 |
| 3D HNCA | sample_1 | isotropic | sample_conditions_1 |
| 3D HNCACB | sample_1 | isotropic | sample_conditions_1 |
| 3D C(CO)NH | sample_1 | isotropic | sample_conditions_1 |
TOPSPIN - collection
NMRPipe - processing
istHMS - processing
NMRFAM-SPARKY - chemical shift assignment
| NCBI | NP_006451.1 |
Download HSQC peak lists in one of the following formats:
CSV: Backbone
or all simulated peaks
SPARKY: Backbone
or all simulated peaks