Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR53263
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Aleshintsev, Aleksey; Way, Lindsey; Lai, Ngoc Khanh; Guerra, Bianca; Dorantes, Paloma; Serwaa, Lois Akosua; Anulao, Sealtiel; Molina, Miranda; Wang, Xindan; Kim, HyeongJun. "Bacillus subtilis ParB C-terminal lysine residues are essential for dimerization and in vivo function, indicating their roles in DNA sliding
" Nucleic Acids Res. 54, gkag202-gkag202 (2026).
PubMed: 41830326
Assembly members:
entity_1, polymer, 66 residues, Formula weight is not available
entity_2, polymer, 25 residues, Formula weight is not available
Natural source: Common Name: E. coli Taxonomy ID: 562 Superkingdom: Bacteria Kingdom: not available Genus/species: Escherichia coli
Experimental source: Production method: recombinant technology Host organism: Escherichia coli Vector: pTG011
Entity Sequences (FASTA):
entity_1: QNVPRETKKKEPVKDAVLKE
RESYLQNYFGTTVNIKRQKK
KGKIEIEFFSNEDLDRILEL
LSERES
entity_2: GCGTACATCATTCCCTGATG
TACGC
| Data type | Count |
| T1 relaxation values | 58 |
| T2 relaxation values | 55 |
| heteronuclear NOE values | 53 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | CTD_BsParB | 1 |
| 2 | DNA | 2 |
Entity 1, CTD_BsParB 66 residues - Formula weight is not available
| 1 | GLN | ASN | VAL | PRO | ARG | GLU | THR | LYS | LYS | LYS | ||||
| 2 | GLU | PRO | VAL | LYS | ASP | ALA | VAL | LEU | LYS | GLU | ||||
| 3 | ARG | GLU | SER | TYR | LEU | GLN | ASN | TYR | PHE | GLY | ||||
| 4 | THR | THR | VAL | ASN | ILE | LYS | ARG | GLN | LYS | LYS | ||||
| 5 | LYS | GLY | LYS | ILE | GLU | ILE | GLU | PHE | PHE | SER | ||||
| 6 | ASN | GLU | ASP | LEU | ASP | ARG | ILE | LEU | GLU | LEU | ||||
| 7 | LEU | SER | GLU | ARG | GLU | SER |
Entity 2, DNA 25 residues - Formula weight is not available
| 1 | DG | DC | DG | DT | DA | DC | DA | DT | DC | DA | ||||
| 2 | DT | DT | DC | DC | DC | DT | DG | DA | DT | DG | ||||
| 3 | DT | DA | DC | DG | DC |
sample_1: CTD_BsParB, [U-100% 15N], 0.4 mM; D2O 10%; DSS 200 mM; PBS 10 mM; DNA hairpin 1.25:1 ratio
sample_conditions_1: pH: 6.1; pressure: 1 atm; temperature: 308 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| T1/R1 relaxation | sample_1 | isotropic | sample_conditions_1 |
| T2/R2 relaxation | sample_1 | isotropic | sample_conditions_1 |
| 15N-(1H) NOE | sample_1 | isotropic | sample_conditions_1 |
NMRPipe - processing
NMRFAM-SPARKY - data analysis