BMRB Entry 52888

Name: NMR assignments of a single A-to-I edited motif in a 20mer dsRNA
Published: 2025-02-12

Click here to enlarge.

PDB ID: 9i8b
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR52888
MolProbity Validation Chart

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry

Nicholas Rego and David Koes
3Dmol.js: molecular visualization with WebGL
Bioinformatics (2015) 31 (8): 1322-1324 doi:10.1093/bioinformatics/btu829

Select model:

I am color blind

Download raw data. Direct link to this display. Help

Title:

NMR assignments of a single A-to-I edited motif in a 20mer dsRNA

Deposition date:

2025-01-31

Original release date:

2025-02-12

Authors:

Mueller-Hermes, Christoph; Sattler, Michael

Citation:

Citation: Mueller-Hermes, Christoph; Piomponi, Valerio; Hilber, Stefan; Asami, Sam; Kreutz, Christoph; Bussi, Giovanni; Sattler, Michael. "A-to-I hyper-editing of dsRNA confers unique conformational dynamics and protein interactions" Nucleic Acids Res. ., .-..

Assembly members:

Assembly members:
entity_1, polymer, 20 residues, Formula weight is not available
entity_2, polymer, 20 residues, Formula weight is not available

Natural source:

Natural source: Common Name: Rat Taxonomy ID: 10116 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Rattus norvegicus

Experimental source:

Experimental source: Production method: chemical synthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
entity_1: ACUGGACAAAUACUCCGAGG
entity_2: CCUCGGAGUAUUUGUCCAGU

Data sets:

assigned_chemical_shifts
- assigned_chemical_shifts_1
- assigned_chemical_shifts_2
homonucl_NOEs
- homonucl_NOEs_1
- homonucl_NOEs_2

Data type	Count
15N chemical shifts	17
1H chemical shifts	128
homonuclear NOE values	229

Additional metadata:

Assembly
Samples and Experiments
Software
Spectrometers
Hide all

Assembly:

Entity Assembly ID	Entity Name	Entity ID
1	A-RNA, TS	1
2	A-RNA, BS	2

Entities:

Entity 1, A-RNA, TS 20 residues - Formula weight is not available

1		A	C	U	G	G	A	C	A	A	A
2		U	A	C	U	C	C	G	A	G	G

Entity 2, A-RNA, BS 20 residues - Formula weight is not available

1		C	C	U	C	G	G	A	G	U	A
2		U	U	U	G	U	C	C	A	G	U

Samples:

sample_1: A-RNA, TS 500 uM; A-RNA, BS 500 uM; sodium phosphate 25 mM; sodium chloride 25 mM

sample_2: A-RNA, TS 500 uM; A-RNA, BS 500 uM; sodium phosphate 25 mM; sodium chloride 25 mM

sample_conditions_1: ionic strength: 0.06 M; pH: 6.4; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 0.06 M; pH: 6.4; pressure: 1 atm; temperature: 278 K

sample_conditions_3: ionic strength: 0.06 M; pH: 6.4; pressure: 1 atm; temperature: 287 K

Experiments:

Name	Sample	Sample state	Sample conditions
2D 1H-15N SOFAST-HMQC	sample_1	isotropic	sample_conditions_3
2D NOESY with watergate and flip-back pulse	sample_1	isotropic	sample_conditions_3
2D 1H-1H NOESY with excitation sculpting using gradients	sample_2	isotropic	sample_conditions_1

Software:

CcpNMR v2.4.2 - chemical shift assignment

TOPSPIN v3.7.0 - processing

NMR spectrometers:

Bruker AVANCE III 600 MHz
Bruker AVANCE III 500 MHz
Bruker AVANCE III 900 MHz
Bruker AVANCE III 950 MHz