Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR52575
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Stagno, Jason; Deme, Justin; Dwivedi, Vibha; Lee, Yun-Tzai; Lee, Hyun Kyung; Yu, Ping; Chen, Szu-Yun; Fan, Lixin; Degenhardt, Maximilia; Chari, Raj; Young, Howard; Lea, Susan; Wang, Yun-Xing. "Structural investigation of an RNA device that regulates PD-1 expression in mammalian cells" Nucleic Acids Res. 53, gkaf156-gkaf156 (2025).
PubMed: 40071935
Assembly members:
entity_1, polymer, 108 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GCAGGUACAUCCAGCUGAUG
AGUCCCAAAUAGGACAAAAA
GGGAGAGGUGAAGAAUACGA
CCACCUAGGCUCGAAAGAGC
CUAAAACAUACCUUUCCUGG
AUUCCUGC
| Data type | Count |
| 15N chemical shifts | 46 |
| 1H chemical shifts | 40 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | D43m3 | 1 |
Entity 1, D43m3 108 residues - Formula weight is not available
| 1 | G | C | A | G | G | U | A | C | A | U | ||||
| 2 | C | C | A | G | C | U | G | A | U | G | ||||
| 3 | A | G | U | C | C | C | A | A | A | U | ||||
| 4 | A | G | G | A | C | A | A | A | A | A | ||||
| 5 | G | G | G | A | G | A | G | G | U | G | ||||
| 6 | A | A | G | A | A | U | A | C | G | A | ||||
| 7 | C | C | A | C | C | U | A | G | G | C | ||||
| 8 | U | C | G | A | A | A | G | A | G | C | ||||
| 9 | C | U | A | A | A | A | C | A | U | A | ||||
| 10 | C | C | U | U | U | C | C | U | G | G | ||||
| 11 | A | U | U | C | C | U | G | C |
sample_1: D43m3 RNA apo-state, [U-99% 15N], 300 uM
sample_conditions_1: ionic strength: 0.02 M; pH: 6.5; pressure: 1 atm; temperature: 303 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N TROSY | sample_1 | isotropic | sample_conditions_1 |
| 2D HNN COSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
NMRPipe - processing
SPARKY - chemical shift assignment