Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR52285
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Liu, Yaping; Harkner, Cade; Westwood, Megan; Munsayac, Aldrex; Keane, Sarah. "Structural features within precursor microRNA-20a regulate Dicer-TRBP processing
" J. Mol. Biol. ., .-. (2025).
PubMed: 40609633
Assembly members:
entity_1, polymer, 73 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: In vitro transcription Host organism: In vitro
Entity Sequences (FASTA):
entity_1: GGUAGCACUAAAGUGCUUAU
AGUGCAGGUAGUGUUUAGUU
AUCUACUGCAUUAUGAGCAC
UUAAAGUACUGCC
| Data type | Count |
| 13C chemical shifts | 81 |
| 15N chemical shifts | 33 |
| 1H chemical shifts | 348 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | pre-miR-20a | 1 |
Entity 1, pre-miR-20a 73 residues - Formula weight is not available
| 1 | G | G | U | A | G | C | A | C | U | A | ||||
| 2 | A | A | G | U | G | C | U | U | A | U | ||||
| 3 | A | G | U | G | C | A | G | G | U | A | ||||
| 4 | G | U | G | U | U | U | A | G | U | U | ||||
| 5 | A | U | C | U | A | C | U | G | C | A | ||||
| 6 | U | U | A | U | G | A | G | C | A | C | ||||
| 7 | U | U | A | A | A | G | U | A | C | U | ||||
| 8 | G | C | C |
sample_1: pre-miR-20a 600 uM; potassium phosphate 50 mM
sample_conditions_1: ionic strength: 0.05 M; pH: 7.5; pressure: 1 atm; temperature: 310 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-13C HSQC/HMQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
TOPSPIN - collection
NMRFx Analyst - processing
NMRViewJ - chemical shift assignment