Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR52280
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Liu, Yaping; Harkner, Cade; Westwood, Megan; Munsayac, Aldrex; Keane, Sarah. "Structural features within precursor microRNA-20a regulate Dicer-TRBP processing
" J. Mol. Biol. ., .-. (2025).
PubMed: 40609633
Assembly members:
entity_1, polymer, 31 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: In vitro transcription Host organism: In vitro
Entity Sequences (FASTA):
entity_1: GGUAGUGCAGGUAGGAGACU
ACUGCAUUACC
| Data type | Count |
| 13C chemical shifts | 39 |
| 1H chemical shifts | 145 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | 20a-Frag3 | 1 |
Entity 1, 20a-Frag3 31 residues - Formula weight is not available
| 1 | G | G | U | A | G | U | G | C | A | G | ||||
| 2 | G | U | A | G | G | A | G | A | C | U | ||||
| 3 | A | C | U | G | C | A | U | U | A | C | ||||
| 4 | C |
sample_1: 20a-Frag3 500 uM; potassium phosphate 50 mM
sample_conditions_1: ionic strength: 0.05 M; pH: 7.5; pressure: 1 atm; temperature: 310 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-13C HMQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
TOPSPIN - collection
NMRFx Analyst - processing
NMRViewJ - chemical shift assignment