Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR52000
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Stagno, Jason; Deme, Justin; Dwivedi, Vibha; Lee, Yun-Tzai; Lee, Hyun Kyung; Yu, Ping; Chen, Szu-Yun; Fan, Lixin; Degenhardt, Maximilia; Chari, Raj; Young, Howard; Lea, Susan; Wang, Yun-Xing. "Structural investigation of an RNA device that regulates PD-1 expression in mammalian cells
" Nucleic Acids Res. 53, gkaf156-gkaf156 (2025).
PubMed: 40071935
Assembly members:
entity_1, polymer, 108 residues, Formula weight is not available
entity_MG, non-polymer, 24.305 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: in vitro transcription Host organism: not applicable
Entity Sequences (FASTA):
entity_1: GCAGGUACAUCCAGCUGAUG
AGUCCCAAAUAGGACAAAAA
GGGAGAGGUGAAGAAUACGA
CCACCUAGGCUCGAAAGAGC
CUAAAACAUACCUUUCCUGG
AUUCCUGC
| Data type | Count |
| 15N chemical shifts | 82 |
| 1H chemical shifts | 46 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA aptazyme device | 1 |
| 2 | Magnesium ion, 1 | 2 |
| 3 | Magnesium ion, 2 | 2 |
| 4 | Magnesium ion, 3 | 2 |
| 5 | Magnesium ion, 4 | 2 |
| 6 | Magnesium ion, 5 | 2 |
| 7 | Magnesium ion, 6 | 2 |
| 8 | Magnesium ion, 7 | 2 |
| 9 | Magnesium ion, 8 | 2 |
| 10 | Magnesium ion, 9 | 2 |
| 11 | Magnesium ion, 10 | 2 |
| 12 | Magnesium ion, 11 | 2 |
| 13 | Magnesium ion, 12 | 2 |
Entity 1, RNA aptazyme device 108 residues - Formula weight is not available
| 1 | G | C | A | G | G | U | A | C | A | U | ||||
| 2 | C | C | A | G | C | U | G | A | U | G | ||||
| 3 | A | G | U | C | C | C | A | A | A | U | ||||
| 4 | A | G | G | A | C | A | A | A | A | A | ||||
| 5 | G | G | G | A | G | A | G | G | U | G | ||||
| 6 | A | A | G | A | A | U | A | C | G | A | ||||
| 7 | C | C | A | C | C | U | A | G | G | C | ||||
| 8 | U | C | G | A | A | A | G | A | G | C | ||||
| 9 | C | U | A | A | A | A | C | A | U | A | ||||
| 10 | C | C | U | U | U | C | C | U | G | G | ||||
| 11 | A | U | U | C | C | U | G | C |
Entity 2, Magnesium ion, 1 - Mg - 24.305 Da.
| 1 | MG |
sample_1: RNA aptazyme apo-state, [U-100% 15N], 250 uM; Potassium chloride 50 mM; Magnesium chloride 1 mM
sample_conditions_1: ionic strength: 0.15 M; pH: 6.5; pressure: 1 atm; temperature: 303 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N TROSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D HNN COSY | sample_1 | isotropic | sample_conditions_1 |
| 3D 15N-separated NOESY | sample_1 | isotropic | sample_conditions_1 |
NMRPipe v11.5 - processing
Poky - chemical shift assignment