Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51956
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Korn, Sophie; Dhamotharan, Karthikeyan; Jeffries, Cy; Schlundt, Andreas. "The preference signature of the SARS-CoV-2 Nucleocapsid NTD for its 5'-genomic RNA elements
" Nat. Commun. 14, 3331-3331 (2023).
PubMed: 37286558
Assembly members:
entity_1, polymer, 69 residues, Formula weight is not available
Natural source: Common Name: SARS-CoV-2 Taxonomy ID: 2697049 Superkingdom: Viruses Kingdom: not available Genus/species: Betacoronavirus HCoV-SARS
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GGUCUGUGUGGCUGUCACUC
GGCUGCAUGCUUAGUGCACU
CACGCAGUAUAAUUAAUAAC
UAAUUACUG
| Data type | Count |
| 15N chemical shifts | 20 |
| 1H chemical shifts | 20 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | SL4ext | 1 |
Entity 1, SL4ext 69 residues - Formula weight is not available
The first two Gs 1+2, are artificially included to enable efficient IVT. The natural sequence (Wuhan) starts with U83, which is represented by U3 in this entry.
| 1 | G | G | U | C | U | G | U | G | U | G | ||||
| 2 | G | C | U | G | U | C | A | C | U | C | ||||
| 3 | G | G | C | U | G | C | A | U | G | C | ||||
| 4 | U | U | A | G | U | G | C | A | C | U | ||||
| 5 | C | A | C | G | C | A | G | U | A | U | ||||
| 6 | A | A | U | U | A | A | U | A | A | C | ||||
| 7 | U | A | A | U | U | A | C | U | G |
sample_1: SL4ext, [U-99% 15N], 600 ± 12 uM; potassium phosphate 25 ± 0.25 mM; potassium chloride 150 ± 1.5 mM
sample_conditions_1: ionic strength: 150 mM; pH: 6.5; pressure: 1 atm; temperature: 278 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 1D 1H | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N TROSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
TOPSPIN vv3, v4 - chemical shift assignment, collection, data analysis, processing
ANALYSIS v2.4 - chemical shift assignment, data analysis