Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51809
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Wang, Yaqiang; He, Yao; Wang, Yanjiao; Yang, Yuan; Singh, Mahavir; Eichhom, Catherine; Cheng, Xinyi; Jiang, Yi Xiao; Zhou, Z.Hong; Feigon, Juli. "Structure of LARP7 Protein p65-telomerase RNA Complex in Telomerase Revealed by Cryo-EM and NMR" J. Mol. Biol. 435, 168044-168044 (2023).
PubMed: 37330293
Assembly members:
entity_1, polymer, 21 residues, Formula weight is not available
Natural source: Common Name: Tetrahymena Thermophilia Taxonomy ID: 5911 Superkingdom: Eukaryota Kingdom: not available Genus/species: Tetrahymena Thermophilia
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: AUACCCGCUUCGGCGGGACA
A
| Data type | Count |
| 1H chemical shifts | 9 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | stem 1 hairpin with linker of Tetrahymena telomerase RNA | 1 |
Entity 1, stem 1 hairpin with linker of Tetrahymena telomerase RNA 21 residues - Formula weight is not available
| 1 | A | U | A | C | C | C | G | C | U | U | ||||
| 2 | C | G | G | C | G | G | G | A | C | A | ||||
| 3 | A |
sample_1: stem 1 hairpin of Tetrahymena telomerase RNA with ACAA linker 0.05 mM; D2O, [U-100% 2H], 10%; sodium phosphate 10 mM; potassium chloride 50 mM; H2O 90%
sample_conditions_1: ionic strength: 0.06 M; pH: 6.4; pressure: 1 atm; temperature: 283 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 1D 1H | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
TOPSPIN - collection
NMRFAM-SPARKY - chemical shift assignment
NMRDraw - processing
NMRPipe - processing