Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51698
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Ma, Sicong; Kotar, Anita; Hall, Ian; Grote, Scott; Rouskin, Silvi; Keane, Sarah. "Structure of pre-miR-31 reveals an active role in Dicer-TRBP complex processing" Proc. Natl. Acad. Sci. U. S. A. 120, e2300527120-e2300527120 (2023).
PubMed: 37725636
Assembly members:
entity_1, polymer, 33 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GGCAUAGCUGUUGAACUGGG
AACCUGCUAUGCC
Data type | Count |
13C chemical shifts | 39 |
1H chemical shifts | 155 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | pre-miR-31 Top | 1 |
Entity 1, pre-miR-31 Top 33 residues - Formula weight is not available
1 | G | G | C | A | U | A | G | C | U | G | ||||
2 | U | U | G | A | A | C | U | G | G | G | ||||
3 | A | A | C | C | U | G | C | U | A | U | ||||
4 | G | C | C |
sample_1: pre-miR-31 Top 0.4 mM; potassium phosphate 50 mM; MgCl2 1 mM; D2O, [U-100% 2H], 100%
sample_2: pre-miR-31 Top, [U-100% 2H], 0.4 mM; potassium phosphate 50 mM; MgCl2 1 mM; D2O, [U-100% 2H], 100%
sample_conditions_1: ionic strength: 0.0025 M; pH: 7.5; pressure: 1 atm; temperature: 303 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-13C HMQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H TOCSY | sample_2 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
NMRViewJ v9.2.0-b24 - chemical shift assignment