Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51244
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Han, Ge; Xue, Yi. "Rational design of hairpin RNA excited states reveals multi-step transitions" Nat. Commun. 13, 1523-1523 (2022).
PubMed: 35314698
Assembly members:
entity_1, polymer, 36 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: in vitro transcription Host organism: in vitro transcription
Entity Sequences (FASTA):
entity_1: GGCGCGAAAGGGAAGGGCAA
CUUUCUAAAACGCGCC
| Data type | Count |
| 15N chemical shifts | 14 |
| 1H chemical shifts | 14 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | T1-add1bp RNA | 1 |
Entity 1, T1-add1bp RNA 36 residues - Formula weight is not available
| 1 | G | G | C | G | C | G | A | A | A | G | ||||
| 2 | G | G | A | A | G | G | G | C | A | A | ||||
| 3 | C | U | U | U | C | U | A | A | A | A | ||||
| 4 | C | G | C | G | C | C |
sample_1: T1-add1bp RNA 2.90 mM; sodium phosphate 10 mM; EDTA 0.01 mM; H2O 90%; D2O 10%
sample_conditions_1: ionic strength: 0.01 M; pH: 6.4; pressure: 1 atm; temperature: 283.15 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HMQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
TOPSPIN - collection
NMRPipe - processing
SPARKY - chemical shift assignment, peak picking