Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50929
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Liu, Yaping; Kotar, Anita; Hodges, Tracy; Abdallah, Kyrillos; Taleb, Mallak; Bitterman, Brayden; Jaime, Sara; Schaubroeck, Kyle; Mathew, Ethan; Morgenstern, Nick; Lohmeier, Anthony; Page, Jordan; Ratanapanichkich, Matt; Arhin, Grace; Johnson, Breanna; Cherepanov, Stanislav; Moss, Stephen; Zuniga, Gisselle; Tilson, Nicholas; Yeoh, Zoe; Johnson, Bruce; Keane, Sarah. "NMR chemical shift assignments of RNA oligonucleotides to expand the RNA chemical shift database
" Biomol. NMR Assign. 15, 479-490 (2021).
PubMed: 34449019
Assembly members:
entity_1, polymer, 22 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: In vitro transcription Host organism: In vitro
Entity Sequences (FASTA):
entity_1: GGCAUUGCUGAGAAGCAAUG
CC
| Data type | Count |
| 13C chemical shifts | 28 |
| 1H chemical shifts | 117 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA23 | 1 |
Entity 1, RNA23 22 residues - Formula weight is not available
| 1 | G | G | C | A | U | U | G | C | U | G | ||||
| 2 | A | G | A | A | G | C | A | A | U | G | ||||
| 3 | C | C |
sample_1: RNA23 400 uM; potassium phosphate 50 mM
sample_conditions_1: ionic strength: 0.05 M; pH: 7.4; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-13C HMQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
TOPSPIN v4.0.9 - collection
NMRFx Analyst - processing
NMRPipe - processing
NMRViewJ - chemical shift assignment