Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50637
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Dagenais, Pierre; Desjardins, Genevieve; Legault, Pascale. "An integrative NMR-SAXS approach for structural determination of large RNAs defines the substrate-free state of a trans-cleaving Neurospora Varkud Satellite ribozyme
" Nucleic Acids Res. 49, 11959-11973 (2021).
PubMed: 34718697
Assembly members:
entity_1, polymer, 101 residues, 32652.55626 Da.
Natural source: Common Name: Neurospora crassa Taxonomy ID: 5141 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Neurospora crassa
Experimental source: Production method: recombinant technology Host organism: Synthetic Vector: pTZ19R-derived plasmid
Entity Sequences (FASTA):
entity_1: GCAGGGAACUCACCUCCCCU
UGGGUCGUAGCAGUUGACUA
CUGUUAUGUGAUUGGUAGAG
GCUAAGUGACGCCGUAAGGC
GCAGCACAGCACAAGCCCGC
G
| Data type | Count |
| 15N chemical shifts | 78 |
| 1H chemical shifts | 78 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | Minimal trans VS ribozyme | 1 |
Entity 1, Minimal trans VS ribozyme 101 residues - 32652.55626 Da.
| 1 | G | C | A | G | G | G | A | A | C | U | ||||
| 2 | C | A | C | C | U | C | C | C | C | U | ||||
| 3 | U | G | G | G | U | C | G | U | A | G | ||||
| 4 | C | A | G | U | U | G | A | C | U | A | ||||
| 5 | C | U | G | U | U | A | U | G | U | G | ||||
| 6 | A | U | U | G | G | U | A | G | A | G | ||||
| 7 | G | C | U | A | A | G | U | G | A | C | ||||
| 8 | G | C | C | G | U | A | A | G | G | C | ||||
| 9 | G | C | A | G | C | A | C | A | G | C | ||||
| 10 | A | C | A | A | G | C | C | C | G | C | ||||
| 11 | G |
sample_1: TR4P, [U-15N], 1.7 mM; Na cacodylate 10 mM; KCl 50 mM; MgCl2 5 mM; NaN3 0.05 mM
sample_conditions_1: pH: 6.500; pressure: 1.000 atm; temperature: 288.000 K
sample_conditions_2: pH: 6.500; pressure: 1.000 atm; temperature: 298.000 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC/HMQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC/HMQC | sample_1 | isotropic | sample_conditions_2 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_2 |
CcpNmr Analysis v2.5 - Chemical shift assignments, data analysis
NMRPipe v9.7 - Data processing, data analysis