Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50572
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Soni, Komal; Kempf, Georg; Manalastas-Cantos, Karen; Hendricks, Astrid; Flemming, Dirk; Guizetti, Julien; Simon, Bernd; Frischknecht, Friedrich; Svergun, Dmitri; Wild, Klemens; Sinning, Irmgard. "Structural analysis of the SRP Alu domain from Plasmodium falciparum reveals a non-canonical open conformation
" Commun. Biol. 4, 600-600 (2021).
PubMed: 34017052
Assembly members:
entity_1, polymer, 43 residues, Formula weight is not available
Natural source: Common Name: Plasmodium falciparum Taxonomy ID: 5833 Superkingdom: Eukaryota Kingdom: not available Genus/species: Plasmodium falciparum
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GGCUAUAAUAUUUCUGAGAG
UAAUCUCAUAAGUAUAAUAU
GUA
| Data type | Count |
| 1H chemical shifts | 15 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | PfAlu Helix5 | 1 |
Entity 1, PfAlu Helix5 43 residues - Formula weight is not available
Due to insertion of a closing tetraloop inplace of the S-domain, the numbering is such that after the tetraloop at A98, orginal sequence numbering from U279 to U298 is continued.
| 1 | G | G | C | U | A | U | A | A | U | A | ||||
| 2 | U | U | U | C | U | G | A | G | A | G | ||||
| 3 | U | A | A | U | C | U | C | A | U | A | ||||
| 4 | A | G | U | A | U | A | A | U | A | U | ||||
| 5 | G | U | A |
sample_1: PfAlu Helix5 275 uM; sodium phosphate 20 mM
sample_conditions_1: pH: 6.8; pressure: 1 atm; temperature: 277 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
CcpNMR - chemical shift assignment