Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50237
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Nishikawa, Tadateru; Wojciak, Jonathan; Dyson, Helen Jane; Wright, Peter. "RNA Binding by the KTS Splice Variants of Wilms' Tumor Suppressor Protein WT1
" Biochemistry 59, 3889-3901 (2020).
PubMed: 32955251
Assembly members:
entity_1, polymer, 29 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GGGCCACCAACGACAUUGAU
AUGGUGCCC
| Data type | Count |
| 13C chemical shifts | 179 |
| 15N chemical shifts | 6 |
| 1H chemical shifts | 211 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA | 1 |
Entity 1, RNA 29 residues - Formula weight is not available
| 1 | G | G | G | C | C | A | C | C | A | A | ||||
| 2 | C | G | A | C | A | U | U | G | A | U | ||||
| 3 | A | U | G | G | U | G | C | C | C |
sample_1: aptamer RNA, [U-99% 13C; U-99% 15N], 0.55 ± 0.1 mM; TRIS, [U-100% 2H], 10 ± 0.1 mM; potassium chloride 350 ± 0.5 mM; DTT 10 ± 0.1 mM; ZnSO4 5 ± 0.1 uM; sodium azide 2 ± 0.1 mM
sample_2: aptamer RNA, [U-100% 15N], 0.55 ± 0.1 mM; TRIS, [U-100% 2H], 10 ± 0.1 mM; potassium chloride 350 ± 0.5 mM; DTT 10 ± 0.1 mM; ZnSO4 5 ± 0.1 uM; sodium azide 2 ± 0.1 mM
sample_conditions_1: ionic strength: 350 mM; pH: 7.1; pressure: 1 atm; temperature: 310 K
sample_conditions_2: ionic strength: 350 mM; pH: 7.1; pressure: 1 atm; temperature: 280 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 3D HCCH-COSY | sample_1 | isotropic | sample_conditions_1 |
| 3D HMQC-NOESY | sample_1 | isotropic | sample_conditions_1 |
NMRPipe - processing
NMRView - chemical shift assignment, data analysis, peak picking