Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR4346
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Mao, Hongyuan; White, Susan; Williamson, james. "A Novel Loop-loop Recognition Motif in the Yeast Ribosomal Protein L30
Autoregulatory RNA Complex" Nat. Struct. Biol. 6, 1139-1147 (1999).
Assembly members:
L30 MRNA, polymer, 33 residues, Formula weight is not available
Natural source: Common Name: BAKER'S YEAST Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: FUNGI Genus/species: SACCHAROMYCES CEREVISIAE
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
L30 MRNA: GGACCGGAGUGUCGCAAGAC
GCAGAGAUGGUCC
| Data type | Count |
| 13C chemical shifts | 193 |
| 15N chemical shifts | 24 |
| 1H chemical shifts | 255 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | L30RNA | 1 |
Entity 1, L30RNA 33 residues - Formula weight is not available
| 1 | G | G | A | C | C | G | G | A | G | U | ||||
| 2 | G | U | C | G | C | A | A | G | A | C | ||||
| 3 | G | C | A | G | A | G | A | U | G | G | ||||
| 4 | U | C | C |
SAMPLE_1: L30 MRNA, N/A, 1.8 mM
SAMPLE_2: L30 MRNA, [U-99% 13C; U-99% 15N], 0.9 mM
SAMPLE_3: L30 MRNA, [U-95% 13C; U-99% 15N]-G, 0.5 mM
Ex-cond_1: ionic strength: 0.1 M; pH: 6.0; temperature: 288 K
| Name | Sample | Sample state | Sample conditions |
|---|
NMRPipe -