Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR4125
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Glemarec, C.; Kufel, J.; Foldesi, A.; Maltseva, T.; Sandstrom, A.; Kirsebom, L.; Chattopadhyaya, J.. "The NMR Structure of 31mer RNA Domain of Escherichia Coli RNase
P RNA Using Its Non-uniformly Deuterium Labelled Counterpart
[the 'NMR-window' concept]" Nucleic Acids Res. 24, 2022-2035 (1996).
Assembly members:
31mer_RNA_1, polymer, 31 residues, Formula weight is not available
Natural source: Common Name: E. coli Taxonomy ID: 562 Superkingdom: Eubacteria Kingdom: not available Genus/species: Escherichia coli
Experimental source: Production method: recombinant technology Host organism: Escherichia coli
Entity Sequences (FASTA):
31mer_RNA_1: GGCCAAAUAGGGGCUUCGGC
CCGGGUAGGCU
| Data type | Count |
| 1H chemical shifts | 192 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | 31mer_RNA_1 | 1 |
Entity 1, 31mer_RNA_1 31 residues - Formula weight is not available
| 1 | G | G | C | C | A | A | A | U | A | G | ||||
| 2 | G | G | G | C | U | U | C | G | G | C | ||||
| 3 | C | C | G | G | G | U | A | G | G | C | ||||
| 4 | U |
sample_one: 31mer_RNA_1, [U-99%-2H]-C, 1 mM; NaHPO4 10 mM; NaCl 50 mM; EDTA 0.1 mM
sample_two: 31mer_RNA_1 1 mM; NaHPO4 10 mM; NaCl 50 mM; EDTA 0.1 mM
sample_conditions_one: pH: 6.2; temperature: 299 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| not available | not available | not available | not available |
No software information available